Starting /dee2/code/volunteer_pipeline.sh SRR6031166 current disk space = 1523598028800 free memory = 1563155704 SRR6031166 SRAfilesize 56d3b746f1b95fe31c5afa93fc41bc85 SRR6031166.sra SRR6031166.sra file validated SRR6031166 is paired end SRR6031166 is conventional basespace SRR6031166 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031166_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.49925 25.0 18.0 33.0 18.0 33.0 2 28.72725 32.0 27.0 32.0 18.0 33.0 3 31.04225 31.0 30.0 33.0 28.0 33.0 4 31.797 33.0 32.0 33.0 30.0 33.0 5 32.50925 33.0 33.0 33.0 32.0 33.0 6 37.206 38.0 37.0 38.0 36.0 38.0 7 37.59025 38.0 38.0 38.0 37.0 38.0 8 37.80575 38.0 38.0 38.0 38.0 38.0 9 37.72125 38.0 38.0 38.0 38.0 38.0 10-14 37.779700000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.78195 38.0 38.0 38.0 38.0 38.0 20-24 37.8104 38.0 38.0 38.0 38.0 38.0 25-29 37.7911 38.0 38.0 38.0 38.0 38.0 30-34 37.76635 38.0 38.0 38.0 38.0 38.0 35-39 37.7658 38.0 38.0 38.0 38.0 38.0 40-44 37.72520000000001 38.0 38.0 38.0 38.0 38.0 45-49 37.678450000000005 38.0 38.0 38.0 38.0 38.0 50-54 37.6534 38.0 38.0 38.0 38.0 38.0 55-59 37.6025 38.0 38.0 38.0 38.0 38.0 60-64 37.59155 38.0 38.0 38.0 38.0 38.0 65-69 37.580600000000004 38.0 38.0 38.0 38.0 38.0 70-74 37.53395 38.0 38.0 38.0 37.8 38.0 75-79 37.443650000000005 38.0 38.0 38.0 37.0 38.0 80-84 37.4207 38.0 38.0 38.0 37.0 38.0 85-89 37.3617 38.0 38.0 38.0 37.0 38.0 90-94 37.330349999999996 38.0 38.0 38.0 36.8 38.0 95-99 37.29025 38.0 38.0 38.0 37.0 38.0 100-104 37.1941 38.0 38.0 38.0 36.2 38.0 105-109 37.129949999999994 38.0 38.0 38.0 36.0 38.0 110-114 37.0343 38.0 38.0 38.0 36.0 38.0 115-119 36.941950000000006 38.0 38.0 38.0 35.4 38.0 120-124 36.768800000000006 38.0 38.0 38.0 35.0 38.0 125-129 36.66605 38.0 38.0 38.0 34.6 38.0 130-134 36.626450000000006 38.0 38.0 38.0 34.6 38.0 135-139 36.41375 38.0 38.0 38.0 34.0 38.0 140-144 36.18865 38.0 37.8 38.0 33.4 38.0 145-149 35.863600000000005 38.0 36.4 38.0 33.0 38.0 150-151 32.941125 37.0 33.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 2.0 17 1.0 18 1.0 19 3.0 20 0.0 21 0.0 22 3.0 23 1.0 24 4.0 25 4.0 26 1.0 27 5.0 28 5.0 29 13.0 30 6.0 31 12.0 32 31.0 33 64.0 34 87.0 35 181.0 36 532.0 37 3042.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.688144978605585 14.548200352378554 10.823055625471936 31.940599043543923 2 22.400000000000002 16.125 33.900000000000006 27.575 3 19.75 21.475 26.825 31.95 4 21.175 26.200000000000003 25.074999999999996 27.55 5 22.625 31.0 23.425 22.95 6 22.925 33.1 23.025000000000002 20.95 7 16.725 25.35 39.525 18.4 8 20.200000000000003 25.674999999999997 27.400000000000002 26.724999999999998 9 19.1 24.474999999999998 33.25 23.175 10-14 20.8 28.055000000000003 27.625 23.52 15-19 21.11 27.384999999999998 27.13 24.375 20-24 21.09 26.995 27.88 24.035 25-29 21.37 27.63 26.665 24.335 30-34 21.165 27.47 27.224999999999998 24.14 35-39 20.94 27.810000000000002 26.66 24.59 40-44 21.08 27.265 27.334999999999997 24.32 45-49 20.935000000000002 27.560000000000002 27.215 24.29 50-54 21.310000000000002 27.250000000000004 26.724999999999998 24.715 55-59 21.51 26.99 27.195000000000004 24.305 60-64 21.68 26.75 26.75 24.82 65-69 21.38 27.534999999999997 26.545 24.54 70-74 21.654999999999998 26.490000000000002 27.02 24.834999999999997 75-79 21.435000000000002 27.04 26.779999999999998 24.745 80-84 21.47 27.08 27.26 24.19 85-89 21.39 26.22 27.700000000000003 24.69 90-94 21.995 26.5 27.250000000000004 24.255 95-99 21.765 26.61 27.08 24.545 100-104 21.5 26.950000000000003 27.52 24.03 105-109 21.26 27.07 26.91 24.759999999999998 110-114 21.560000000000002 26.900000000000002 27.05 24.490000000000002 115-119 21.9 27.205000000000002 26.31 24.585 120-124 21.38 26.590000000000003 27.245 24.785 125-129 21.41 26.63 27.105 24.855 130-134 21.145 25.869999999999997 27.915 25.069999999999997 135-139 21.385 26.435 27.389999999999997 24.79 140-144 21.740000000000002 26.955000000000002 26.729999999999997 24.575 145-149 21.584999999999997 26.490000000000002 27.54 24.385 150-151 21.4125 26.387500000000003 27.3625 24.837500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 0.5 21 1.0 22 1.0 23 1.0 24 1.5 25 0.5 26 1.0 27 4.0 28 5.0 29 6.0 30 9.0 31 18.0 32 29.5 33 30.5 34 36.5 35 56.5 36 81.5 37 103.5 38 125.5 39 156.5 40 178.5 41 192.0 42 207.5 43 220.0 44 231.5 45 244.5 46 234.0 47 214.0 48 195.0 49 172.0 50 153.0 51 139.0 52 128.5 53 119.0 54 114.5 55 96.5 56 80.5 57 72.5 58 58.5 59 48.5 60 41.5 61 29.0 62 19.0 63 24.0 64 25.0 65 17.0 66 16.5 67 12.5 68 8.5 69 7.0 70 7.0 71 6.0 72 6.0 73 5.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34574735782587 98.7 2 0.6542526421741319 1.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.037500000000000006 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.05 0.0 0.0 0.0 0.0 112-113 0.05 0.0 0.0 0.0 0.0 114-115 0.05 0.0 0.0 0.0 0.0 116-117 0.0625 0.0 0.0 0.0 0.0 118-119 0.0875 0.0 0.0 0.0 0.0 120-121 0.125 0.0 0.0 0.0 0.0 122-123 0.125 0.0 0.0 0.0 0.0 124-125 0.1375 0.0 0.0 0.0 0.0 126-127 0.15 0.0 0.0 0.0 0.0 128-129 0.175 0.0 0.0 0.0 0.0 130-131 0.21250000000000002 0.0 0.0 0.0 0.0 132-133 0.25 0.0 0.0 0.0 0.0 134-135 0.3 0.0 0.0 0.0 0.0 136-137 0.3 0.0 0.0 0.0 0.0 138-139 0.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATATC 10 0.006830828 145.0 6 TATCCAT 10 0.006830828 145.0 9 CGGTTGG 10 0.006830828 145.0 9 ACAATAT 10 0.006830828 145.0 5 >>END_MODULE SRR6031166 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031166_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.513 34.0 33.0 34.0 33.0 34.0 2 32.5915 34.0 33.0 34.0 33.0 34.0 3 32.7045 34.0 33.0 34.0 33.0 34.0 4 32.62975 34.0 33.0 34.0 33.0 34.0 5 32.6905 34.0 33.0 34.0 33.0 34.0 6 36.6825 38.0 38.0 38.0 38.0 38.0 7 36.66 38.0 38.0 38.0 38.0 38.0 8 36.729 38.0 38.0 38.0 38.0 38.0 9 36.75175 38.0 38.0 38.0 38.0 38.0 10-14 36.6567 38.0 38.0 38.0 37.8 38.0 15-19 36.58125 38.0 38.0 38.0 37.8 38.0 20-24 36.59185 38.0 38.0 38.0 37.6 38.0 25-29 36.5904 38.0 38.0 38.0 37.4 38.0 30-34 36.83575 38.0 38.0 38.0 38.0 38.0 35-39 36.89790000000001 38.0 38.0 38.0 38.0 38.0 40-44 36.89960000000001 38.0 38.0 38.0 37.8 38.0 45-49 36.90805 38.0 38.0 38.0 38.0 38.0 50-54 36.7955 38.0 38.0 38.0 38.0 38.0 55-59 36.6139 38.0 38.0 38.0 37.2 38.0 60-64 36.66345 38.0 38.0 38.0 37.0 38.0 65-69 36.5727 38.0 38.0 38.0 37.0 38.0 70-74 36.40245 38.0 38.0 38.0 36.8 38.0 75-79 36.5067 38.0 38.0 38.0 37.0 38.0 80-84 36.71565 38.0 38.0 38.0 37.0 38.0 85-89 36.671549999999996 38.0 38.0 38.0 37.0 38.0 90-94 36.678999999999995 38.0 38.0 38.0 36.8 38.0 95-99 36.60314999999999 38.0 38.0 38.0 36.2 38.0 100-104 36.422999999999995 38.0 38.0 38.0 36.0 38.0 105-109 36.27705 38.0 38.0 38.0 35.8 38.0 110-114 36.08905 38.0 38.0 38.0 34.8 38.0 115-119 36.029999999999994 38.0 38.0 38.0 35.0 38.0 120-124 35.89515 38.0 38.0 38.0 34.0 38.0 125-129 36.079049999999995 38.0 38.0 38.0 34.6 38.0 130-134 35.9701 38.0 38.0 38.0 34.0 38.0 135-139 35.81565 38.0 38.0 38.0 33.8 38.0 140-144 35.7134 38.0 38.0 38.0 33.6 38.0 145-149 35.36265 38.0 37.8 38.0 32.6 38.0 150-151 32.538375 37.0 34.5 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 78.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 1.0 14 0.0 15 1.0 16 3.0 17 6.0 18 9.0 19 2.0 20 6.0 21 7.0 22 4.0 23 5.0 24 4.0 25 11.0 26 9.0 27 13.0 28 14.0 29 9.0 30 21.0 31 25.0 32 31.0 33 41.0 34 70.0 35 95.0 36 309.0 37 3223.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.379681888147765 22.370446382760388 12.904053360697793 24.34581836839405 2 27.83610755441741 27.98975672215109 25.58258642765685 18.591549295774648 3 22.367075664621677 30.01022494887526 28.169734151329244 19.452965235173824 4 24.237765821163208 33.33333333333333 21.13758647194466 21.2913143735588 5 25.925925925925924 34.32950191570881 19.846743295019156 19.897828863346103 6 23.601847101077475 36.58286300667009 21.190354027706515 18.62493586454592 7 21.45790554414784 22.202258726899384 35.24127310061601 21.098562628336754 8 24.416517055655294 24.903821492690433 22.826365734803797 27.853295716850475 9 23.520368946963874 23.16167050986421 28.28593389700231 25.032026646169612 10-14 24.865280985373364 27.816268924813958 24.973056197074673 22.345393892738002 15-19 24.452104125938884 26.32472476592242 25.990328223068214 23.232842885070482 20-24 24.86375321336761 27.2853470437018 25.331619537275063 22.519280205655527 25-29 24.789354706124126 27.13727907932594 25.52918207973695 22.54418413481299 30-34 24.51155435392542 27.15910829975004 25.817476916798448 22.51186042952609 35-39 24.997454952662117 26.86042960399063 25.68970782856561 22.452407614781634 40-44 24.53395641794077 27.00259054198202 26.07812261898715 22.38533042109006 45-49 24.909912196112266 27.021265797086734 25.321017103994315 22.747804902806678 50-54 24.925016521783334 26.8059580092522 25.972243403995734 22.29678206496874 55-59 25.74196524680917 26.213542467579064 25.403659849300325 22.640832436311445 60-64 24.571720787522374 27.660444899002812 25.77345947328049 21.99437484019432 65-69 24.88859294165856 26.23572196895969 26.40475336782257 22.470931721559186 70-74 25.107935855263158 26.212993421052634 26.084498355263158 22.594572368421055 75-79 24.605936540429887 26.53019447287615 26.228249744114635 22.635619242579324 80-84 25.05958115714213 26.945895238578167 25.987525987525988 22.006997616753715 85-89 25.130439187477837 27.30358137885619 25.59647434273846 21.96950509092751 90-94 24.262361455539246 27.612733437927023 26.064072068424515 22.060833038109216 95-99 25.1649913696822 25.80465021829627 26.37831251903747 22.65204589298406 100-104 24.846813725490197 26.843341503267975 26.358251633986928 21.951593137254903 105-109 25.01667436252629 26.96629213483146 25.873480067723563 22.14355343491868 110-114 24.279327886542315 27.29561687477519 26.422074919068905 22.002980319613584 115-119 25.236820428336078 26.307660626029655 25.70531301482702 22.750205930807248 120-124 24.82425983888347 26.666324593360358 26.594489199035355 21.914926368720817 125-129 24.465376782077396 27.535641547861506 26.059063136456214 21.93991853360489 130-134 25.05960533657992 27.00248566935525 26.23649368437072 21.70141530969411 135-139 24.529828109201212 26.830131445904954 26.481294236602633 22.158746208291202 140-144 24.742372196403313 27.60153566377046 25.8890684986866 21.767023641139623 145-149 25.149851407847677 26.645846975268224 26.232811162041003 21.971490454843096 150-151 25.14597613607514 27.48159431327748 25.628332063975627 21.74409748667174 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 44.0 1 23.0 2 2.0 3 2.5 4 2.0 5 0.5 6 0.0 7 0.5 8 0.5 9 1.0 10 1.5 11 2.0 12 2.5 13 2.5 14 3.0 15 3.0 16 2.5 17 1.0 18 1.5 19 1.5 20 0.5 21 1.5 22 2.5 23 3.0 24 4.0 25 3.5 26 2.5 27 4.5 28 7.5 29 9.5 30 11.5 31 13.5 32 18.5 33 26.5 34 36.5 35 53.0 36 71.0 37 88.5 38 101.5 39 121.5 40 157.5 41 189.5 42 212.5 43 226.0 44 233.5 45 222.0 46 200.5 47 186.5 48 172.5 49 156.0 50 144.0 51 135.5 52 128.0 53 115.0 54 103.5 55 87.5 56 69.0 57 67.5 58 57.0 59 48.5 60 50.5 61 50.0 62 44.0 63 41.0 64 35.5 65 30.5 66 30.0 67 22.5 68 21.0 69 23.0 70 19.0 71 16.5 72 16.0 73 10.5 74 6.5 75 6.0 76 3.5 77 3.0 78 2.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.55 2 2.375 3 2.1999999999999997 4 2.4250000000000003 5 2.125 6 2.55 7 2.6 8 2.5250000000000004 9 2.4250000000000003 10-14 2.5749999999999997 15-19 2.81 20-24 2.75 25-29 2.68 30-34 1.9849999999999999 35-39 1.77 40-44 1.5650000000000002 45-49 1.485 50-54 1.645 55-59 2.455 60-64 2.225 65-69 2.385 70-74 2.7199999999999998 75-79 2.3 80-84 1.395 85-89 1.295 90-94 1.205 95-99 1.51 100-104 2.08 105-109 2.545 110-114 2.6950000000000003 115-119 2.88 120-124 2.555 125-129 1.7999999999999998 130-134 1.435 135-139 1.0999999999999999 140-144 1.02 145-149 0.735 150-151 1.525 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.13221031138336 97.1 2 0.8422664624808576 1.6500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025523226135783564 1.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 50 1.25 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0125 0.0 0.0 48-49 0.0 0.0 0.025 0.0 0.0 50-51 0.0 0.0 0.025 0.0 0.0 52-53 0.0 0.0 0.025 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.0 0.0 0.025 0.0 0.0 64-65 0.0 0.0 0.025 0.0 0.0 66-67 0.0 0.0 0.025 0.0 0.0 68-69 0.0 0.0 0.025 0.0 0.0 70-71 0.0 0.0 0.025 0.0 0.0 72-73 0.0 0.0 0.025 0.0 0.0 74-75 0.0 0.0 0.025 0.0 0.0 76-77 0.0 0.0 0.025 0.0 0.0 78-79 0.0 0.0 0.025 0.0 0.0 80-81 0.0 0.0 0.025 0.0 0.0 82-83 0.0 0.0 0.025 0.0 0.0 84-85 0.0 0.0 0.025 0.0 0.0 86-87 0.0 0.0 0.025 0.0 0.0 88-89 0.0 0.0 0.025 0.0 0.0 90-91 0.0 0.0 0.025 0.0 0.0 92-93 0.0 0.0 0.025 0.0 0.0 94-95 0.0 0.0 0.025 0.0 0.0 96-97 0.0 0.0 0.025 0.0 0.0 98-99 0.0 0.0 0.025 0.0 0.0 100-101 0.0 0.0 0.025 0.0 0.0 102-103 0.025 0.0 0.025 0.0 0.0 104-105 0.025 0.0 0.025 0.0 0.0 106-107 0.037500000000000006 0.0 0.025 0.0 0.0 108-109 0.05 0.0 0.025 0.0 0.0 110-111 0.05 0.0 0.025 0.0 0.0 112-113 0.05 0.0 0.025 0.0 0.0 114-115 0.05 0.0 0.025 0.0 0.0 116-117 0.0625 0.0 0.025 0.0 0.0 118-119 0.0875 0.0 0.025 0.0 0.0 120-121 0.125 0.0 0.025 0.0 0.0 122-123 0.125 0.0 0.025 0.0 0.0 124-125 0.1375 0.0 0.025 0.0 0.0 126-127 0.15 0.0 0.025 0.0 0.0 128-129 0.175 0.0 0.025 0.0 0.0 130-131 0.21250000000000002 0.0 0.025 0.0 0.0 132-133 0.25 0.0 0.025 0.0 0.0 134-135 0.3125 0.0 0.025 0.0 0.0 136-137 0.325 0.0 0.025 0.0 0.0 138-139 0.3625 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 701678 spots for SRR6031166.sra Written 701678 spots for SRR6031166.sra Read 701678 spots for SRR6031166.sra Written 701678 spots for SRR6031166.sra Read 701678 spots for SRR6031166.sra Written 701678 spots for SRR6031166.sra Read 701678 spots for SRR6031166.sra Written 701678 spots for SRR6031166.sra Read 701678 spots for SRR6031166.sra Written 701678 spots for SRR6031166.sra Read 701678 spots for SRR6031166.sra Written 701678 spots for SRR6031166.sra Read 701678 spots for SRR6031166.sra Written 701678 spots for SRR6031166.sra Read 701678 spots for SRR6031166.sra Written 701678 spots for SRR6031166.sra Read 701678 spots for SRR6031166.sra Written 701678 spots for SRR6031166.sra Read 701678 spots for SRR6031166.sra Written 701678 spots for SRR6031166.sra Read 701678 spots for SRR6031166.sra Written 701678 spots for SRR6031166.sra Read 701678 spots for SRR6031166.sra Written 701678 spots for SRR6031166.sra Read 701678 spots for SRR6031166.sra Written 701678 spots for SRR6031166.sra Read 701678 spots for SRR6031166.sra Written 701678 spots for SRR6031166.sra Read 701678 spots for SRR6031166.sra Written 701678 spots for SRR6031166.sra Read 701678 spots for SRR6031166.sra Written 701678 spots for SRR6031166.sra Read 701678 spots for SRR6031166.sra Written 701678 spots for SRR6031166.sra Read 701678 spots for SRR6031166.sra Written 701678 spots for SRR6031166.sra Read 701678 spots for SRR6031166.sra Written 701678 spots for SRR6031166.sra Read 701679 spots for SRR6031166.sra Written 701679 spots for SRR6031166.sra SRR ids: ['SRR6031166.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_linaq1r_ SRR6031166.sra spots: 14033561 blocks: [[1, 701678], [701679, 1403356], [1403357, 2105034], [2105035, 2806712], [2806713, 3508390], [3508391, 4210068], [4210069, 4911746], [4911747, 5613424], [5613425, 6315102], [6315103, 7016780], [7016781, 7718458], [7718459, 8420136], [8420137, 9121814], [9121815, 9823492], [9823493, 10525170], [10525171, 11226848], [11226849, 11928526], [11928527, 12630204], [12630205, 13331882], [13331883, 14033561]] SRR6031166 file size 4733812 SRR6031166 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031166 SRR6031166_1.fastq SRR6031166_2.fastq Input file: SRR6031166_1.fastq Paired file: SRR6031166_2.fastq trimmed: SRR6031166-trimmed-pair1.fastq, SRR6031166-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:28:13 2024 >> started Tue Dec 10 00:28:32 2024 >> done (19.352s) 14033561 read pairs processed; of these: 11023 ( 0.08%) short read pairs filtered out after trimming by size control 20926 ( 0.15%) empty read pairs filtered out after trimming by size control 14001612 (99.77%) read pairs available; of these: 4007973 (28.63%) trimmed read pairs available after processing 9993639 (71.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 5 0.00% 21 6 0.00% 22 9 0.00% 23 2 0.00% 24 6 0.00% 25 9 0.00% 26 5 0.00% 27 2 0.00% 28 2 0.00% 29 6 0.00% 30 9 0.00% 31 11 0.00% 32 5 0.00% 33 4 0.00% 34 6 0.00% 35 9 0.00% 36 7 0.00% 37 6 0.00% 38 5 0.00% 39 6 0.00% 40 3 0.00% 41 3 0.00% 42 8 0.00% 43 8 0.00% 44 9 0.00% 45 8 0.00% 46 6 0.00% 47 7 0.00% 48 10 0.00% 49 9 0.00% 50 22 0.00% 51 9 0.00% 52 13 0.00% 53 22 0.00% 54 15 0.00% 55 13 0.00% 56 17 0.00% 57 25 0.00% 58 28 0.00% 59 22 0.00% 60 24 0.00% 61 32 0.00% 62 36 0.00% 63 51 0.00% 64 45 0.00% 65 70 0.00% 66 51 0.00% 67 57 0.00% 68 69 0.00% 69 69 0.00% 70 66 0.00% 71 79 0.00% 72 81 0.00% 73 105 0.00% 74 103 0.00% 75 116 0.00% 76 151 0.00% 77 179 0.00% 78 179 0.00% 79 195 0.00% 80 233 0.00% 81 221 0.00% 82 247 0.00% 83 351 0.00% 84 753 0.01% 85 1097 0.01% 86 1068 0.01% 87 1297 0.01% 88 1428 0.01% 89 1582 0.01% 90 1480 0.01% 91 1411 0.01% 92 1349 0.01% 93 1367 0.01% 94 1360 0.01% 95 1341 0.01% 96 1328 0.01% 97 1346 0.01% 98 1387 0.01% 99 1443 0.01% 100 1490 0.01% 101 1600 0.01% 102 1815 0.01% 103 1786 0.01% 104 1933 0.01% 105 2012 0.01% 106 2060 0.01% 107 2244 0.02% 108 2455 0.02% 109 2662 0.02% 110 2911 0.02% 111 3167 0.02% 112 3318 0.02% 113 3941 0.03% 114 4665 0.03% 115 5512 0.04% 116 5952 0.04% 117 5317 0.04% 118 4571 0.03% 119 4504 0.03% 120 4493 0.03% 121 4668 0.03% 122 4769 0.03% 123 5171 0.04% 124 5605 0.04% 125 5988 0.04% 126 6145 0.04% 127 6354 0.05% 128 6727 0.05% 129 7006 0.05% 130 7711 0.06% 131 8153 0.06% 132 8674 0.06% 133 9674 0.07% 134 10714 0.08% 135 11264 0.08% 136 12418 0.09% 137 13382 0.10% 138 14961 0.11% 139 16414 0.12% 140 18724 0.13% 141 21709 0.16% 142 23771 0.17% 143 28361 0.20% 144 36973 0.26% 145 50687 0.36% 146 83016 0.59% 147 91930 0.66% 148 168592 1.20% 149 408401 2.92% 150 2817372 20.12% 151 9993639 71.37% 14001612 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=3.48 fanout-score-rank=30 prefix-density=0.28 prefix-fanout=3.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=159.51 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=14.9 sequence=TTTCATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTA criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=4.37 fanout-score-rank=23 prefix-density=0.18 prefix-fanout=3.7 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=44.55 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=15.0 sequence=TGGACAAGAAGAA SRR6031166 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:29:23 Started mapping on | Dec 10 00:29:23 Finished on | Dec 10 00:31:47 Mapping speed, Million of reads per hour | 350.04 Number of input reads | 14001612 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 12968662 Uniquely mapped reads % | 92.62% Average mapped length | 299.72 Number of splices: Total | 15262205 Number of splices: Annotated (sjdb) | 14524479 Number of splices: GT/AG | 15069175 Number of splices: GC/AG | 174299 Number of splices: AT/AC | 9064 Number of splices: Non-canonical | 9667 Mismatch rate per base, % | 0.16% Deletion rate per base | 0.00% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 134575 % of reads mapped to multiple loci | 0.96% Number of reads mapped to too many loci | 8656 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.77% % of reads unmapped: other | 0.59% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 905975 905975 905975 N_multimapping 134575 134575 134575 N_noFeature 520909 12597138 607290 N_ambiguous 346708 2917 63221 UnstrandedReadsAssigned:12101045 PositiveStrandReadsAssigned:368607 NegativeStrandReadsAssigned:12298151 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6031166 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6031166-trimmed-pair1.fastq SRR6031166-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,001,612 reads, 12,399,178 reads pseudoaligned [quant] estimated average fragment length: 452.208 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52973 SRR6031166.ke.tsv 35125 SRR6031166.se.tsv 88098 total ==> SRR6031166.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 486.073 0 0 PNS24247 1044 592.792 88.2979 17.0797 PNS24249 1928 1476.79 10.047 0.780098 PNS24246 1044 592.792 88.2979 17.0797 PNS24248 1044 592.792 88.2979 17.0797 PNS24244 1471 1019.79 57.0593 6.41575 PNS24243 293 59.9084 0 0 KQK14069 1603 1151.79 2680.3 266.834 KQK14071 474 119.235 11.0801 10.6555 ==> SRR6031166.se.tsv <== BRADI_1g14170v3 3087 BRADI_1g53295v3 63 BRADI_1g59795v3 634 BRADI_1g07683v3 0 BRADI_1g00485v3 59 BRADI_1g20270v3 896 BRADI_1g74790v3 107 BRADI_1g09890v3 0 BRADI_1g77505v3 202 BRADI_1g48960v3 0 SRR6031166 completed mapping pipeline successfully