Starting /dee2/code/volunteer_pipeline.sh SRR6031165 current disk space = 1523553529856 free memory = 1598594284 SRR6031165 SRAfilesize 657ee191ea21882fcc8bfe93a21ffbdb SRR6031165.sra SRR6031165.sra file validated SRR6031165 is paired end SRR6031165 is conventional basespace SRR6031165 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031165_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.76975 33.0 32.0 33.0 30.0 33.0 2 32.99575 33.0 33.0 34.0 33.0 34.0 3 33.15025 33.0 33.0 34.0 33.0 34.0 4 33.51325 34.0 33.0 34.0 33.0 34.0 5 33.68725 34.0 34.0 34.0 33.0 34.0 6 37.5355 38.0 38.0 38.0 37.0 38.0 7 37.74925 38.0 38.0 38.0 38.0 38.0 8 37.80475 38.0 38.0 38.0 38.0 38.0 9 37.837 38.0 38.0 38.0 38.0 38.0 10-14 37.8243 38.0 38.0 38.0 38.0 38.0 15-19 37.833600000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.828250000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.8091 38.0 38.0 38.0 38.0 38.0 30-34 37.79469999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.792199999999994 38.0 38.0 38.0 38.0 38.0 40-44 37.762150000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.770250000000004 38.0 38.0 38.0 38.0 38.0 50-54 37.6589 38.0 38.0 38.0 38.0 38.0 55-59 37.6414 38.0 38.0 38.0 38.0 38.0 60-64 37.6396 38.0 38.0 38.0 38.0 38.0 65-69 37.616249999999994 38.0 38.0 38.0 38.0 38.0 70-74 37.6163 38.0 38.0 38.0 38.0 38.0 75-79 37.58005000000001 38.0 38.0 38.0 38.0 38.0 80-84 37.530649999999994 38.0 38.0 38.0 38.0 38.0 85-89 37.47695 38.0 38.0 38.0 38.0 38.0 90-94 37.49059999999999 38.0 38.0 38.0 38.0 38.0 95-99 37.4591 38.0 38.0 38.0 38.0 38.0 100-104 37.387350000000005 38.0 38.0 38.0 37.2 38.0 105-109 37.306450000000005 38.0 38.0 38.0 37.0 38.0 110-114 37.27515 38.0 38.0 38.0 36.8 38.0 115-119 37.1885 38.0 38.0 38.0 36.4 38.0 120-124 37.10195 38.0 38.0 38.0 36.0 38.0 125-129 37.0382 38.0 38.0 38.0 36.0 38.0 130-134 36.88945 38.0 38.0 38.0 35.6 38.0 135-139 36.8361 38.0 38.0 38.0 35.2 38.0 140-144 36.680699999999995 38.0 38.0 38.0 35.0 38.0 145-149 36.41175 38.0 38.0 38.0 35.0 38.0 150-151 34.51375 38.0 36.0 38.0 29.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 0.0 16 2.0 17 1.0 18 2.0 19 2.0 20 1.0 21 2.0 22 2.0 23 2.0 24 7.0 25 3.0 26 4.0 27 6.0 28 8.0 29 6.0 30 11.0 31 12.0 32 20.0 33 37.0 34 37.0 35 75.0 36 261.0 37 3496.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.04666332162569 12.995484194681383 7.827395885599599 30.130456598093325 2 22.1 13.65 35.35 28.9 3 18.925 19.05 27.625 34.4 4 22.825 25.025 24.224999999999998 27.925 5 23.775 28.025 26.025 22.175 6 22.685069008782936 31.919698870765373 24.54203262233375 20.85319949811794 7 16.400000000000002 27.525 37.65 18.425 8 19.45 25.525 29.075 25.95 9 18.35 23.674999999999997 33.675 24.3 10-14 21.575 27.560000000000002 26.995 23.87 15-19 21.61 26.479999999999997 26.77 25.14 20-24 21.61 27.250000000000004 27.084999999999997 24.055 25-29 22.09 26.924999999999997 26.875 24.11 30-34 21.48 26.91 27.155 24.455 35-39 21.709999999999997 26.965 26.27 25.055 40-44 21.310000000000002 26.700000000000003 27.215 24.775 45-49 21.065 26.845000000000002 26.995 25.095 50-54 21.905 26.69 26.69 24.715 55-59 21.475 26.724999999999998 27.05 24.75 60-64 21.66 26.85 26.840000000000003 24.65 65-69 21.245 27.060000000000002 26.650000000000002 25.045 70-74 22.17 26.724999999999998 26.919999999999998 24.185000000000002 75-79 21.485000000000003 26.625 26.605 25.285000000000004 80-84 22.005 26.405 26.87 24.72 85-89 21.595 26.655 27.205000000000002 24.545 90-94 21.445 26.625 27.13 24.8 95-99 21.445 26.02 27.169999999999998 25.365 100-104 22.095000000000002 26.87 26.51 24.525 105-109 22.13 26.240000000000002 26.905 24.725 110-114 21.83 26.19 27.055 24.925 115-119 22.025 26.415 26.63 24.93 120-124 21.445 26.534999999999997 27.27 24.75 125-129 21.59 26.369999999999997 26.605 25.435000000000002 130-134 21.47 26.44 27.63 24.46 135-139 21.865000000000002 26.619999999999997 26.455000000000002 25.06 140-144 21.685 26.840000000000003 26.365 25.11 145-149 21.975 26.155 26.955000000000002 24.915000000000003 150-151 22.20555138784696 26.406601650412604 26.86921730432608 24.518629657414355 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 2.0 27 2.5 28 2.5 29 5.0 30 8.0 31 13.0 32 15.0 33 20.0 34 34.0 35 50.0 36 60.0 37 76.5 38 91.5 39 112.0 40 163.0 41 190.5 42 206.5 43 230.0 44 245.0 45 239.0 46 235.0 47 247.0 48 230.5 49 214.5 50 202.5 51 162.5 52 133.5 53 122.0 54 106.0 55 93.5 56 74.5 57 57.5 58 52.0 59 44.5 60 38.0 61 35.5 62 30.5 63 29.0 64 23.0 65 16.0 66 16.0 67 12.5 68 11.0 69 12.0 70 9.0 71 6.0 72 5.0 73 3.5 74 2.0 75 1.5 76 1.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.375 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.21250000000000002 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.225 0.0 0.0 0.0 0.0 122-123 0.225 0.0 0.0 0.0 0.0 124-125 0.2375 0.0 0.0 0.0 0.0 126-127 0.25 0.0 0.0 0.0 0.0 128-129 0.3 0.0 0.0 0.0 0.0 130-131 0.325 0.0 0.0 0.0 0.0 132-133 0.325 0.0 0.0 0.0 0.0 134-135 0.4125 0.0 0.0 0.0 0.0 136-137 0.44999999999999996 0.0 0.0 0.0 0.0 138-139 0.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGGGA 10 0.006832588 144.9875 145 TGTGTGC 10 0.006832588 144.9875 5 >>END_MODULE SRR6031165 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031165_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.29 34.0 33.0 34.0 33.0 34.0 2 33.45725 34.0 33.0 34.0 33.0 34.0 3 33.47525 34.0 33.0 34.0 33.0 34.0 4 33.4765 34.0 33.0 34.0 33.0 34.0 5 33.497 34.0 33.0 34.0 33.0 34.0 6 37.667 38.0 38.0 38.0 38.0 38.0 7 37.15175 38.0 38.0 38.0 37.0 38.0 8 37.499 38.0 38.0 38.0 38.0 38.0 9 37.57175 38.0 38.0 38.0 38.0 38.0 10-14 37.5906 38.0 38.0 38.0 38.0 38.0 15-19 37.5207 38.0 38.0 38.0 38.0 38.0 20-24 37.42315 38.0 38.0 38.0 38.0 38.0 25-29 37.56655 38.0 38.0 38.0 38.0 38.0 30-34 37.643150000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.658699999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.660000000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.63415 38.0 38.0 38.0 38.0 38.0 50-54 37.61845 38.0 38.0 38.0 38.0 38.0 55-59 37.57425 38.0 38.0 38.0 38.0 38.0 60-64 37.58505 38.0 38.0 38.0 38.0 38.0 65-69 37.604699999999994 38.0 38.0 38.0 38.0 38.0 70-74 37.38615 38.0 38.0 38.0 38.0 38.0 75-79 37.538149999999995 38.0 38.0 38.0 38.0 38.0 80-84 37.53595 38.0 38.0 38.0 38.0 38.0 85-89 37.536649999999995 38.0 38.0 38.0 38.0 38.0 90-94 37.47655 38.0 38.0 38.0 38.0 38.0 95-99 37.448350000000005 38.0 38.0 38.0 38.0 38.0 100-104 37.38835 38.0 38.0 38.0 38.0 38.0 105-109 37.1731 38.0 38.0 38.0 38.0 38.0 110-114 37.069449999999996 38.0 38.0 38.0 38.0 38.0 115-119 37.0309 38.0 38.0 38.0 37.0 38.0 120-124 37.110949999999995 38.0 38.0 38.0 37.0 38.0 125-129 37.158500000000004 38.0 38.0 38.0 36.6 38.0 130-134 37.09580000000001 38.0 38.0 38.0 36.0 38.0 135-139 37.04395 38.0 38.0 38.0 36.0 38.0 140-144 36.9647 38.0 38.0 38.0 36.0 38.0 145-149 36.80800000000001 38.0 38.0 38.0 36.0 38.0 150-151 34.886875 38.0 36.0 38.0 29.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 1.0 5 0.0 6 1.0 7 3.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 1.0 20 1.0 21 3.0 22 6.0 23 4.0 24 6.0 25 2.0 26 7.0 27 9.0 28 13.0 29 13.0 30 7.0 31 15.0 32 16.0 33 29.0 34 33.0 35 77.0 36 178.0 37 3566.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.65 22.5 9.625 25.224999999999998 2 27.900000000000002 28.050000000000004 25.900000000000002 18.15 3 20.96048024012006 28.639319659829916 28.96448224112056 21.435717858929465 4 25.137706559839764 31.74762143214822 21.407110665999 21.707561342013022 5 26.708385481852314 33.191489361702125 21.00125156445557 19.09887359198999 6 22.63631815907954 35.26763381690846 21.03551775887944 21.060530265132567 7 22.35 21.875 33.074999999999996 22.7 8 23.990975181749814 24.968663825520178 24.041113060917525 26.999247931812487 9 23.43945851090499 23.84056154424668 27.275006267234897 25.444973677613437 10-14 25.066372789660875 26.674347542954468 24.485297800931725 23.773981866452935 15-19 25.008784699563275 25.741679634556498 25.651322724762814 23.598212941117414 20-24 24.689183067398197 26.068354557809432 25.82674787335783 23.41571450143454 25-29 25.38068523342016 25.861550791424566 25.310559006211182 23.4472049689441 30-34 25.124999999999996 26.455000000000002 25.71 22.71 35-39 25.069999999999997 26.295 25.535000000000004 23.1 40-44 25.025 26.924999999999997 24.55 23.5 45-49 24.69 26.575 25.245 23.49 50-54 25.369999999999997 26.52 25.045 23.064999999999998 55-59 25.55638909727432 26.65666416604151 24.901225306326584 22.885721430357588 60-64 25.115 25.929999999999996 25.655 23.3 65-69 25.16 26.41 25.374999999999996 23.055 70-74 24.80927524593455 26.65127484440875 25.235896406344104 23.30355350331259 75-79 25.11 26.255 25.415 23.22 80-84 25.46 26.245 25.545 22.75 85-89 25.7 26.625 25.285000000000004 22.39 90-94 25.064999999999998 25.929999999999996 26.08 22.925 95-99 25.4 26.265 25.435000000000002 22.900000000000002 100-104 25.6 26.375 25.2 22.825 105-109 25.577068141815438 26.43198390746794 25.340709077193864 22.650238873522756 110-114 25.214192117730068 27.199879044451166 25.022679165406714 22.563249672412056 115-119 24.846471358099265 26.52773583006141 25.802879291251386 22.82291352058794 120-124 25.105273711650288 26.734509725285744 26.08281531983156 22.0774012432324 125-129 25.445 26.415 25.645 22.495 130-134 25.53 26.625 25.56 22.285 135-139 25.345000000000002 26.779999999999998 25.55 22.325 140-144 25.495 27.134999999999998 24.825 22.545 145-149 25.27 26.729999999999997 25.6 22.400000000000002 150-151 24.637500000000003 27.025 25.924999999999997 22.412499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 0.5 26 1.0 27 2.0 28 2.0 29 3.0 30 3.5 31 5.5 32 11.5 33 16.0 34 23.0 35 32.5 36 47.0 37 65.5 38 93.0 39 120.0 40 147.0 41 182.5 42 194.5 43 206.5 44 233.5 45 245.0 46 229.0 47 218.5 48 209.5 49 176.5 50 154.5 51 139.5 52 121.5 53 104.5 54 97.5 55 94.5 56 74.5 57 68.0 58 71.5 59 66.5 60 54.0 61 54.5 62 60.0 63 53.0 64 47.5 65 40.0 66 40.0 67 43.0 68 36.5 69 29.0 70 20.5 71 16.5 72 17.5 73 9.5 74 6.5 75 4.5 76 0.5 77 2.0 78 1.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.05 4 0.15 5 0.125 6 0.05 7 0.0 8 0.27499999999999997 9 0.27499999999999997 10-14 0.185 15-19 0.395 20-24 0.6649999999999999 25-29 0.18 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.025 60-64 0.0 65-69 0.0 70-74 0.38 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.575 110-114 0.79 115-119 0.67 120-124 0.26 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.21250000000000002 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.225 0.0 0.0 0.0 0.0 122-123 0.225 0.0 0.0 0.0 0.0 124-125 0.2375 0.0 0.0 0.0 0.0 126-127 0.25 0.0 0.0 0.0 0.0 128-129 0.3 0.0 0.0 0.0 0.0 130-131 0.325 0.0 0.0 0.0 0.0 132-133 0.325 0.0 0.0 0.0 0.0 134-135 0.4125 0.0 0.0 0.0 0.0 136-137 0.44999999999999996 0.0 0.0 0.0 0.0 138-139 0.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 322450 spots for SRR6031165.sra Written 322450 spots for SRR6031165.sra Read 322450 spots for SRR6031165.sra Written 322450 spots for SRR6031165.sra Read 322450 spots for SRR6031165.sra Written 322450 spots for SRR6031165.sra Read 322450 spots for SRR6031165.sra Written 322450 spots for SRR6031165.sra Read 322450 spots for SRR6031165.sra Written 322450 spots for SRR6031165.sra Read 322450 spots for SRR6031165.sra Written 322450 spots for SRR6031165.sra Read 322450 spots for SRR6031165.sra Written 322450 spots for SRR6031165.sra Read 322450 spots for SRR6031165.sra Written 322450 spots for SRR6031165.sra Read 322450 spots for SRR6031165.sra Written 322450 spots for SRR6031165.sra Read 322450 spots for SRR6031165.sra Written 322450 spots for SRR6031165.sra Read 322450 spots for SRR6031165.sra Written 322450 spots for SRR6031165.sra Read 322450 spots for SRR6031165.sra Written 322450 spots for SRR6031165.sra Read 322450 spots for SRR6031165.sra Written 322450 spots for SRR6031165.sra Read 322450 spots for SRR6031165.sra Written 322450 spots for SRR6031165.sra Read 322450 spots for SRR6031165.sra Written 322450 spots for SRR6031165.sra Read 322450 spots for SRR6031165.sra Written 322450 spots for SRR6031165.sra Read 322450 spots for SRR6031165.sra Written 322450 spots for SRR6031165.sra Read 322450 spots for SRR6031165.sra Written 322450 spots for SRR6031165.sra Read 322452 spots for SRR6031165.sra Written 322452 spots for SRR6031165.sra Read 322450 spots for SRR6031165.sra Written 322450 spots for SRR6031165.sra SRR ids: ['SRR6031165.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ji1oy2f0 SRR6031165.sra spots: 6449002 blocks: [[1, 322450], [322451, 644900], [644901, 967350], [967351, 1289800], [1289801, 1612250], [1612251, 1934700], [1934701, 2257150], [2257151, 2579600], [2579601, 2902050], [2902051, 3224500], [3224501, 3546950], [3546951, 3869400], [3869401, 4191850], [4191851, 4514300], [4514301, 4836750], [4836751, 5159200], [5159201, 5481650], [5481651, 5804100], [5804101, 6126550], [6126551, 6449002]] SRR6031165 file size 2170590 SRR6031165 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031165 SRR6031165_1.fastq SRR6031165_2.fastq Input file: SRR6031165_1.fastq Paired file: SRR6031165_2.fastq trimmed: SRR6031165-trimmed-pair1.fastq, SRR6031165-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:25:09 2024 >> started Tue Dec 10 00:25:17 2024 >> done (7.622s) 6449002 read pairs processed; of these: 4471 ( 0.07%) short read pairs filtered out after trimming by size control 3652 ( 0.06%) empty read pairs filtered out after trimming by size control 6440879 (99.87%) read pairs available; of these: 1269905 (19.72%) trimmed read pairs available after processing 5170974 (80.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 5 0.00% 21 3 0.00% 22 1 0.00% 23 5 0.00% 24 4 0.00% 25 1 0.00% 26 3 0.00% 27 6 0.00% 28 3 0.00% 29 4 0.00% 30 4 0.00% 31 3 0.00% 32 9 0.00% 33 4 0.00% 34 2 0.00% 35 4 0.00% 36 3 0.00% 37 8 0.00% 38 4 0.00% 39 3 0.00% 40 5 0.00% 41 3 0.00% 42 7 0.00% 43 4 0.00% 44 6 0.00% 45 5 0.00% 46 9 0.00% 47 4 0.00% 48 11 0.00% 49 8 0.00% 50 4 0.00% 51 15 0.00% 52 16 0.00% 53 8 0.00% 54 13 0.00% 55 7 0.00% 56 10 0.00% 57 13 0.00% 58 16 0.00% 59 18 0.00% 60 13 0.00% 61 23 0.00% 62 24 0.00% 63 28 0.00% 64 26 0.00% 65 28 0.00% 66 27 0.00% 67 38 0.00% 68 45 0.00% 69 39 0.00% 70 41 0.00% 71 45 0.00% 72 62 0.00% 73 71 0.00% 74 62 0.00% 75 64 0.00% 76 71 0.00% 77 94 0.00% 78 97 0.00% 79 109 0.00% 80 121 0.00% 81 121 0.00% 82 144 0.00% 83 149 0.00% 84 356 0.01% 85 482 0.01% 86 542 0.01% 87 681 0.01% 88 805 0.01% 89 834 0.01% 90 835 0.01% 91 734 0.01% 92 737 0.01% 93 708 0.01% 94 776 0.01% 95 658 0.01% 96 645 0.01% 97 656 0.01% 98 714 0.01% 99 708 0.01% 100 768 0.01% 101 758 0.01% 102 826 0.01% 103 810 0.01% 104 898 0.01% 105 920 0.01% 106 997 0.02% 107 993 0.02% 108 1065 0.02% 109 1157 0.02% 110 1289 0.02% 111 1319 0.02% 112 1458 0.02% 113 1618 0.03% 114 1944 0.03% 115 2185 0.03% 116 2455 0.04% 117 2266 0.04% 118 2026 0.03% 119 1818 0.03% 120 2008 0.03% 121 2026 0.03% 122 2205 0.03% 123 2313 0.04% 124 2323 0.04% 125 2458 0.04% 126 2494 0.04% 127 2584 0.04% 128 2669 0.04% 129 2797 0.04% 130 2714 0.04% 131 3017 0.05% 132 3262 0.05% 133 3421 0.05% 134 3793 0.06% 135 4086 0.06% 136 4283 0.07% 137 4607 0.07% 138 5215 0.08% 139 5691 0.09% 140 6279 0.10% 141 6923 0.11% 142 7635 0.12% 143 9062 0.14% 144 10859 0.17% 145 13564 0.21% 146 18106 0.28% 147 25646 0.40% 148 43129 0.67% 149 98711 1.53% 150 925779 14.37% 151 5170974 80.28% 6440879 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=7.74 fanout-score-rank=16 prefix-density=0.25 prefix-fanout=4.7 sequence=ATCATCTGCTTCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=13 fanout-score=337.91 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=31.3 sequence=CTTCTTCTTGAT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=6.97 fanout-score-rank=19 prefix-density=0.27 prefix-fanout=4.9 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=537.46 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=18.9 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR6031165 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:26:13 Started mapping on | Dec 10 00:26:13 Finished on | Dec 10 00:27:24 Mapping speed, Million of reads per hour | 326.58 Number of input reads | 6440879 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 6084202 Uniquely mapped reads % | 94.46% Average mapped length | 300.29 Number of splices: Total | 7235257 Number of splices: Annotated (sjdb) | 6905314 Number of splices: GT/AG | 7143732 Number of splices: GC/AG | 81797 Number of splices: AT/AC | 5300 Number of splices: Non-canonical | 4428 Mismatch rate per base, % | 0.06% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 64932 % of reads mapped to multiple loci | 1.01% Number of reads mapped to too many loci | 4874 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.88% % of reads unmapped: other | 0.57% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 295840 295840 295840 N_multimapping 64932 64932 64932 N_noFeature 176489 5930420 213087 N_ambiguous 137066 1269 19869 UnstrandedReadsAssigned:5770647 PositiveStrandReadsAssigned:152513 NegativeStrandReadsAssigned:5851246 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6031165 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6031165-trimmed-pair1.fastq SRR6031165-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,440,879 reads, 5,880,498 reads pseudoaligned [quant] estimated average fragment length: 450.285 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52973 SRR6031165.ke.tsv 35125 SRR6031165.se.tsv 88098 total ==> SRR6031165.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 488.66 0 0 PNS24247 1044 594.715 39.9253 16.1456 PNS24249 1928 1478.72 15.6716 2.54885 PNS24246 1044 594.715 39.9253 16.1456 PNS24248 1044 594.715 39.9253 16.1456 PNS24244 1471 1021.72 10.5527 2.48399 PNS24243 293 61.41 0 0 KQK14069 1603 1153.72 710.851 148.182 KQK14071 474 126.444 0 0 ==> SRR6031165.se.tsv <== BRADI_1g14170v3 757 BRADI_1g53295v3 23 BRADI_1g59795v3 127 BRADI_1g07683v3 0 BRADI_1g00485v3 33 BRADI_1g20270v3 353 BRADI_1g74790v3 84 BRADI_1g09890v3 0 BRADI_1g77505v3 52 BRADI_1g48960v3 0 SRR6031165 completed mapping pipeline successfully