Starting /dee2/code/volunteer_pipeline.sh SRR6031167 current disk space = 1523594551296 free memory = 1566019720 SRR6031167 SRAfilesize b36064fe868002dd6d3cb1a9e6d0ad1d SRR6031167.sra SRR6031167.sra file validated SRR6031167 is paired end SRR6031167 is conventional basespace SRR6031167 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031167_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.50175 32.0 25.0 33.0 18.0 33.0 2 28.64875 29.0 27.0 31.0 25.0 33.0 3 31.61 33.0 31.0 33.0 29.0 33.0 4 32.8065 33.0 33.0 33.0 32.0 33.0 5 33.173 33.0 33.0 34.0 33.0 34.0 6 37.489 38.0 38.0 38.0 37.0 38.0 7 37.76025 38.0 38.0 38.0 38.0 38.0 8 37.83025 38.0 38.0 38.0 38.0 38.0 9 37.85275 38.0 38.0 38.0 38.0 38.0 10-14 37.913700000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.92229999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.928700000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.917100000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.9011 38.0 38.0 38.0 38.0 38.0 35-39 37.913599999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.8606 38.0 38.0 38.0 38.0 38.0 45-49 37.8795 38.0 38.0 38.0 38.0 38.0 50-54 37.8515 38.0 38.0 38.0 38.0 38.0 55-59 37.84740000000001 38.0 38.0 38.0 38.0 38.0 60-64 37.82995 38.0 38.0 38.0 38.0 38.0 65-69 37.80395 38.0 38.0 38.0 38.0 38.0 70-74 37.80395 38.0 38.0 38.0 38.0 38.0 75-79 37.78575 38.0 38.0 38.0 38.0 38.0 80-84 37.78995 38.0 38.0 38.0 38.0 38.0 85-89 37.769 38.0 38.0 38.0 38.0 38.0 90-94 37.7234 38.0 38.0 38.0 38.0 38.0 95-99 37.70035 38.0 38.0 38.0 38.0 38.0 100-104 37.6608 38.0 38.0 38.0 38.0 38.0 105-109 37.6441 38.0 38.0 38.0 38.0 38.0 110-114 37.61514999999999 38.0 38.0 38.0 38.0 38.0 115-119 37.5414 38.0 38.0 38.0 38.0 38.0 120-124 37.4416 38.0 38.0 38.0 38.0 38.0 125-129 37.4929 38.0 38.0 38.0 38.0 38.0 130-134 37.32575 38.0 38.0 38.0 37.4 38.0 135-139 37.256099999999996 38.0 38.0 38.0 36.2 38.0 140-144 37.1596 38.0 38.0 38.0 36.0 38.0 145-149 37.016949999999994 38.0 38.0 38.0 36.0 38.0 150-151 35.297375 38.0 36.0 38.0 32.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 2.0 20 2.0 21 1.0 22 0.0 23 2.0 24 1.0 25 2.0 26 1.0 27 3.0 28 2.0 29 3.0 30 5.0 31 9.0 32 19.0 33 17.0 34 19.0 35 52.0 36 163.0 37 3696.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.1991991991992 13.188188188188189 7.3573573573573565 30.255255255255253 2 22.0 13.875000000000002 35.575 28.549999999999997 3 19.175 19.35 25.575 35.9 4 21.625 25.424999999999997 23.75 29.2 5 23.775 28.925 23.974999999999998 23.325000000000003 6 23.26633165829146 32.814070351758794 23.241206030150753 20.678391959798994 7 17.1 26.125 38.9 17.875 8 19.675 24.925 29.425 25.974999999999998 9 18.65 22.95 33.975 24.425 10-14 21.305 28.615000000000002 26.369999999999997 23.71 15-19 21.64 26.834999999999997 27.57 23.955000000000002 20-24 21.255 27.339999999999996 26.815 24.59 25-29 21.62 27.165 27.105 24.11 30-34 20.985 27.169999999999998 27.0 24.845 35-39 21.45 27.21 26.85 24.490000000000002 40-44 21.215 26.88 27.389999999999997 24.515 45-49 21.72 27.295 26.39 24.595 50-54 21.26 26.695 27.425 24.62 55-59 21.29 27.339999999999996 26.634999999999998 24.735 60-64 21.895 26.490000000000002 27.36 24.255 65-69 21.5 26.445 27.145000000000003 24.91 70-74 21.95 26.5 27.29 24.26 75-79 21.990000000000002 26.21 26.834999999999997 24.965 80-84 21.58 26.919999999999998 27.045 24.455 85-89 21.855 27.16 26.105 24.88 90-94 21.445 26.69 27.27 24.595 95-99 21.3 26.935 27.35 24.415 100-104 21.11 27.134999999999998 26.584999999999997 25.169999999999998 105-109 21.435000000000002 26.919999999999998 27.49 24.154999999999998 110-114 21.7 26.700000000000003 27.505000000000003 24.095 115-119 21.83 27.375 26.979999999999997 23.815 120-124 21.279999999999998 27.04 27.115000000000002 24.565 125-129 21.765 26.650000000000002 26.805 24.779999999999998 130-134 21.86 26.38 26.805 24.955 135-139 22.16 27.05 26.55 24.240000000000002 140-144 21.66 26.72 26.77 24.85 145-149 21.57 26.93 26.534999999999997 24.965 150-151 20.9125 26.8625 27.825 24.4 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 1.0 25 1.0 26 2.5 27 2.0 28 4.5 29 7.0 30 8.5 31 16.5 32 22.0 33 27.0 34 37.0 35 48.0 36 61.0 37 73.5 38 101.5 39 146.5 40 168.0 41 182.0 42 220.0 43 232.0 44 223.0 45 239.0 46 262.5 47 242.5 48 203.0 49 199.0 50 190.5 51 165.0 52 142.0 53 115.0 54 88.0 55 74.5 56 75.5 57 62.5 58 42.5 59 46.0 60 48.0 61 37.5 62 33.5 63 28.5 64 21.5 65 23.0 66 19.0 67 11.0 68 10.0 69 7.5 70 4.5 71 4.0 72 3.5 73 3.0 74 3.0 75 3.0 76 1.5 77 1.0 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72410333584149 99.4 2 0.2508151492350138 0.5 3 0.0 0.0 4 0.025081514923501375 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0125 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.037500000000000006 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.05 0.0 0.0 0.0 0.0 112-113 0.0625 0.0 0.0 0.0 0.0 114-115 0.1 0.0 0.0 0.0 0.0 116-117 0.1 0.0 0.0 0.0 0.0 118-119 0.125 0.0 0.0 0.0 0.0 120-121 0.15 0.0 0.0 0.0 0.0 122-123 0.175 0.0 0.0 0.0 0.0 124-125 0.2625 0.0 0.0 0.0 0.0 126-127 0.3 0.0 0.0 0.0 0.0 128-129 0.32499999999999996 0.0 0.0 0.0 0.0 130-131 0.4125 0.0 0.0 0.0 0.0 132-133 0.425 0.0 0.0 0.0 0.0 134-135 0.425 0.0 0.0 0.0 0.0 136-137 0.4375 0.0 0.0 0.0 0.0 138-139 0.5375000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGATGA 10 0.006830828 145.0 7 AGATGAT 10 0.006830828 145.0 8 CCCCCCC 20 0.00593511 29.0 135-139 >>END_MODULE SRR6031167 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031167_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.5135 34.0 33.0 34.0 33.0 34.0 2 33.566 34.0 33.0 34.0 33.0 34.0 3 33.553 34.0 33.0 34.0 33.0 34.0 4 33.46275 34.0 34.0 34.0 33.0 34.0 5 33.51825 34.0 34.0 34.0 33.0 34.0 6 37.63275 38.0 38.0 38.0 38.0 38.0 7 37.686 38.0 38.0 38.0 38.0 38.0 8 37.61475 38.0 38.0 38.0 38.0 38.0 9 37.68175 38.0 38.0 38.0 38.0 38.0 10-14 37.6638 38.0 38.0 38.0 38.0 38.0 15-19 37.60855 38.0 38.0 38.0 38.0 38.0 20-24 37.5556 38.0 38.0 38.0 38.0 38.0 25-29 37.628550000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.76790000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.75835 38.0 38.0 38.0 38.0 38.0 40-44 37.75895 38.0 38.0 38.0 38.0 38.0 45-49 37.7512 38.0 38.0 38.0 38.0 38.0 50-54 37.7626 38.0 38.0 38.0 38.0 38.0 55-59 37.68625000000001 38.0 38.0 38.0 38.0 38.0 60-64 37.738 38.0 38.0 38.0 38.0 38.0 65-69 37.7167 38.0 38.0 38.0 38.0 38.0 70-74 37.618500000000004 38.0 38.0 38.0 38.0 38.0 75-79 37.674949999999995 38.0 38.0 38.0 38.0 38.0 80-84 37.6697 38.0 38.0 38.0 38.0 38.0 85-89 37.6506 38.0 38.0 38.0 38.0 38.0 90-94 37.62755 38.0 38.0 38.0 38.0 38.0 95-99 37.5917 38.0 38.0 38.0 38.0 38.0 100-104 37.5659 38.0 38.0 38.0 38.0 38.0 105-109 37.3919 38.0 38.0 38.0 38.0 38.0 110-114 37.2759 38.0 38.0 38.0 38.0 38.0 115-119 37.20335 38.0 38.0 38.0 38.0 38.0 120-124 37.224500000000006 38.0 38.0 38.0 37.8 38.0 125-129 37.3615 38.0 38.0 38.0 38.0 38.0 130-134 37.30435000000001 38.0 38.0 38.0 37.2 38.0 135-139 37.28715 38.0 38.0 38.0 37.0 38.0 140-144 37.16245 38.0 38.0 38.0 36.0 38.0 145-149 37.023450000000004 38.0 38.0 38.0 36.0 38.0 150-151 35.08725 38.0 36.0 38.0 30.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 2.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 2.0 16 1.0 17 0.0 18 1.0 19 0.0 20 0.0 21 1.0 22 0.0 23 3.0 24 3.0 25 5.0 26 6.0 27 4.0 28 9.0 29 9.0 30 7.0 31 4.0 32 20.0 33 19.0 34 25.0 35 59.0 36 166.0 37 3647.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.88597149287322 22.73068267066767 9.402350587646911 23.980995248812203 2 27.045283962972228 29.046785088816613 26.54490868151113 17.363022266700025 3 20.435762584522916 29.351364888554972 29.72702228900576 20.485850237916353 4 24.974899598393574 32.354417670682736 21.78714859437751 20.883534136546185 5 26.93273092369478 33.81024096385542 20.908634538152608 18.34839357429719 6 22.94383149448345 37.0110330992979 20.611835506519558 19.433299899699097 7 22.46993987975952 21.29258517034068 35.57114228456914 20.66633266533066 8 22.671353251318102 25.759477780567412 25.081596786341954 26.487572181772535 9 23.308270676691727 24.235588972431078 28.345864661654137 24.110275689223055 10-14 25.567982346155777 27.16786197903606 24.56492301519635 22.699232659611816 15-19 25.253539511999197 26.895270609498944 25.519630484988454 22.331559393513405 20-24 25.247599416821675 26.50947664773013 26.26816148006636 21.97476245538183 25-29 25.373358725067657 26.260398917510276 25.764257792923722 22.601984564498345 30-34 24.75 26.46 25.515 23.275000000000002 35-39 24.545 26.66 26.27 22.525000000000002 40-44 25.085 26.355 25.885 22.675 45-49 24.455 27.04 26.145000000000003 22.36 50-54 25.014999999999997 26.96 26.025 22.0 55-59 24.774549098196395 26.793587174348698 25.806613226452907 22.625250501002004 60-64 24.755 26.674999999999997 26.025 22.545 65-69 25.12876931539731 26.58898834825224 26.543981597239586 21.738260739110867 70-74 24.85960689931809 26.795026073004415 26.123144805455272 22.22222222222222 75-79 25.346267313365665 26.336316815840792 26.266313315665784 22.051102555127756 80-84 25.0 26.325 26.195 22.48 85-89 24.990000000000002 26.31 25.785000000000004 22.915 90-94 24.92 26.58 26.465 22.035 95-99 25.064999999999998 26.75 25.71 22.475 100-104 25.021255313828455 26.851712928232057 26.151537884471114 21.975493873468366 105-109 24.75759859331826 26.822406430545087 26.75709620698317 21.66289876915348 110-114 24.73323937990739 26.38916851218039 26.660962351520034 22.21662975639219 115-119 25.582917862718435 26.85702774840107 25.41672961675983 22.14332477212066 120-124 25.027602127873134 27.145438121047878 25.976111612967983 21.85084813811101 125-129 24.71123556177809 27.26136306815341 26.30131506575329 21.726086304315213 130-134 25.509999999999998 26.815 25.685000000000002 21.990000000000002 135-139 24.69 26.674999999999997 26.369999999999997 22.264999999999997 140-144 25.16 26.924999999999997 25.645 22.27 145-149 25.564999999999998 27.415 25.56 21.46 150-151 25.2 26.325 26.025 22.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 1.0 25 2.5 26 3.5 27 3.5 28 6.5 29 10.5 30 11.0 31 11.5 32 15.5 33 23.5 34 25.0 35 35.0 36 56.5 37 76.5 38 97.5 39 122.5 40 157.5 41 191.5 42 197.0 43 207.5 44 232.5 45 233.5 46 242.0 47 240.5 48 210.0 49 187.5 50 160.5 51 139.5 52 120.5 53 104.0 54 107.0 55 90.5 56 75.0 57 66.0 58 59.0 59 60.5 60 55.0 61 50.5 62 45.5 63 37.5 64 35.5 65 34.0 66 26.5 67 24.0 68 28.0 69 23.0 70 13.5 71 12.0 72 9.0 73 6.0 74 5.5 75 3.0 76 1.0 77 1.5 78 1.0 79 0.0 80 0.0 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.075 3 0.17500000000000002 4 0.4 5 0.4 6 0.3 7 0.2 8 0.42500000000000004 9 0.25 10-14 0.305 15-19 0.41000000000000003 20-24 0.545 25-29 0.22999999999999998 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.2 60-64 0.0 65-69 0.015 70-74 0.27999999999999997 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.025 105-109 0.475 110-114 0.66 115-119 0.715 120-124 0.37 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0125 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.037500000000000006 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.05 0.0 0.0 0.0 0.0 112-113 0.0625 0.0 0.0 0.0 0.0 114-115 0.1 0.0 0.0 0.0 0.0 116-117 0.1 0.0 0.0 0.0 0.0 118-119 0.125 0.0 0.0 0.0 0.0 120-121 0.15 0.0 0.0 0.0 0.0 122-123 0.175 0.0 0.0 0.0 0.0 124-125 0.2625 0.0 0.0 0.0 0.0 126-127 0.3 0.0 0.0 0.0 0.0 128-129 0.32499999999999996 0.0 0.0 0.0 0.0 130-131 0.4125 0.0 0.0 0.0 0.0 132-133 0.425 0.0 0.0 0.0 0.0 134-135 0.425 0.0 0.0 0.0 0.0 136-137 0.4375 0.0 0.0 0.0 0.0 138-139 0.5375000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 470330 spots for SRR6031167.sra Written 470330 spots for SRR6031167.sra Read 470330 spots for SRR6031167.sra Written 470330 spots for SRR6031167.sra Read 470330 spots for SRR6031167.sra Written 470330 spots for SRR6031167.sra Read 470330 spots for SRR6031167.sra Written 470330 spots for SRR6031167.sra Read 470330 spots for SRR6031167.sra Written 470330 spots for SRR6031167.sra Read 470330 spots for SRR6031167.sra Written 470330 spots for SRR6031167.sra Read 470330 spots for SRR6031167.sra Written 470330 spots for SRR6031167.sra Read 470330 spots for SRR6031167.sra Written 470330 spots for SRR6031167.sra Read 470330 spots for SRR6031167.sra Written 470330 spots for SRR6031167.sra Read 470330 spots for SRR6031167.sra Written 470330 spots for SRR6031167.sra Read 470330 spots for SRR6031167.sra Written 470330 spots for SRR6031167.sra Read 470330 spots for SRR6031167.sra Written 470330 spots for SRR6031167.sra Read 470347 spots for SRR6031167.sra Written 470347 spots for SRR6031167.sra Read 470330 spots for SRR6031167.sra Written 470330 spots for SRR6031167.sra Read 470330 spots for SRR6031167.sra Written 470330 spots for SRR6031167.sra Read 470330 spots for SRR6031167.sra Written 470330 spots for SRR6031167.sra Read 470330 spots for SRR6031167.sra Written 470330 spots for SRR6031167.sra Read 470330 spots for SRR6031167.sra Written 470330 spots for SRR6031167.sra Read 470330 spots for SRR6031167.sra Written 470330 spots for SRR6031167.sra Read 470330 spots for SRR6031167.sra Written 470330 spots for SRR6031167.sra SRR ids: ['SRR6031167.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8jrbevz9 SRR6031167.sra spots: 9406617 blocks: [[1, 470330], [470331, 940660], [940661, 1410990], [1410991, 1881320], [1881321, 2351650], [2351651, 2821980], [2821981, 3292310], [3292311, 3762640], [3762641, 4232970], [4232971, 4703300], [4703301, 5173630], [5173631, 5643960], [5643961, 6114290], [6114291, 6584620], [6584621, 7054950], [7054951, 7525280], [7525281, 7995610], [7995611, 8465940], [8465941, 8936270], [8936271, 9406617]] SRR6031167 file size 3167052 SRR6031167 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031167 SRR6031167_1.fastq SRR6031167_2.fastq Input file: SRR6031167_1.fastq Paired file: SRR6031167_2.fastq trimmed: SRR6031167-trimmed-pair1.fastq, SRR6031167-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:27:55 2024 >> started Tue Dec 10 00:28:06 2024 >> done (10.687s) 9406617 read pairs processed; of these: 4443 ( 0.05%) short read pairs filtered out after trimming by size control 4205 ( 0.04%) empty read pairs filtered out after trimming by size control 9397969 (99.91%) read pairs available; of these: 1900448 (20.22%) trimmed read pairs available after processing 7497521 (79.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 11 0.00% 20 8 0.00% 21 5 0.00% 22 7 0.00% 23 10 0.00% 24 10 0.00% 25 12 0.00% 26 7 0.00% 27 6 0.00% 28 8 0.00% 29 6 0.00% 30 4 0.00% 31 10 0.00% 32 5 0.00% 33 6 0.00% 34 10 0.00% 35 8 0.00% 36 11 0.00% 37 8 0.00% 38 12 0.00% 39 5 0.00% 40 8 0.00% 41 6 0.00% 42 10 0.00% 43 7 0.00% 44 6 0.00% 45 6 0.00% 46 13 0.00% 47 11 0.00% 48 9 0.00% 49 16 0.00% 50 11 0.00% 51 20 0.00% 52 23 0.00% 53 18 0.00% 54 15 0.00% 55 16 0.00% 56 29 0.00% 57 16 0.00% 58 27 0.00% 59 29 0.00% 60 29 0.00% 61 29 0.00% 62 40 0.00% 63 35 0.00% 64 33 0.00% 65 49 0.00% 66 59 0.00% 67 63 0.00% 68 63 0.00% 69 79 0.00% 70 69 0.00% 71 91 0.00% 72 94 0.00% 73 102 0.00% 74 113 0.00% 75 86 0.00% 76 121 0.00% 77 141 0.00% 78 149 0.00% 79 155 0.00% 80 184 0.00% 81 220 0.00% 82 210 0.00% 83 236 0.00% 84 481 0.01% 85 600 0.01% 86 635 0.01% 87 722 0.01% 88 706 0.01% 89 773 0.01% 90 783 0.01% 91 705 0.01% 92 827 0.01% 93 846 0.01% 94 788 0.01% 95 900 0.01% 96 895 0.01% 97 938 0.01% 98 972 0.01% 99 1062 0.01% 100 1056 0.01% 101 1076 0.01% 102 1184 0.01% 103 1298 0.01% 104 1301 0.01% 105 1455 0.02% 106 1430 0.02% 107 1470 0.02% 108 1566 0.02% 109 1601 0.02% 110 1681 0.02% 111 1756 0.02% 112 1849 0.02% 113 2031 0.02% 114 2061 0.02% 115 2293 0.02% 116 2234 0.02% 117 2388 0.03% 118 2485 0.03% 119 2599 0.03% 120 2640 0.03% 121 2794 0.03% 122 2992 0.03% 123 3190 0.03% 124 3214 0.03% 125 3468 0.04% 126 3467 0.04% 127 3729 0.04% 128 3902 0.04% 129 4203 0.04% 130 4477 0.05% 131 4734 0.05% 132 5072 0.05% 133 5327 0.06% 134 5685 0.06% 135 6164 0.07% 136 6666 0.07% 137 7125 0.08% 138 7727 0.08% 139 8376 0.09% 140 9072 0.10% 141 10015 0.11% 142 11409 0.12% 143 13184 0.14% 144 15595 0.17% 145 18999 0.20% 146 25262 0.27% 147 36408 0.39% 148 62148 0.66% 149 153377 1.63% 150 1399660 14.89% 151 7497521 79.78% 9397969 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=9.62 fanout-score-rank=13 prefix-density=0.42 prefix-fanout=5.2 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=16 fanout-score=142.49 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=27.5 sequence=ATCTTCTTCTTGTCGTCC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.56 fanout-score-rank=25 prefix-density=0.21 prefix-fanout=3.7 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=184.48 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=15.0 sequence=CCGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR6031167 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:28:55 Started mapping on | Dec 10 00:28:55 Finished on | Dec 10 00:29:36 Mapping speed, Million of reads per hour | 825.19 Number of input reads | 9397969 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 8937895 Uniquely mapped reads % | 95.10% Average mapped length | 300.21 Number of splices: Total | 10561363 Number of splices: Annotated (sjdb) | 10035974 Number of splices: GT/AG | 10423520 Number of splices: GC/AG | 124961 Number of splices: AT/AC | 6005 Number of splices: Non-canonical | 6877 Mismatch rate per base, % | 0.06% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 113908 % of reads mapped to multiple loci | 1.21% Number of reads mapped to too many loci | 17016 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.06% % of reads unmapped: other | 1.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 350156 350156 350156 N_multimapping 113908 113908 113908 N_noFeature 377835 8689734 442505 N_ambiguous 225651 1846 42716 UnstrandedReadsAssigned:8334409 PositiveStrandReadsAssigned:246315 NegativeStrandReadsAssigned:8452674 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6031167 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6031167-trimmed-pair1.fastq SRR6031167-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,397,969 reads, 8,490,753 reads pseudoaligned [quant] estimated average fragment length: 441.238 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52973 SRR6031167.ke.tsv 35125 SRR6031167.se.tsv 88098 total ==> SRR6031167.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 497.088 0 0 PNS24247 1044 603.762 63.4943 18.3798 PNS24249 1928 1487.76 10.2824 1.20791 PNS24246 1044 603.762 63.4943 18.3798 PNS24248 1044 603.762 63.4943 18.3798 PNS24244 1471 1030.76 35.2346 5.97424 PNS24243 293 62.9113 0 0 KQK14069 1603 1162.76 1536.9 231.008 KQK14071 474 130.4 14.6476 19.6318 ==> SRR6031167.se.tsv <== BRADI_1g14170v3 1859 BRADI_1g53295v3 46 BRADI_1g59795v3 438 BRADI_1g07683v3 0 BRADI_1g00485v3 18 BRADI_1g20270v3 632 BRADI_1g74790v3 113 BRADI_1g09890v3 0 BRADI_1g77505v3 111 BRADI_1g48960v3 0 SRR6031167 completed mapping pipeline successfully