Starting /dee2/code/volunteer_pipeline.sh SRR6031170 current disk space = 1523708215296 free memory = 1569695456 SRR6031170 SRAfilesize b58c0a5e9990f97a0d47a24a5ddfde28 SRR6031170.sra SRR6031170.sra file validated SRR6031170 is paired end SRR6031170 is conventional basespace SRR6031170 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031170_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.59875 32.0 30.0 32.0 18.0 33.0 2 32.194 33.0 31.0 33.0 31.0 33.0 3 32.6785 33.0 33.0 33.0 31.0 34.0 4 33.2065 33.0 33.0 34.0 33.0 34.0 5 33.63875 34.0 33.0 34.0 33.0 34.0 6 37.5785 38.0 38.0 38.0 37.0 38.0 7 37.8185 38.0 38.0 38.0 38.0 38.0 8 37.87575 38.0 38.0 38.0 38.0 38.0 9 37.88875 38.0 38.0 38.0 38.0 38.0 10-14 37.8861 38.0 38.0 38.0 38.0 38.0 15-19 37.8856 38.0 38.0 38.0 38.0 38.0 20-24 37.90115 38.0 38.0 38.0 38.0 38.0 25-29 37.8948 38.0 38.0 38.0 38.0 38.0 30-34 37.890499999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.8609 38.0 38.0 38.0 38.0 38.0 40-44 37.843199999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.85105 38.0 38.0 38.0 38.0 38.0 50-54 37.788 38.0 38.0 38.0 38.0 38.0 55-59 37.76895 38.0 38.0 38.0 38.0 38.0 60-64 37.7525 38.0 38.0 38.0 38.0 38.0 65-69 37.72935 38.0 38.0 38.0 38.0 38.0 70-74 37.7099 38.0 38.0 38.0 38.0 38.0 75-79 37.70725 38.0 38.0 38.0 38.0 38.0 80-84 37.69024999999999 38.0 38.0 38.0 38.0 38.0 85-89 37.661 38.0 38.0 38.0 38.0 38.0 90-94 37.59755 38.0 38.0 38.0 38.0 38.0 95-99 37.579 38.0 38.0 38.0 38.0 38.0 100-104 37.50645 38.0 38.0 38.0 37.8 38.0 105-109 37.464549999999996 38.0 38.0 38.0 37.6 38.0 110-114 37.41525 38.0 38.0 38.0 37.2 38.0 115-119 37.3367 38.0 38.0 38.0 37.0 38.0 120-124 37.239700000000006 38.0 38.0 38.0 36.4 38.0 125-129 37.17999999999999 38.0 38.0 38.0 36.0 38.0 130-134 37.0423 38.0 38.0 38.0 35.8 38.0 135-139 36.9189 38.0 38.0 38.0 35.0 38.0 140-144 36.7726 38.0 38.0 38.0 35.0 38.0 145-149 36.5547 38.0 38.0 38.0 34.8 38.0 150-151 34.541624999999996 38.0 36.0 38.0 27.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 1.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 1.0 20 0.0 21 0.0 22 2.0 23 2.0 24 2.0 25 1.0 26 5.0 27 2.0 28 2.0 29 3.0 30 2.0 31 13.0 32 15.0 33 26.0 34 42.0 35 94.0 36 277.0 37 3508.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.47642928786359 13.089267803410232 8.099297893681042 28.335005015045134 2 23.175 13.8 35.4 27.625 3 20.225 18.575 28.025 33.175 4 23.325000000000003 25.4 23.925 27.35 5 24.537268634317158 28.8144072036018 23.761880940470235 22.886443221610804 6 23.883592574009032 31.359759157049673 23.482187656798796 21.274460612142498 7 16.125 27.05 38.925 17.9 8 19.375 26.05 28.449999999999996 26.125 9 20.0 22.55 32.425 25.025 10-14 21.43 27.825 26.555 24.19 15-19 21.795 26.58 26.834999999999997 24.79 20-24 21.95 26.490000000000002 27.744999999999997 23.815 25-29 21.5 26.455000000000002 27.07 24.975 30-34 21.575 26.345000000000002 27.21 24.87 35-39 22.335 26.43 26.855 24.38 40-44 22.08 26.905 27.015 24.0 45-49 21.68716871687169 26.842684268426844 26.977697769776977 24.49244924492449 50-54 22.317231723172316 26.4026402640264 26.927692769276927 24.352435243524354 55-59 21.515 26.555 27.265 24.665 60-64 21.87 26.33 27.084999999999997 24.715 65-69 21.725 27.034999999999997 26.584999999999997 24.654999999999998 70-74 21.78 27.275 26.619999999999997 24.325 75-79 21.8 26.474999999999998 26.85 24.875 80-84 21.555 26.145000000000003 27.58 24.72 85-89 21.795 26.805 26.995 24.404999999999998 90-94 21.82 26.55 26.735 24.895 95-99 21.975 26.625 26.755000000000003 24.645 100-104 21.654999999999998 26.700000000000003 26.96 24.685000000000002 105-109 21.91 26.36 27.04 24.69 110-114 21.785 26.11 27.275 24.83 115-119 22.205 25.755 26.945000000000004 25.095 120-124 22.040000000000003 26.484999999999996 26.68 24.795 125-129 22.16 25.569999999999997 27.439999999999998 24.83 130-134 22.435 26.125 26.834999999999997 24.605 135-139 22.375 26.215 27.08 24.33 140-144 22.3 26.31 26.69 24.7 145-149 22.289457891578316 26.500300060012 26.6003200640128 24.60992198439688 150-151 21.31782945736434 26.531632908227053 27.081770442610654 25.068767191797946 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 1.5 28 4.0 29 6.5 30 9.5 31 11.5 32 18.0 33 24.0 34 33.5 35 47.5 36 49.5 37 72.0 38 112.5 39 131.5 40 152.0 41 193.0 42 209.0 43 215.5 44 239.0 45 250.0 46 241.5 47 228.5 48 229.5 49 205.0 50 167.0 51 147.5 52 132.0 53 121.5 54 105.0 55 91.5 56 84.5 57 75.5 58 66.5 59 56.5 60 44.5 61 34.5 62 29.0 63 28.5 64 28.0 65 22.5 66 17.5 67 14.0 68 12.5 69 11.0 70 7.0 71 5.5 72 4.0 73 2.5 74 1.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.05 6 0.35000000000000003 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.01 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.02 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94997498749375 99.9 2 0.05002501250625312 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.037500000000000006 0.0 0.0 0.0 0.0 114-115 0.05 0.0 0.0 0.0 0.0 116-117 0.05 0.0 0.0 0.0 0.0 118-119 0.0625 0.0 0.0 0.0 0.0 120-121 0.0875 0.0 0.0 0.0 0.0 122-123 0.1 0.0 0.0 0.0 0.0 124-125 0.1 0.0 0.0 0.0 0.0 126-127 0.1 0.0 0.0 0.0 0.0 128-129 0.125 0.0 0.0 0.0 0.0 130-131 0.125 0.0 0.0 0.0 0.0 132-133 0.1625 0.0 0.0 0.0 0.0 134-135 0.21250000000000002 0.0 0.0 0.0 0.0 136-137 0.25 0.0 0.0 0.0 0.0 138-139 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6031170 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031170_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.48775 34.0 33.0 34.0 33.0 34.0 2 33.568 34.0 33.0 34.0 33.0 34.0 3 33.57775 34.0 34.0 34.0 33.0 34.0 4 33.531 34.0 34.0 34.0 33.0 34.0 5 33.54875 34.0 34.0 34.0 33.0 34.0 6 37.71525 38.0 38.0 38.0 38.0 38.0 7 37.71725 38.0 38.0 38.0 38.0 38.0 8 37.6775 38.0 38.0 38.0 38.0 38.0 9 37.7115 38.0 38.0 38.0 38.0 38.0 10-14 37.70005 38.0 38.0 38.0 38.0 38.0 15-19 37.6743 38.0 38.0 38.0 38.0 38.0 20-24 37.6439 38.0 38.0 38.0 38.0 38.0 25-29 37.709500000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.776599999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.785250000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.782149999999994 38.0 38.0 38.0 38.0 38.0 45-49 37.79855 38.0 38.0 38.0 38.0 38.0 50-54 37.76460000000001 38.0 38.0 38.0 38.0 38.0 55-59 37.69445 38.0 38.0 38.0 38.0 38.0 60-64 37.74645 38.0 38.0 38.0 38.0 38.0 65-69 37.73845 38.0 38.0 38.0 38.0 38.0 70-74 37.6445 38.0 38.0 38.0 38.0 38.0 75-79 37.68005 38.0 38.0 38.0 38.0 38.0 80-84 37.69675 38.0 38.0 38.0 38.0 38.0 85-89 37.6442 38.0 38.0 38.0 38.0 38.0 90-94 37.62155 38.0 38.0 38.0 38.0 38.0 95-99 37.60475 38.0 38.0 38.0 38.0 38.0 100-104 37.5549 38.0 38.0 38.0 38.0 38.0 105-109 37.40070000000001 38.0 38.0 38.0 38.0 38.0 110-114 37.36395 38.0 38.0 38.0 38.0 38.0 115-119 37.30375 38.0 38.0 38.0 38.0 38.0 120-124 37.3162 38.0 38.0 38.0 38.0 38.0 125-129 37.3593 38.0 38.0 38.0 37.8 38.0 130-134 37.31195 38.0 38.0 38.0 37.8 38.0 135-139 37.2394 38.0 38.0 38.0 36.8 38.0 140-144 37.1708 38.0 38.0 38.0 36.0 38.0 145-149 36.93275 38.0 38.0 38.0 36.0 38.0 150-151 34.985375000000005 38.0 36.0 38.0 29.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 2.0 12 1.0 13 0.0 14 1.0 15 1.0 16 1.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 3.0 23 2.0 24 6.0 25 3.0 26 5.0 27 6.0 28 3.0 29 6.0 30 8.0 31 6.0 32 10.0 33 17.0 34 33.0 35 55.0 36 143.0 37 3681.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.434826119589694 21.015761821366024 9.682261696272205 22.86715036277208 2 27.102102102102105 29.254254254254253 25.05005005005005 18.593593593593592 3 21.126408010012515 29.737171464330416 29.336670838548184 19.799749687108886 4 24.423269809428287 32.673019057171516 21.464393179538614 21.439317953861583 5 25.33868539889614 33.993978926241844 20.973406924234823 19.693928750627197 6 24.360902255639097 35.21303258145363 20.676691729323306 19.749373433583962 7 23.140495867768596 20.786376158276983 34.91109441522664 21.162033558727774 8 23.069207622868607 25.351053159478436 24.523570712136408 27.05616850551655 9 22.319639278557112 24.223446893787575 28.73246492985972 24.724448897795593 10-14 24.573977546110665 27.425821972734564 24.533881315156375 23.466319165998396 15-19 24.768019260671114 26.297838190299444 25.505341826754275 23.428800722275167 20-24 25.00878293601004 26.880803011292347 24.993726474278542 23.11668757841907 25-29 24.98497295131236 26.45261470647165 25.260468843919053 23.301943498296936 30-34 25.019999999999996 26.625 25.629999999999995 22.725 35-39 24.709999999999997 26.375 25.174999999999997 23.74 40-44 24.759999999999998 26.595000000000002 25.46 23.185 45-49 24.915000000000003 26.1 25.97 23.015 50-54 24.8 26.43 26.435 22.335 55-59 25.172793749373934 26.13442852849845 25.658619653410796 23.034158068716817 60-64 24.645 26.645000000000003 25.89 22.82 65-69 24.65739721916575 26.657997399219767 25.72271681504451 22.96188856656997 70-74 24.56404088995791 26.97935458007617 25.771697735017035 22.684906794948887 75-79 25.192519251925194 26.48264826482648 25.417541754175417 22.90729072907291 80-84 24.665 26.314999999999998 25.979999999999997 23.04 85-89 25.295 26.705000000000002 25.405 22.595000000000002 90-94 24.72 26.484999999999996 25.695 23.1 95-99 24.725 27.01 25.25 23.015 100-104 25.467733866933468 27.25862931465733 24.852426213106554 22.42121060530265 105-109 25.033870239349692 26.604445782527975 25.766470971950422 22.59521300617191 110-114 24.629676123524984 26.894300778307805 25.99548079337183 22.48054230479538 115-119 25.37545833542619 26.590988999949772 25.70194384449244 22.3316088201316 120-124 24.818250188017046 26.001504136375033 26.44773126096766 22.732514414640264 125-129 24.69246924692469 26.94269426942694 25.78757875787579 22.577257725772576 130-134 25.115 26.665 25.619999999999997 22.6 135-139 24.884999999999998 26.8 25.490000000000002 22.825 140-144 24.44 26.71 25.655 23.195 145-149 25.155 26.400000000000002 25.885 22.56 150-151 24.8 26.0625 25.7625 23.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.5 25 1.5 26 3.0 27 3.5 28 5.0 29 6.0 30 7.5 31 10.5 32 17.0 33 21.0 34 26.0 35 39.5 36 59.5 37 72.5 38 85.0 39 120.5 40 153.5 41 174.0 42 197.0 43 213.5 44 230.0 45 226.5 46 218.0 47 216.0 48 199.5 49 186.5 50 175.5 51 138.0 52 110.5 53 106.0 54 94.5 55 88.0 56 76.0 57 76.0 58 80.0 59 68.5 60 64.5 61 64.5 62 56.5 63 46.0 64 40.5 65 40.5 66 35.5 67 34.0 68 30.0 69 18.5 70 16.5 71 15.0 72 11.5 73 8.5 74 2.5 75 1.0 76 1.0 77 1.0 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.1 3 0.125 4 0.3 5 0.35000000000000003 6 0.25 7 0.17500000000000002 8 0.3 9 0.2 10-14 0.24 15-19 0.315 20-24 0.375 25-29 0.18 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.16999999999999998 60-64 0.0 65-69 0.03 70-74 0.22 75-79 0.01 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.05 105-109 0.35500000000000004 110-114 0.42500000000000004 115-119 0.455 120-124 0.27499999999999997 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.037500000000000006 0.0 0.0 0.0 0.0 114-115 0.05 0.0 0.0 0.0 0.0 116-117 0.05 0.0 0.0 0.0 0.0 118-119 0.0625 0.0 0.0 0.0 0.0 120-121 0.0875 0.0 0.0 0.0 0.0 122-123 0.1 0.0 0.0 0.0 0.0 124-125 0.1 0.0 0.0 0.0 0.0 126-127 0.1 0.0 0.0 0.0 0.0 128-129 0.125 0.0 0.0 0.0 0.0 130-131 0.125 0.0 0.0 0.0 0.0 132-133 0.1625 0.0 0.0 0.0 0.0 134-135 0.21250000000000002 0.0 0.0 0.0 0.0 136-137 0.25 0.0 0.0 0.0 0.0 138-139 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTCCGT 10 0.006830828 145.0 6 >>END_MODULE Read 381097 spots for SRR6031170.sra Written 381097 spots for SRR6031170.sra Read 381097 spots for SRR6031170.sra Written 381097 spots for SRR6031170.sra Read 381097 spots for SRR6031170.sra Written 381097 spots for SRR6031170.sra Read 381097 spots for SRR6031170.sra Written 381097 spots for SRR6031170.sra Read 381097 spots for SRR6031170.sra Written 381097 spots for SRR6031170.sra Read 381097 spots for SRR6031170.sra Written 381097 spots for SRR6031170.sra Read 381097 spots for SRR6031170.sra Written 381097 spots for SRR6031170.sra Read 381097 spots for SRR6031170.sra Written 381097 spots for SRR6031170.sra Read 381097 spots for SRR6031170.sra Written 381097 spots for SRR6031170.sra Read 381097 spots for SRR6031170.sra Written 381097 spots for SRR6031170.sra Read 381097 spots for SRR6031170.sra Written 381097 spots for SRR6031170.sra Read 381097 spots for SRR6031170.sra Written 381097 spots for SRR6031170.sra Read 381097 spots for SRR6031170.sra Written 381097 spots for SRR6031170.sra Read 381097 spots for SRR6031170.sra Written 381097 spots for SRR6031170.sra Read 381097 spots for SRR6031170.sra Written 381097 spots for SRR6031170.sra Read 381104 spots for SRR6031170.sra Written 381104 spots for SRR6031170.sra Read 381097 spots for SRR6031170.sra Written 381097 spots for SRR6031170.sra Read 381097 spots for SRR6031170.sra Written 381097 spots for SRR6031170.sra Read 381097 spots for SRR6031170.sra Written 381097 spots for SRR6031170.sra Read 381097 spots for SRR6031170.sra Written 381097 spots for SRR6031170.sra SRR ids: ['SRR6031170.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0ob92og4 SRR6031170.sra spots: 7621947 blocks: [[1, 381097], [381098, 762194], [762195, 1143291], [1143292, 1524388], [1524389, 1905485], [1905486, 2286582], [2286583, 2667679], [2667680, 3048776], [3048777, 3429873], [3429874, 3810970], [3810971, 4192067], [4192068, 4573164], [4573165, 4954261], [4954262, 5335358], [5335359, 5716455], [5716456, 6097552], [6097553, 6478649], [6478650, 6859746], [6859747, 7240843], [7240844, 7621947]] SRR6031170 file size 2565772 SRR6031170 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031170 SRR6031170_1.fastq SRR6031170_2.fastq Input file: SRR6031170_1.fastq Paired file: SRR6031170_2.fastq trimmed: SRR6031170-trimmed-pair1.fastq, SRR6031170-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:34:40 2024 >> started Tue Dec 10 00:34:48 2024 >> done (7.974s) 7621947 read pairs processed; of these: 4615 ( 0.06%) short read pairs filtered out after trimming by size control 4411 ( 0.06%) empty read pairs filtered out after trimming by size control 7612921 (99.88%) read pairs available; of these: 1718296 (22.57%) trimmed read pairs available after processing 5894625 (77.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 9 0.00% 21 5 0.00% 22 7 0.00% 23 2 0.00% 24 7 0.00% 25 6 0.00% 26 6 0.00% 27 8 0.00% 28 4 0.00% 29 7 0.00% 30 3 0.00% 31 3 0.00% 32 5 0.00% 33 8 0.00% 34 5 0.00% 35 6 0.00% 36 5 0.00% 37 7 0.00% 38 3 0.00% 39 4 0.00% 40 6 0.00% 41 9 0.00% 42 8 0.00% 43 6 0.00% 44 9 0.00% 45 6 0.00% 46 6 0.00% 47 5 0.00% 48 12 0.00% 49 10 0.00% 50 7 0.00% 51 4 0.00% 52 11 0.00% 53 19 0.00% 54 10 0.00% 55 11 0.00% 56 16 0.00% 57 12 0.00% 58 16 0.00% 59 19 0.00% 60 25 0.00% 61 35 0.00% 62 28 0.00% 63 29 0.00% 64 20 0.00% 65 31 0.00% 66 33 0.00% 67 34 0.00% 68 48 0.00% 69 63 0.00% 70 57 0.00% 71 61 0.00% 72 63 0.00% 73 92 0.00% 74 87 0.00% 75 80 0.00% 76 103 0.00% 77 130 0.00% 78 134 0.00% 79 135 0.00% 80 149 0.00% 81 166 0.00% 82 194 0.00% 83 191 0.00% 84 367 0.00% 85 552 0.01% 86 473 0.01% 87 536 0.01% 88 608 0.01% 89 583 0.01% 90 638 0.01% 91 649 0.01% 92 604 0.01% 93 643 0.01% 94 662 0.01% 95 721 0.01% 96 683 0.01% 97 668 0.01% 98 759 0.01% 99 739 0.01% 100 871 0.01% 101 884 0.01% 102 911 0.01% 103 993 0.01% 104 1076 0.01% 105 1061 0.01% 106 1184 0.02% 107 1137 0.01% 108 1127 0.01% 109 1215 0.02% 110 1258 0.02% 111 1284 0.02% 112 1423 0.02% 113 1582 0.02% 114 1630 0.02% 115 1725 0.02% 116 1749 0.02% 117 1852 0.02% 118 1948 0.03% 119 1957 0.03% 120 2042 0.03% 121 2217 0.03% 122 2300 0.03% 123 2402 0.03% 124 2571 0.03% 125 2623 0.03% 126 2723 0.04% 127 2945 0.04% 128 3046 0.04% 129 3238 0.04% 130 3389 0.04% 131 3622 0.05% 132 3812 0.05% 133 4112 0.05% 134 4356 0.06% 135 4779 0.06% 136 5200 0.07% 137 5519 0.07% 138 6107 0.08% 139 6568 0.09% 140 7323 0.10% 141 8211 0.11% 142 9239 0.12% 143 10941 0.14% 144 12943 0.17% 145 16363 0.21% 146 22159 0.29% 147 32920 0.43% 148 58354 0.77% 149 149058 1.96% 150 1278153 16.79% 151 5894625 77.43% 7612921 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=28 prefix-density=0.20 prefix-fanout=2.4 sequence=ATGCCCTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCGATGGTGTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=21 fanout-score=405.35 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=31.3 sequence=CTTCTTCTTGAT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=4.10 fanout-score-rank=23 prefix-density=0.30 prefix-fanout=3.4 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=148.16 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=20.3 sequence=CGCCGCCGCCGC SRR6031170 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:35:38 Started mapping on | Dec 10 00:35:38 Finished on | Dec 10 00:37:41 Mapping speed, Million of reads per hour | 222.82 Number of input reads | 7612921 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 7010678 Uniquely mapped reads % | 92.09% Average mapped length | 300.26 Number of splices: Total | 8509542 Number of splices: Annotated (sjdb) | 8115212 Number of splices: GT/AG | 8401365 Number of splices: GC/AG | 98236 Number of splices: AT/AC | 4960 Number of splices: Non-canonical | 4981 Mismatch rate per base, % | 0.06% Deletion rate per base | 0.00% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 63741 % of reads mapped to multiple loci | 0.84% Number of reads mapped to too many loci | 1500 % of reads mapped to too many loci | 0.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.86% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 541853 541853 541853 N_multimapping 63741 63741 63741 N_noFeature 229083 6833314 272597 N_ambiguous 162264 1456 28634 UnstrandedReadsAssigned:6619331 PositiveStrandReadsAssigned:175908 NegativeStrandReadsAssigned:6709447 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6031170 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6031170-trimmed-pair1.fastq SRR6031170-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,612,921 reads, 6,745,695 reads pseudoaligned [quant] estimated average fragment length: 450.812 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52973 SRR6031170.ke.tsv 35125 SRR6031170.se.tsv 88098 total ==> SRR6031170.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 487.67 0 0 PNS24247 1044 594.188 35.6294 13.3434 PNS24249 1928 1478.19 13.4705 2.02784 PNS24246 1044 594.188 35.6294 13.3434 PNS24248 1044 594.188 35.6294 13.3434 PNS24244 1471 1021.19 34.6414 7.54868 PNS24243 293 62.012 0 0 KQK14069 1603 1153.19 1375.48 265.422 KQK14071 474 126.362 6.10409 10.7495 ==> SRR6031170.se.tsv <== BRADI_1g14170v3 1627 BRADI_1g53295v3 34 BRADI_1g59795v3 228 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 488 BRADI_1g74790v3 60 BRADI_1g09890v3 0 BRADI_1g77505v3 76 BRADI_1g48960v3 0 SRR6031170 completed mapping pipeline successfully