Starting /dee2/code/volunteer_pipeline.sh SRR6031171 current disk space = 1523693375488 free memory = 1598621704 SRR6031171 SRAfilesize 199ca39e393e82795b85ef46a751a873 SRR6031171.sra SRR6031171.sra file validated SRR6031171 is paired end SRR6031171 is conventional basespace SRR6031171 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031171_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.83075 32.0 31.0 33.0 28.0 33.0 2 32.729 33.0 33.0 33.0 31.0 33.0 3 32.9905 33.0 33.0 34.0 33.0 34.0 4 33.39425 34.0 33.0 34.0 33.0 34.0 5 33.6535 34.0 34.0 34.0 33.0 34.0 6 37.43 38.0 38.0 38.0 37.0 38.0 7 37.74425 38.0 38.0 38.0 38.0 38.0 8 37.774 38.0 38.0 38.0 38.0 38.0 9 37.84475 38.0 38.0 38.0 38.0 38.0 10-14 37.8322 38.0 38.0 38.0 38.0 38.0 15-19 37.82815 38.0 38.0 38.0 38.0 38.0 20-24 37.833800000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.763850000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.782349999999994 38.0 38.0 38.0 38.0 38.0 35-39 37.7857 38.0 38.0 38.0 38.0 38.0 40-44 37.754450000000006 38.0 38.0 38.0 38.0 38.0 45-49 37.73205 38.0 38.0 38.0 38.0 38.0 50-54 37.68 38.0 38.0 38.0 38.0 38.0 55-59 37.645849999999996 38.0 38.0 38.0 38.0 38.0 60-64 37.6421 38.0 38.0 38.0 38.0 38.0 65-69 37.62565 38.0 38.0 38.0 38.0 38.0 70-74 37.582499999999996 38.0 38.0 38.0 38.0 38.0 75-79 37.5926 38.0 38.0 38.0 38.0 38.0 80-84 37.5548 38.0 38.0 38.0 38.0 38.0 85-89 37.502300000000005 38.0 38.0 38.0 38.0 38.0 90-94 37.480999999999995 38.0 38.0 38.0 38.0 38.0 95-99 37.4603 38.0 38.0 38.0 37.8 38.0 100-104 37.340799999999994 38.0 38.0 38.0 37.0 38.0 105-109 37.31230000000001 38.0 38.0 38.0 37.0 38.0 110-114 37.289100000000005 38.0 38.0 38.0 36.8 38.0 115-119 37.18580000000001 38.0 38.0 38.0 36.2 38.0 120-124 37.030750000000005 38.0 38.0 38.0 36.0 38.0 125-129 37.03895 38.0 38.0 38.0 35.8 38.0 130-134 36.906349999999996 38.0 38.0 38.0 35.2 38.0 135-139 36.87220000000001 38.0 38.0 38.0 35.0 38.0 140-144 36.60265 38.0 38.0 38.0 35.0 38.0 145-149 36.32525 38.0 38.0 38.0 34.6 38.0 150-151 34.110749999999996 37.0 35.5 38.0 27.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 2.0 20 0.0 21 1.0 22 0.0 23 5.0 24 0.0 25 6.0 26 8.0 27 8.0 28 11.0 29 10.0 30 12.0 31 16.0 32 19.0 33 28.0 34 36.0 35 115.0 36 274.0 37 3446.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.200501253132835 11.954887218045112 5.889724310776942 31.954887218045116 2 23.425 11.35 33.975 31.25 3 18.6 13.700000000000001 25.624999999999996 42.075 4 23.3 19.55 24.925 32.225 5 24.825 23.799999999999997 24.625 26.75 6 24.151796933902993 29.831615983915555 23.749685850716258 22.26690123146519 7 16.400000000000002 26.974999999999998 37.525 19.1 8 19.425 26.575 30.025000000000002 23.974999999999998 9 19.375 22.875 34.25 23.5 10-14 21.39 27.105 27.07 24.435000000000002 15-19 21.675 25.180000000000003 27.450000000000003 25.695 20-24 21.584999999999997 25.445 27.38 25.590000000000003 25-29 22.615 25.775 26.5 25.11 30-34 21.654999999999998 26.235000000000003 26.685 25.424999999999997 35-39 22.25 25.900000000000002 26.795 25.055 40-44 21.985 26.125 26.555 25.335 45-49 22.25 25.590000000000003 26.77 25.39 50-54 22.285 25.490000000000002 27.025 25.2 55-59 22.275 25.915 26.200000000000003 25.61 60-64 21.975 26.150000000000002 26.634999999999998 25.240000000000002 65-69 22.36 25.535000000000004 26.795 25.31 70-74 22.425 25.540000000000003 26.275 25.759999999999998 75-79 21.9 26.115 26.235000000000003 25.75 80-84 21.785 26.115 26.58 25.52 85-89 22.345000000000002 26.14 25.985000000000003 25.53 90-94 22.345000000000002 25.345000000000002 26.44 25.869999999999997 95-99 22.145 26.135 26.174999999999997 25.545 100-104 22.36 25.575 26.575 25.490000000000002 105-109 22.625 25.685000000000002 26.365 25.324999999999996 110-114 22.38 25.66 26.735 25.224999999999998 115-119 22.725 25.019999999999996 26.455000000000002 25.8 120-124 22.66 25.0 26.555 25.785000000000004 125-129 22.195 25.89 26.545 25.369999999999997 130-134 22.8 25.25 26.695 25.255 135-139 22.68 24.990000000000002 26.685 25.645 140-144 22.735 25.380000000000003 26.245 25.64 145-149 22.634999999999998 25.324999999999996 26.51 25.53 150-151 23.268317079269817 24.831207801950487 25.806451612903224 26.094023505876468 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 0.5 25 1.5 26 5.0 27 7.0 28 6.5 29 6.0 30 10.0 31 11.0 32 12.0 33 23.5 34 34.5 35 37.0 36 51.0 37 65.5 38 81.5 39 100.5 40 131.0 41 162.0 42 179.5 43 185.5 44 194.0 45 210.5 46 221.5 47 224.5 48 207.5 49 199.5 50 190.5 51 167.0 52 147.5 53 137.0 54 124.0 55 116.5 56 120.0 57 111.0 58 85.5 59 65.5 60 51.5 61 42.0 62 36.5 63 36.5 64 33.5 65 28.5 66 26.5 67 21.0 68 22.5 69 17.5 70 13.0 71 13.5 72 6.0 73 4.5 74 5.0 75 2.5 76 1.0 77 0.5 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.525 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.475 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83219091139883 97.32499999999999 2 0.8631632394008631 1.7000000000000002 3 0.2284843869002285 0.675 4 0.07616146230007616 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.225 0.0 0.0 0.0 0.0 118-119 0.2375 0.0 0.0 0.0 0.0 120-121 0.3 0.0 0.0 0.0 0.0 122-123 0.325 0.0 0.0 0.0 0.0 124-125 0.325 0.0 0.0 0.0 0.0 126-127 0.3375 0.0 0.0 0.0 0.0 128-129 0.4125 0.0 0.0 0.0 0.0 130-131 0.4875 0.0 0.0 0.0 0.0 132-133 0.525 0.0 0.0 0.0 0.0 134-135 0.525 0.0 0.0 0.0 0.0 136-137 0.525 0.0 0.0 0.0 0.0 138-139 0.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGGTT 10 0.006830828 145.0 1 >>END_MODULE SRR6031171 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031171_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.39 34.0 33.0 34.0 33.0 34.0 2 33.45225 34.0 33.0 34.0 33.0 34.0 3 33.40575 34.0 33.0 34.0 33.0 34.0 4 33.348 34.0 33.0 34.0 33.0 34.0 5 33.42575 34.0 33.0 34.0 33.0 34.0 6 37.578 38.0 38.0 38.0 38.0 38.0 7 37.592 38.0 38.0 38.0 38.0 38.0 8 37.5515 38.0 38.0 38.0 38.0 38.0 9 37.6125 38.0 38.0 38.0 38.0 38.0 10-14 37.55055 38.0 38.0 38.0 38.0 38.0 15-19 37.481399999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.37205 38.0 38.0 38.0 38.0 38.0 25-29 37.491200000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.66045 38.0 38.0 38.0 38.0 38.0 35-39 37.68415 38.0 38.0 38.0 38.0 38.0 40-44 37.67595000000001 38.0 38.0 38.0 38.0 38.0 45-49 37.62405 38.0 38.0 38.0 38.0 38.0 50-54 37.649950000000004 38.0 38.0 38.0 38.0 38.0 55-59 37.5611 38.0 38.0 38.0 38.0 38.0 60-64 37.59509999999999 38.0 38.0 38.0 38.0 38.0 65-69 37.563 38.0 38.0 38.0 38.0 38.0 70-74 37.440099999999994 38.0 38.0 38.0 38.0 38.0 75-79 37.564550000000004 38.0 38.0 38.0 38.0 38.0 80-84 37.5193 38.0 38.0 38.0 38.0 38.0 85-89 37.46095 38.0 38.0 38.0 38.0 38.0 90-94 37.42215 38.0 38.0 38.0 38.0 38.0 95-99 37.376 38.0 38.0 38.0 38.0 38.0 100-104 37.3505 38.0 38.0 38.0 37.8 38.0 105-109 37.18695 38.0 38.0 38.0 37.6 38.0 110-114 37.05495 38.0 38.0 38.0 37.0 38.0 115-119 36.91415 38.0 38.0 38.0 36.4 38.0 120-124 36.929 38.0 38.0 38.0 36.0 38.0 125-129 37.00705 38.0 38.0 38.0 36.0 38.0 130-134 37.02115 38.0 38.0 38.0 36.0 38.0 135-139 36.88334999999999 38.0 38.0 38.0 35.4 38.0 140-144 36.83245 38.0 38.0 38.0 35.4 38.0 145-149 36.60395 38.0 38.0 38.0 35.0 38.0 150-151 34.321625 38.0 35.5 38.0 28.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 0.0 5 0.0 6 0.0 7 0.0 8 2.0 9 1.0 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 6.0 18 1.0 19 4.0 20 2.0 21 3.0 22 4.0 23 5.0 24 4.0 25 4.0 26 6.0 27 6.0 28 7.0 29 10.0 30 7.0 31 18.0 32 24.0 33 36.0 34 45.0 35 94.0 36 232.0 37 3472.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.375 22.125 9.175 25.324999999999996 2 29.522141606204656 28.32124093069802 23.217413059794847 18.939204403302476 3 23.19458375125376 27.30692076228686 28.510531594784354 20.987963891675022 4 26.59974905897114 30.639899623588455 21.75658720200753 21.003764115432872 5 26.82376535472549 33.0910002506894 20.205565304587616 19.879669089997492 6 21.723878727136057 36.78276121272864 20.947131044850913 20.54622901528439 7 24.354798296166376 22.726133801052367 31.420696567276373 21.49837133550489 8 23.583959899749374 24.962406015037594 25.98997493734336 25.46365914786967 9 23.810716074111166 23.410115172759138 27.366049073610416 25.41311967951928 10-14 25.824093121268376 27.003160905122677 23.877376950479153 23.295369023129798 15-19 26.057470109514718 25.93187983522556 24.57550487290264 23.43514518235708 20-24 25.502645502645503 26.737213403880073 24.13202317964223 23.6281179138322 25-29 25.281180960032135 26.631853785900784 24.568186382807795 23.51877887125929 30-34 25.679999999999996 25.869999999999997 25.145 23.305 35-39 25.45 26.619999999999997 24.675 23.255 40-44 25.490000000000002 26.355 24.755 23.400000000000002 45-49 25.77 25.94 24.775 23.515 50-54 25.540000000000003 26.240000000000002 24.740000000000002 23.48 55-59 26.18152658748058 26.592492357039042 23.8460381897459 23.379942865734478 60-64 25.83 25.540000000000003 25.124999999999996 23.505000000000003 65-69 26.38451148131472 25.749162039121515 24.978738306068337 22.88758817349542 70-74 26.57574086145515 26.25984054555483 24.63019605876749 22.534222534222533 75-79 25.83 25.95 25.074999999999996 23.145 80-84 26.06 26.384999999999998 24.62 22.935 85-89 26.355 26.064999999999998 24.255 23.325000000000003 90-94 26.46 25.590000000000003 24.505 23.445 95-99 26.085 26.1 24.755 23.06 100-104 26.303945591838772 26.323948592288843 24.46867030054508 22.9034355153273 105-109 26.20015048908954 25.70855279658891 25.352395284675193 22.73890142964635 110-114 25.8126098970108 26.77719166038684 24.591811102738006 22.818387339864355 115-119 25.97082494969819 26.016096579476862 25.196177062374247 22.816901408450704 120-124 25.82359725216868 26.435340721055006 24.715439001153285 23.025623025623027 125-129 25.455 26.685 24.27 23.59 130-134 26.545 26.040000000000003 24.595 22.82 135-139 25.655 26.345000000000002 25.045 22.955000000000002 140-144 26.165 26.395000000000003 24.465 22.975 145-149 26.06 26.85 24.345 22.745 150-151 25.581395348837212 25.71892973243311 24.90622655663916 23.793448362090523 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 3.0 23 3.5 24 3.5 25 3.0 26 3.5 27 5.5 28 6.5 29 8.0 30 11.0 31 14.5 32 16.0 33 20.0 34 30.5 35 43.5 36 51.0 37 53.5 38 73.5 39 104.0 40 134.5 41 145.0 42 154.0 43 185.0 44 183.0 45 179.0 46 195.0 47 202.0 48 193.5 49 166.0 50 149.5 51 151.5 52 140.5 53 131.0 54 124.5 55 126.0 56 121.0 57 88.0 58 79.0 59 81.5 60 73.5 61 66.5 62 64.5 63 48.0 64 40.0 65 44.5 66 41.0 67 40.0 68 38.0 69 35.0 70 26.0 71 21.5 72 19.5 73 18.5 74 14.0 75 8.5 76 8.5 77 4.5 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.3 4 0.375 5 0.27499999999999997 6 0.22499999999999998 7 0.22499999999999998 8 0.25 9 0.15 10-14 0.345 15-19 0.47000000000000003 20-24 0.775 25-29 0.42 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.23500000000000001 60-64 0.0 65-69 0.055 70-74 0.28500000000000003 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.015 105-109 0.325 110-114 0.475 115-119 0.6 120-124 0.28500000000000003 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.59371004858093 96.39999999999999 2 1.048325236512401 2.0500000000000003 3 0.2045512656609563 0.6 4 0.051137816415239075 0.2 5 0.051137816415239075 0.25 6 0.025568908207619537 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025568908207619537 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCTTGCGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGCAAG 14 0.35000000000000003 No Hit CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT 6 0.15 No Hit GTTGAAGAATGAGCCGGCGACTCATAGGCAGTGGCTTGGTTAAGGGAACG 5 0.125 No Hit GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.225 0.0 0.0 0.0 0.0 118-119 0.2375 0.0 0.0 0.0 0.0 120-121 0.3 0.0 0.0 0.0 0.0 122-123 0.325 0.0 0.0 0.0 0.0 124-125 0.325 0.0 0.0 0.0 0.0 126-127 0.3375 0.0 0.0 0.0 0.0 128-129 0.4125 0.0 0.0 0.0 0.0 130-131 0.4875 0.0 0.0 0.0 0.0 132-133 0.525 0.0 0.0 0.0 0.0 134-135 0.525 0.0 0.0 0.0 0.0 136-137 0.525 0.0 0.0 0.0 0.0 138-139 0.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATAAG 10 0.006830828 145.0 1 ATGCACT 10 0.006830828 145.0 3 >>END_MODULE Read 751546 spots for SRR6031171.sra Written 751546 spots for SRR6031171.sra Read 751546 spots for SRR6031171.sra Written 751546 spots for SRR6031171.sra Read 751546 spots for SRR6031171.sra Written 751546 spots for SRR6031171.sra Read 751546 spots for SRR6031171.sra Written 751546 spots for SRR6031171.sra Read 751546 spots for SRR6031171.sra Written 751546 spots for SRR6031171.sra Read 751546 spots for SRR6031171.sra Written 751546 spots for SRR6031171.sra Read 751546 spots for SRR6031171.sra Written 751546 spots for SRR6031171.sra Read 751546 spots for SRR6031171.sra Written 751546 spots for SRR6031171.sra Read 751546 spots for SRR6031171.sra Written 751546 spots for SRR6031171.sra Read 751546 spots for SRR6031171.sra Written 751546 spots for SRR6031171.sra Read 751546 spots for SRR6031171.sra Written 751546 spots for SRR6031171.sra Read 751546 spots for SRR6031171.sra Written 751546 spots for SRR6031171.sra Read 751546 spots for SRR6031171.sra Written 751546 spots for SRR6031171.sra Read 751546 spots for SRR6031171.sra Written 751546 spots for SRR6031171.sra Read 751546 spots for SRR6031171.sra Written 751546 spots for SRR6031171.sra Read 751565 spots for SRR6031171.sra Written 751565 spots for SRR6031171.sra Read 751546 spots for SRR6031171.sra Written 751546 spots for SRR6031171.sra Read 751546 spots for SRR6031171.sra Written 751546 spots for SRR6031171.sra Read 751546 spots for SRR6031171.sra Written 751546 spots for SRR6031171.sra Read 751546 spots for SRR6031171.sra Written 751546 spots for SRR6031171.sra SRR ids: ['SRR6031171.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oqfwr9o6 SRR6031171.sra spots: 15030939 blocks: [[1, 751546], [751547, 1503092], [1503093, 2254638], [2254639, 3006184], [3006185, 3757730], [3757731, 4509276], [4509277, 5260822], [5260823, 6012368], [6012369, 6763914], [6763915, 7515460], [7515461, 8267006], [8267007, 9018552], [9018553, 9770098], [9770099, 10521644], [10521645, 11273190], [11273191, 12024736], [12024737, 12776282], [12776283, 13527828], [13527829, 14279374], [14279375, 15030939]] SRR6031171 file size 5071791 SRR6031171 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031171 SRR6031171_1.fastq SRR6031171_2.fastq Input file: SRR6031171_1.fastq Paired file: SRR6031171_2.fastq trimmed: SRR6031171-trimmed-pair1.fastq, SRR6031171-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:36:38 2024 >> started Tue Dec 10 00:36:56 2024 >> done (17.630s) 15030939 read pairs processed; of these: 8613 ( 0.06%) short read pairs filtered out after trimming by size control 7842 ( 0.05%) empty read pairs filtered out after trimming by size control 15014484 (99.89%) read pairs available; of these: 3550275 (23.65%) trimmed read pairs available after processing 11464209 (76.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 8 0.00% 20 3 0.00% 21 5 0.00% 22 12 0.00% 23 5 0.00% 24 6 0.00% 25 8 0.00% 26 8 0.00% 27 10 0.00% 28 10 0.00% 29 11 0.00% 30 7 0.00% 31 10 0.00% 32 6 0.00% 33 5 0.00% 34 9 0.00% 35 6 0.00% 36 8 0.00% 37 6 0.00% 38 8 0.00% 39 8 0.00% 40 10 0.00% 41 8 0.00% 42 19 0.00% 43 16 0.00% 44 14 0.00% 45 15 0.00% 46 14 0.00% 47 12 0.00% 48 20 0.00% 49 24 0.00% 50 20 0.00% 51 21 0.00% 52 24 0.00% 53 27 0.00% 54 41 0.00% 55 35 0.00% 56 36 0.00% 57 45 0.00% 58 45 0.00% 59 61 0.00% 60 66 0.00% 61 68 0.00% 62 74 0.00% 63 84 0.00% 64 101 0.00% 65 86 0.00% 66 134 0.00% 67 99 0.00% 68 166 0.00% 69 192 0.00% 70 212 0.00% 71 233 0.00% 72 314 0.00% 73 340 0.00% 74 317 0.00% 75 307 0.00% 76 419 0.00% 77 474 0.00% 78 487 0.00% 79 459 0.00% 80 453 0.00% 81 521 0.00% 82 603 0.00% 83 641 0.00% 84 1022 0.01% 85 1280 0.01% 86 1399 0.01% 87 1406 0.01% 88 1477 0.01% 89 1535 0.01% 90 1507 0.01% 91 1534 0.01% 92 1666 0.01% 93 1787 0.01% 94 1792 0.01% 95 1850 0.01% 96 1901 0.01% 97 1972 0.01% 98 2130 0.01% 99 2210 0.01% 100 2225 0.01% 101 2479 0.02% 102 2484 0.02% 103 2601 0.02% 104 2754 0.02% 105 2763 0.02% 106 2951 0.02% 107 2979 0.02% 108 3057 0.02% 109 3251 0.02% 110 3379 0.02% 111 3537 0.02% 112 3672 0.02% 113 3709 0.02% 114 4040 0.03% 115 4347 0.03% 116 4500 0.03% 117 4676 0.03% 118 5042 0.03% 119 5061 0.03% 120 5474 0.04% 121 5647 0.04% 122 5612 0.04% 123 6090 0.04% 124 6507 0.04% 125 6729 0.04% 126 7214 0.05% 127 7537 0.05% 128 7835 0.05% 129 8279 0.06% 130 8920 0.06% 131 9384 0.06% 132 9942 0.07% 133 10823 0.07% 134 11286 0.08% 135 12263 0.08% 136 13234 0.09% 137 14519 0.10% 138 15984 0.11% 139 16908 0.11% 140 18866 0.13% 141 20983 0.14% 142 23604 0.16% 143 26974 0.18% 144 32311 0.22% 145 41073 0.27% 146 53933 0.36% 147 75761 0.50% 148 127820 0.85% 149 309885 2.06% 150 2525379 16.82% 151 11464209 76.35% 15014484 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=32 prefix-density=0.48 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=125.10 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=13.3 sequence=TTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATATGATCTCCCCCAG criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=32 prefix-density=0.68 prefix-fanout=2.2 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=139.61 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.1 sequence=TCATGGAGAGTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAAGTCGAACGGGAAGTGGTGTTTCCAGTGGCGAACGGGTGAGTAACGCGTAAGAACCTGCCCTTGGGAGGGGAACAACAACTGGAAACGGTTGCTAATACCCCGTAGGCTGAGGAGCAAAAGGAGAAATCCGCCCAAGGAGGGGCTCGCGTCTGATTAGCTAGTTGGTGAGGCAATAGCTTACCAAGGCGATGATCAGTAGCTGGTCCGAGAGGATGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATTTTCCGCAATGGGCGAAAGCCTGACGGAGCAATGCCGCGTGGAGGTGGAAGGCCTACGGGTCGTCAACTTCTTTTCTCGGAGAAGAAACAATGACGGTATCTGAGGAATAAGCATCGGCTAACTCTGTGCCAGCAGC SRR6031171 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:37:46 Started mapping on | Dec 10 00:37:47 Finished on | Dec 10 00:38:53 Mapping speed, Million of reads per hour | 818.97 Number of input reads | 15014484 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 13309786 Uniquely mapped reads % | 88.65% Average mapped length | 299.84 Number of splices: Total | 13740760 Number of splices: Annotated (sjdb) | 13034767 Number of splices: GT/AG | 13563664 Number of splices: GC/AG | 157120 Number of splices: AT/AC | 8063 Number of splices: Non-canonical | 11913 Mismatch rate per base, % | 0.08% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 706625 % of reads mapped to multiple loci | 4.71% Number of reads mapped to too many loci | 86828 % of reads mapped to too many loci | 0.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.41% % of reads unmapped: other | 3.65% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1004502 1004502 1004502 N_multimapping 706625 706625 706625 N_noFeature 1171378 12924906 1277005 N_ambiguous 384915 3914 113959 UnstrandedReadsAssigned:11753493 PositiveStrandReadsAssigned:380966 NegativeStrandReadsAssigned:11918822 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6031171 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6031171-trimmed-pair1.fastq SRR6031171-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,014,484 reads, 12,421,365 reads pseudoaligned [quant] estimated average fragment length: 432.432 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52973 SRR6031171.ke.tsv 35125 SRR6031171.se.tsv 88098 total ==> SRR6031171.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 506.021 0 0 PNS24247 1044 612.568 61.2038 10.8355 PNS24249 1928 1496.57 27.2567 1.97516 PNS24246 1044 612.568 61.2038 10.8355 PNS24248 1044 612.568 61.2038 10.8355 PNS24244 1471 1039.57 39.1319 4.08229 PNS24243 293 63.9915 0 0 KQK14069 1603 1171.57 9120.49 844.26 KQK14071 474 129.755 43.4961 36.354 ==> SRR6031171.se.tsv <== BRADI_1g14170v3 9982 BRADI_1g53295v3 29 BRADI_1g59795v3 343 BRADI_1g07683v3 0 BRADI_1g00485v3 14 BRADI_1g20270v3 526 BRADI_1g74790v3 112 BRADI_1g09890v3 1 BRADI_1g77505v3 217 BRADI_1g48960v3 0 SRR6031171 completed mapping pipeline successfully