Starting /dee2/code/volunteer_pipeline.sh SRR6031169 current disk space = 1523633598464 free memory = 1567595464 SRR6031169 SRAfilesize 70effd296b2b20ece438d1f47c6ce78b SRR6031169.sra SRR6031169.sra file validated SRR6031169 is paired end SRR6031169 is conventional basespace SRR6031169 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031169_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.586 32.0 28.0 33.0 18.0 33.0 2 30.82075 31.0 29.0 33.0 27.0 33.0 3 32.60725 33.0 33.0 33.0 31.0 34.0 4 33.12925 33.0 33.0 34.0 33.0 34.0 5 33.5035 34.0 33.0 34.0 33.0 34.0 6 37.5455 38.0 38.0 38.0 37.0 38.0 7 37.773 38.0 38.0 38.0 38.0 38.0 8 37.83425 38.0 38.0 38.0 38.0 38.0 9 37.88375 38.0 38.0 38.0 38.0 38.0 10-14 37.87875 38.0 38.0 38.0 38.0 38.0 15-19 37.89705 38.0 38.0 38.0 38.0 38.0 20-24 37.882999999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.8782 38.0 38.0 38.0 38.0 38.0 30-34 37.852549999999994 38.0 38.0 38.0 38.0 38.0 35-39 37.857600000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.837450000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.812 38.0 38.0 38.0 38.0 38.0 50-54 37.78595 38.0 38.0 38.0 38.0 38.0 55-59 37.762600000000006 38.0 38.0 38.0 38.0 38.0 60-64 37.7241 38.0 38.0 38.0 38.0 38.0 65-69 37.751 38.0 38.0 38.0 38.0 38.0 70-74 37.721050000000005 38.0 38.0 38.0 38.0 38.0 75-79 37.679899999999996 38.0 38.0 38.0 38.0 38.0 80-84 37.686350000000004 38.0 38.0 38.0 38.0 38.0 85-89 37.650400000000005 38.0 38.0 38.0 38.0 38.0 90-94 37.618449999999996 38.0 38.0 38.0 38.0 38.0 95-99 37.56035 38.0 38.0 38.0 38.0 38.0 100-104 37.5132 38.0 38.0 38.0 38.0 38.0 105-109 37.469550000000005 38.0 38.0 38.0 38.0 38.0 110-114 37.41685 38.0 38.0 38.0 37.2 38.0 115-119 37.33905 38.0 38.0 38.0 37.0 38.0 120-124 37.262649999999994 38.0 38.0 38.0 36.6 38.0 125-129 37.16075 38.0 38.0 38.0 36.0 38.0 130-134 37.037549999999996 38.0 38.0 38.0 36.0 38.0 135-139 36.9421 38.0 38.0 38.0 35.8 38.0 140-144 36.836149999999996 38.0 38.0 38.0 35.4 38.0 145-149 36.598949999999995 38.0 38.0 38.0 35.0 38.0 150-151 34.773250000000004 38.0 36.0 38.0 29.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 1.0 19 3.0 20 1.0 21 0.0 22 1.0 23 2.0 24 2.0 25 6.0 26 2.0 27 1.0 28 5.0 29 7.0 30 11.0 31 8.0 32 10.0 33 21.0 34 37.0 35 63.0 36 228.0 37 3586.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.12045169385194 12.346298619824342 6.022584692597239 29.510664993726476 2 21.325 12.65 36.85 29.175 3 16.900000000000002 17.7 27.750000000000004 37.65 4 22.475 23.45 24.875 29.2 5 24.75 28.625 24.175 22.45 6 24.191526698420656 31.411381298571072 23.89069942341439 20.506392579593882 7 17.599999999999998 26.125 37.25 19.025 8 18.825 25.95 30.099999999999998 25.124999999999996 9 18.6 23.45 32.725 25.224999999999998 10-14 21.42 27.67 27.22 23.69 15-19 21.2 26.415 27.49 24.895 20-24 21.54 26.91 27.544999999999998 24.005000000000003 25-29 21.67 26.795 27.0 24.535 30-34 21.375 27.200000000000003 26.91 24.515 35-39 21.475 27.025 26.775 24.725 40-44 21.425 26.965 27.205000000000002 24.404999999999998 45-49 21.959999999999997 26.275 26.96 24.805 50-54 21.565 26.52 26.924999999999997 24.990000000000002 55-59 21.634999999999998 27.384999999999998 26.674999999999997 24.305 60-64 21.279999999999998 26.85 27.034999999999997 24.834999999999997 65-69 21.310000000000002 26.815 27.229999999999997 24.645 70-74 21.55 26.665 26.884999999999998 24.9 75-79 21.54 26.685 26.85 24.925 80-84 21.255 26.715 27.11 24.92 85-89 21.740000000000002 26.21 27.060000000000002 24.990000000000002 90-94 21.345 26.82 27.145000000000003 24.69 95-99 21.790000000000003 26.72 26.615 24.875 100-104 21.529999999999998 27.534999999999997 26.245 24.69 105-109 21.26 26.275 27.029999999999998 25.435000000000002 110-114 20.855 26.775 27.345000000000002 25.025 115-119 21.935 26.96 26.465 24.64 120-124 21.18 26.99 26.655 25.174999999999997 125-129 21.42 27.095000000000002 26.935 24.55 130-134 21.93 26.450000000000003 26.979999999999997 24.64 135-139 22.259999999999998 26.305 26.55 24.884999999999998 140-144 21.86 26.810000000000002 26.495 24.834999999999997 145-149 22.185 26.43 26.51 24.875 150-151 21.5625 26.9125 27.125 24.4 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.5 25 2.0 26 1.5 27 3.5 28 3.5 29 4.5 30 9.5 31 10.0 32 14.0 33 25.0 34 30.5 35 44.5 36 60.5 37 73.0 38 109.5 39 140.5 40 147.5 41 170.5 42 206.5 43 230.5 44 231.5 45 241.0 46 253.0 47 250.0 48 222.0 49 202.0 50 193.5 51 158.5 52 143.5 53 130.0 54 108.0 55 87.5 56 80.5 57 71.5 58 58.0 59 52.5 60 36.0 61 28.0 62 25.0 63 22.0 64 22.0 65 17.0 66 11.5 67 12.5 68 12.0 69 10.0 70 8.0 71 5.0 72 4.5 73 4.5 74 3.0 75 1.0 76 1.5 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.27499999999999997 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.5 0.0 0.0 0.0 0.0 126-127 0.525 0.0 0.0 0.0 0.0 128-129 0.525 0.0 0.0 0.0 0.0 130-131 0.5375000000000001 0.0 0.0 0.0 0.0 132-133 0.625 0.0 0.0 0.0 0.0 134-135 0.7 0.0 0.0 0.0 0.0 136-137 0.75 0.0 0.0 0.0 0.0 138-139 0.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATGCA 10 0.006832588 144.9875 8 >>END_MODULE SRR6031169 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031169_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.518 34.0 33.0 34.0 33.0 34.0 2 33.5895 34.0 33.0 34.0 33.0 34.0 3 33.56375 34.0 34.0 34.0 33.0 34.0 4 33.50875 34.0 34.0 34.0 33.0 34.0 5 33.51375 34.0 34.0 34.0 33.0 34.0 6 37.6685 38.0 38.0 38.0 38.0 38.0 7 37.6445 38.0 38.0 38.0 38.0 38.0 8 37.68975 38.0 38.0 38.0 38.0 38.0 9 37.697 38.0 38.0 38.0 38.0 38.0 10-14 37.67045 38.0 38.0 38.0 38.0 38.0 15-19 37.638099999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.62365 38.0 38.0 38.0 38.0 38.0 25-29 37.66440000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.7359 38.0 38.0 38.0 38.0 38.0 35-39 37.72945 38.0 38.0 38.0 38.0 38.0 40-44 37.729200000000006 38.0 38.0 38.0 38.0 38.0 45-49 37.71035 38.0 38.0 38.0 38.0 38.0 50-54 37.69155 38.0 38.0 38.0 38.0 38.0 55-59 37.63865 38.0 38.0 38.0 38.0 38.0 60-64 37.66825 38.0 38.0 38.0 38.0 38.0 65-69 37.6765 38.0 38.0 38.0 38.0 38.0 70-74 37.607749999999996 38.0 38.0 38.0 38.0 38.0 75-79 37.64104999999999 38.0 38.0 38.0 38.0 38.0 80-84 37.65305000000001 38.0 38.0 38.0 38.0 38.0 85-89 37.627750000000006 38.0 38.0 38.0 38.0 38.0 90-94 37.6077 38.0 38.0 38.0 38.0 38.0 95-99 37.553 38.0 38.0 38.0 38.0 38.0 100-104 37.54045 38.0 38.0 38.0 38.0 38.0 105-109 37.4169 38.0 38.0 38.0 38.0 38.0 110-114 37.352500000000006 38.0 38.0 38.0 38.0 38.0 115-119 37.2764 38.0 38.0 38.0 38.0 38.0 120-124 37.303250000000006 38.0 38.0 38.0 38.0 38.0 125-129 37.34045 38.0 38.0 38.0 37.8 38.0 130-134 37.2827 38.0 38.0 38.0 37.4 38.0 135-139 37.2303 38.0 38.0 38.0 37.0 38.0 140-144 37.134249999999994 38.0 38.0 38.0 36.0 38.0 145-149 36.98205 38.0 38.0 38.0 36.0 38.0 150-151 35.0135 38.0 36.0 38.0 29.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 0.0 5 0.0 6 2.0 7 1.0 8 0.0 9 0.0 10 0.0 11 2.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 3.0 23 4.0 24 4.0 25 2.0 26 8.0 27 4.0 28 9.0 29 4.0 30 5.0 31 11.0 32 9.0 33 24.0 34 22.0 35 60.0 36 156.0 37 3661.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.41185296324081 21.45536384096024 8.727181795448862 22.405601400350086 2 26.18809404702351 28.339169584792394 26.813406703351678 18.659329664832416 3 22.22778473091364 28.16020025031289 29.46182728410513 20.150187734668336 4 26.648282777638503 31.361243419403362 21.057909250438705 20.932564552519427 5 25.319949811794228 33.95232120451694 21.003764115432872 19.723964868255962 6 23.34669338677355 35.77154308617235 21.317635270541082 19.564128256513026 7 22.238918106686704 22.739794640621085 33.93438517405459 21.086902078637614 8 23.263975933818 24.968663825520178 25.795938831787414 25.971421408874406 9 24.818432256448787 23.86676684197345 27.247683446030553 24.06711745554721 10-14 25.329458335421158 27.64944630956557 24.517713083128726 22.50338227188455 15-19 24.67916583116102 26.86484860637658 25.932424303188288 22.523561259274114 20-24 25.06647935377051 26.46129145552155 25.492950679845467 22.979278510862475 25-29 25.10766149223836 26.57486229344016 26.024036054081122 22.293440160240362 30-34 24.59 26.685 26.240000000000002 22.485 35-39 24.775 27.21 25.430000000000003 22.585 40-44 25.205 26.685 25.319999999999997 22.79 45-49 25.09 26.705000000000002 25.865 22.34 50-54 24.83 27.189999999999998 26.005 21.975 55-59 25.62215212057483 26.423313805017273 25.61714486004707 22.337389214360822 60-64 25.319999999999997 26.740000000000002 25.77 22.17 65-69 25.84016803360672 26.125225045009003 25.870174034806958 22.164432886577316 70-74 25.329326321061856 26.79188580015026 25.534685699974958 22.34410217881292 75-79 25.1 26.200000000000003 26.040000000000003 22.66 80-84 24.98 26.75 25.935000000000002 22.335 85-89 25.255 27.02 25.34 22.384999999999998 90-94 25.1 26.69 26.135 22.075 95-99 25.44 26.965 25.729999999999997 21.865000000000002 100-104 25.403891361976694 27.099484819686893 25.373880858300407 22.122742960036014 105-109 24.971162044234916 26.90706655298661 25.59305882942976 22.528712573348713 110-114 24.94224008036163 27.036664992466097 25.921647413360123 22.099447513812155 115-119 25.326633165829143 26.66331658291457 26.090452261306535 21.91959798994975 120-124 25.473684210526315 26.93734335839599 25.84962406015038 21.73934837092732 125-129 25.206260313015648 27.31136556827841 25.83629181459073 21.646082304115204 130-134 25.014999999999997 27.115000000000002 25.319999999999997 22.55 135-139 25.145 26.740000000000002 26.729999999999997 21.385 140-144 25.080000000000002 26.75 26.405 21.765 145-149 25.814999999999998 27.169999999999998 25.795 21.22 150-151 25.124999999999996 26.775 26.387500000000003 21.712500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 2.0 25 1.5 26 0.5 27 2.0 28 5.0 29 8.5 30 10.5 31 11.5 32 14.0 33 22.0 34 30.0 35 37.0 36 51.0 37 62.5 38 88.5 39 112.0 40 144.0 41 188.5 42 199.5 43 208.5 44 229.0 45 243.5 46 242.5 47 228.0 48 208.0 49 183.5 50 172.0 51 164.0 52 141.0 53 117.5 54 97.0 55 84.5 56 70.5 57 68.0 58 69.0 59 61.0 60 55.0 61 49.0 62 49.5 63 40.5 64 38.0 65 39.5 66 29.0 67 23.0 68 22.0 69 22.5 70 20.5 71 12.5 72 5.0 73 3.0 74 3.5 75 2.0 76 1.5 77 1.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.05 3 0.125 4 0.27499999999999997 5 0.375 6 0.2 7 0.17500000000000002 8 0.27499999999999997 9 0.17500000000000002 10-14 0.215 15-19 0.26 20-24 0.345 25-29 0.15 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.145 60-64 0.0 65-69 0.02 70-74 0.17500000000000002 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.034999999999999996 105-109 0.305 110-114 0.44999999999999996 115-119 0.5 120-124 0.25 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3709109209864 98.725 2 0.6039255158530448 1.2 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.5 0.0 0.0 0.0 0.0 126-127 0.55 0.0 0.0 0.0 0.0 128-129 0.55 0.0 0.0 0.0 0.0 130-131 0.5625 0.0 0.0 0.0 0.0 132-133 0.65 0.0 0.0 0.0 0.0 134-135 0.725 0.0 0.0 0.0 0.0 136-137 0.775 0.0 0.0 0.0 0.0 138-139 0.7875000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGGATC 10 0.006830828 145.0 8 CAATTAT 10 0.006830828 145.0 1 TTCCAGA 10 0.006830828 145.0 9 CTTCCAG 10 0.006830828 145.0 8 >>END_MODULE Read 408773 spots for SRR6031169.sra Written 408773 spots for SRR6031169.sra Read 408773 spots for SRR6031169.sra Written 408773 spots for SRR6031169.sra Read 408773 spots for SRR6031169.sra Written 408773 spots for SRR6031169.sra Read 408773 spots for SRR6031169.sra Written 408773 spots for SRR6031169.sra Read 408773 spots for SRR6031169.sra Written 408773 spots for SRR6031169.sra Read 408773 spots for SRR6031169.sra Written 408773 spots for SRR6031169.sra Read 408773 spots for SRR6031169.sra Written 408773 spots for SRR6031169.sra Read 408773 spots for SRR6031169.sra Written 408773 spots for SRR6031169.sra Read 408773 spots for SRR6031169.sra Written 408773 spots for SRR6031169.sra Read 408773 spots for SRR6031169.sra Written 408773 spots for SRR6031169.sra Read 408773 spots for SRR6031169.sra Written 408773 spots for SRR6031169.sra Read 408773 spots for SRR6031169.sra Written 408773 spots for SRR6031169.sra Read 408773 spots for SRR6031169.sra Written 408773 spots for SRR6031169.sra Read 408773 spots for SRR6031169.sra Written 408773 spots for SRR6031169.sra Read 408773 spots for SRR6031169.sra Written 408773 spots for SRR6031169.sra Read 408781 spots for SRR6031169.sra Written 408781 spots for SRR6031169.sra Read 408773 spots for SRR6031169.sra Written 408773 spots for SRR6031169.sra Read 408773 spots for SRR6031169.sra Written 408773 spots for SRR6031169.sra Read 408773 spots for SRR6031169.sra Written 408773 spots for SRR6031169.sra Read 408773 spots for SRR6031169.sra Written 408773 spots for SRR6031169.sra SRR ids: ['SRR6031169.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nft65u1u SRR6031169.sra spots: 8175468 blocks: [[1, 408773], [408774, 817546], [817547, 1226319], [1226320, 1635092], [1635093, 2043865], [2043866, 2452638], [2452639, 2861411], [2861412, 3270184], [3270185, 3678957], [3678958, 4087730], [4087731, 4496503], [4496504, 4905276], [4905277, 5314049], [5314050, 5722822], [5722823, 6131595], [6131596, 6540368], [6540369, 6949141], [6949142, 7357914], [7357915, 7766687], [7766688, 8175468]] SRR6031169 file size 2752261 SRR6031169 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031169 SRR6031169_1.fastq SRR6031169_2.fastq Input file: SRR6031169_1.fastq Paired file: SRR6031169_2.fastq trimmed: SRR6031169-trimmed-pair1.fastq, SRR6031169-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:28:58 2024 >> started Tue Dec 10 00:29:08 2024 >> done (9.459s) 8175468 read pairs processed; of these: 3932 ( 0.05%) short read pairs filtered out after trimming by size control 4543 ( 0.06%) empty read pairs filtered out after trimming by size control 8166993 (99.90%) read pairs available; of these: 1738198 (21.28%) trimmed read pairs available after processing 6428795 (78.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 6 0.00% 21 4 0.00% 22 7 0.00% 23 7 0.00% 24 14 0.00% 25 8 0.00% 26 7 0.00% 27 14 0.00% 28 17 0.00% 29 9 0.00% 30 13 0.00% 31 13 0.00% 32 7 0.00% 33 11 0.00% 34 6 0.00% 35 14 0.00% 36 6 0.00% 37 12 0.00% 38 5 0.00% 39 13 0.00% 40 8 0.00% 41 7 0.00% 42 11 0.00% 43 14 0.00% 44 9 0.00% 45 6 0.00% 46 14 0.00% 47 6 0.00% 48 17 0.00% 49 15 0.00% 50 17 0.00% 51 16 0.00% 52 21 0.00% 53 15 0.00% 54 22 0.00% 55 17 0.00% 56 17 0.00% 57 24 0.00% 58 25 0.00% 59 33 0.00% 60 30 0.00% 61 40 0.00% 62 37 0.00% 63 48 0.00% 64 45 0.00% 65 46 0.00% 66 51 0.00% 67 58 0.00% 68 62 0.00% 69 93 0.00% 70 87 0.00% 71 111 0.00% 72 99 0.00% 73 125 0.00% 74 112 0.00% 75 117 0.00% 76 154 0.00% 77 203 0.00% 78 188 0.00% 79 183 0.00% 80 240 0.00% 81 263 0.00% 82 260 0.00% 83 292 0.00% 84 451 0.01% 85 596 0.01% 86 640 0.01% 87 751 0.01% 88 852 0.01% 89 848 0.01% 90 931 0.01% 91 879 0.01% 92 912 0.01% 93 919 0.01% 94 921 0.01% 95 944 0.01% 96 1006 0.01% 97 1030 0.01% 98 967 0.01% 99 1091 0.01% 100 1112 0.01% 101 1120 0.01% 102 1224 0.01% 103 1279 0.02% 104 1321 0.02% 105 1386 0.02% 106 1519 0.02% 107 1428 0.02% 108 1589 0.02% 109 1673 0.02% 110 1675 0.02% 111 1846 0.02% 112 1965 0.02% 113 2214 0.03% 114 2393 0.03% 115 2749 0.03% 116 2879 0.04% 117 2755 0.03% 118 2478 0.03% 119 2477 0.03% 120 2628 0.03% 121 2737 0.03% 122 2864 0.04% 123 2912 0.04% 124 2952 0.04% 125 3177 0.04% 126 3250 0.04% 127 3519 0.04% 128 3611 0.04% 129 3820 0.05% 130 3954 0.05% 131 4207 0.05% 132 4359 0.05% 133 4681 0.06% 134 5125 0.06% 135 5232 0.06% 136 5650 0.07% 137 6063 0.07% 138 6565 0.08% 139 7133 0.09% 140 7609 0.09% 141 8303 0.10% 142 9533 0.12% 143 11024 0.13% 144 13227 0.16% 145 16181 0.20% 146 21212 0.26% 147 31461 0.39% 148 54341 0.67% 149 140374 1.72% 150 1286211 15.75% 151 6428795 78.72% 8166993 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=32 prefix-density=0.29 prefix-fanout=2.0 sequence=TACCCTTTTGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=30.26 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.6 sequence=GCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=30 prefix-density=0.35 prefix-fanout=2.5 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=180.69 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=14.9 sequence=CCGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR6031169 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:29:56 Started mapping on | Dec 10 00:29:56 Finished on | Dec 10 00:31:04 Mapping speed, Million of reads per hour | 432.37 Number of input reads | 8166993 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 7594363 Uniquely mapped reads % | 92.99% Average mapped length | 300.13 Number of splices: Total | 8992476 Number of splices: Annotated (sjdb) | 8553119 Number of splices: GT/AG | 8877082 Number of splices: GC/AG | 104242 Number of splices: AT/AC | 5087 Number of splices: Non-canonical | 6065 Mismatch rate per base, % | 0.06% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 144860 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 20024 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.72% % of reads unmapped: other | 2.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 430691 430691 430691 N_multimapping 144860 144860 144860 N_noFeature 388232 7390959 442628 N_ambiguous 185881 1547 38037 UnstrandedReadsAssigned:7020250 PositiveStrandReadsAssigned:201857 NegativeStrandReadsAssigned:7113698 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6031169 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6031169-trimmed-pair1.fastq SRR6031169-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,166,993 reads, 7,192,190 reads pseudoaligned [quant] estimated average fragment length: 428.472 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,060 rounds 52973 SRR6031169.ke.tsv 35125 SRR6031169.se.tsv 88098 total ==> SRR6031169.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 509.778 0 0 PNS24247 1044 616.528 45.4239 15.3723 PNS24249 1928 1500.53 6.08696 0.846378 PNS24246 1044 616.528 45.4239 15.3723 PNS24248 1044 616.528 45.4239 15.3723 PNS24244 1471 1043.53 25.6414 5.1268 PNS24243 293 64.3531 0 0 KQK14069 1603 1175.53 1327.37 235.595 KQK14071 474 133.031 4.51949 7.08837 ==> SRR6031169.se.tsv <== BRADI_1g14170v3 1446 BRADI_1g53295v3 32 BRADI_1g59795v3 336 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 401 BRADI_1g74790v3 61 BRADI_1g09890v3 0 BRADI_1g77505v3 99 BRADI_1g48960v3 0 SRR6031169 completed mapping pipeline successfully