Starting /dee2/code/volunteer_pipeline.sh SRR6031172 current disk space = 1523687645184 free memory = 1569642024 SRR6031172 SRAfilesize ed9718290a4f00cf65d656f89e51e934 SRR6031172.sra SRR6031172.sra file validated SRR6031172 is paired end SRR6031172 is conventional basespace SRR6031172 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031172_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.52925 32.0 32.0 33.0 30.0 33.0 2 32.885 33.0 33.0 33.0 33.0 34.0 3 33.05075 33.0 33.0 34.0 33.0 34.0 4 33.4595 34.0 33.0 34.0 33.0 34.0 5 33.65075 34.0 34.0 34.0 33.0 34.0 6 37.651 38.0 38.0 38.0 37.0 38.0 7 37.77575 38.0 38.0 38.0 38.0 38.0 8 37.781 38.0 38.0 38.0 38.0 38.0 9 37.85425 38.0 38.0 38.0 38.0 38.0 10-14 37.8531 38.0 38.0 38.0 38.0 38.0 15-19 37.8503 38.0 38.0 38.0 38.0 38.0 20-24 37.837599999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.8088 38.0 38.0 38.0 38.0 38.0 30-34 37.820550000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.81564999999999 38.0 38.0 38.0 38.0 38.0 40-44 37.775099999999995 38.0 38.0 38.0 38.0 38.0 45-49 37.74435 38.0 38.0 38.0 38.0 38.0 50-54 37.72185 38.0 38.0 38.0 38.0 38.0 55-59 37.6933 38.0 38.0 38.0 38.0 38.0 60-64 37.66735 38.0 38.0 38.0 38.0 38.0 65-69 37.63115 38.0 38.0 38.0 38.0 38.0 70-74 37.64125 38.0 38.0 38.0 38.0 38.0 75-79 37.59865 38.0 38.0 38.0 38.0 38.0 80-84 37.584799999999994 38.0 38.0 38.0 38.0 38.0 85-89 37.54685 38.0 38.0 38.0 38.0 38.0 90-94 37.526149999999994 38.0 38.0 38.0 38.0 38.0 95-99 37.505849999999995 38.0 38.0 38.0 37.8 38.0 100-104 37.447449999999996 38.0 38.0 38.0 37.0 38.0 105-109 37.3664 38.0 38.0 38.0 37.2 38.0 110-114 37.33615 38.0 38.0 38.0 37.0 38.0 115-119 37.31245 38.0 38.0 38.0 36.8 38.0 120-124 37.223699999999994 38.0 38.0 38.0 36.0 38.0 125-129 37.090700000000005 38.0 38.0 38.0 36.0 38.0 130-134 36.999849999999995 38.0 38.0 38.0 35.4 38.0 135-139 36.916999999999994 38.0 38.0 38.0 35.2 38.0 140-144 36.74989999999999 38.0 38.0 38.0 35.0 38.0 145-149 36.496900000000004 38.0 38.0 38.0 34.8 38.0 150-151 34.515 38.0 35.5 38.0 28.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 2.0 15 0.0 16 0.0 17 0.0 18 3.0 19 0.0 20 2.0 21 0.0 22 1.0 23 0.0 24 1.0 25 0.0 26 6.0 27 4.0 28 6.0 29 7.0 30 14.0 31 16.0 32 20.0 33 28.0 34 46.0 35 78.0 36 274.0 37 3490.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.54019534184824 12.046080641121963 7.488104182319058 28.92561983471074 2 22.575 13.5 33.15 30.775000000000002 3 19.7 20.275000000000002 26.700000000000003 33.324999999999996 4 23.549999999999997 25.324999999999996 22.775000000000002 28.349999999999998 5 25.074999999999996 28.175 24.099999999999998 22.650000000000002 6 23.3983983983984 32.207207207207205 23.573573573573572 20.82082082082082 7 16.6 25.825 38.7 18.875 8 20.5 23.875 29.475 26.150000000000002 9 20.349999999999998 22.85 30.8 26.0 10-14 21.224999999999998 27.965 26.405 24.404999999999998 15-19 21.365000000000002 27.01 26.619999999999997 25.005 20-24 21.54 26.939999999999998 26.735 24.785 25-29 21.375 26.38 26.945000000000004 25.3 30-34 21.205 26.945000000000004 26.724999999999998 25.124999999999996 35-39 21.375 26.395000000000003 26.795 25.435000000000002 40-44 21.57 26.445 27.245 24.740000000000002 45-49 21.75 26.625 26.150000000000002 25.474999999999998 50-54 21.065 27.13 26.46 25.345000000000002 55-59 22.305 26.405 26.405 24.884999999999998 60-64 21.93 26.43 27.034999999999997 24.605 65-69 21.385 26.46 26.575 25.580000000000002 70-74 21.89 26.729999999999997 26.905 24.474999999999998 75-79 21.94 26.19 26.340000000000003 25.53 80-84 21.625 26.36 26.445 25.569999999999997 85-89 22.045 26.205000000000002 26.424999999999997 25.324999999999996 90-94 21.834999999999997 26.779999999999998 26.240000000000002 25.145 95-99 21.795 26.179999999999996 26.68 25.345000000000002 100-104 22.400000000000002 26.13 26.729999999999997 24.740000000000002 105-109 21.89 26.625 26.195 25.290000000000003 110-114 21.895 26.590000000000003 26.375 25.14 115-119 22.745 25.924999999999997 26.375 24.955 120-124 21.95 26.495 26.445 25.11 125-129 22.035 26.445 26.405 25.115 130-134 21.91 26.13 26.56 25.4 135-139 21.884999999999998 26.445 26.284999999999997 25.385 140-144 22.31 26.105 26.56 25.025 145-149 22.89 26.06 25.955000000000002 25.095 150-151 22.39029878734842 26.653331666458307 26.728341042630326 24.228028503562946 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 2.5 27 4.0 28 4.0 29 7.0 30 7.5 31 12.0 32 18.5 33 21.0 34 27.5 35 44.0 36 56.0 37 71.0 38 97.0 39 120.0 40 146.5 41 176.0 42 184.0 43 204.0 44 231.0 45 234.0 46 247.0 47 229.5 48 222.5 49 220.5 50 191.0 51 168.0 52 146.5 53 125.5 54 98.5 55 90.0 56 83.0 57 72.5 58 70.5 59 61.5 60 48.5 61 44.0 62 33.0 63 25.0 64 27.0 65 23.5 66 21.5 67 20.5 68 17.5 69 10.0 70 7.5 71 7.5 72 6.0 73 5.5 74 2.0 75 1.5 76 1.5 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.3769791404875597 0.75 3 0.07539582809751194 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.175 0.0 0.0 0.0 0.0 118-119 0.175 0.0 0.0 0.0 0.0 120-121 0.175 0.0 0.0 0.0 0.0 122-123 0.1875 0.0 0.0 0.0 0.0 124-125 0.2 0.0 0.0 0.0 0.0 126-127 0.225 0.0 0.0 0.0 0.0 128-129 0.2375 0.0 0.0 0.0 0.0 130-131 0.2875 0.0 0.0 0.0 0.0 132-133 0.3125 0.0 0.0 0.0 0.0 134-135 0.375 0.0 0.0 0.0 0.0 136-137 0.3875 0.0 0.0 0.0 0.0 138-139 0.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTCCA 10 0.006830828 145.0 4 CTTTATC 10 0.006830828 145.0 5 CTCATCG 10 0.006830828 145.0 3 >>END_MODULE SRR6031172 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031172_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.23875 34.0 33.0 34.0 33.0 34.0 2 33.4015 34.0 33.0 34.0 33.0 34.0 3 33.456 34.0 33.0 34.0 33.0 34.0 4 33.4045 34.0 33.0 34.0 33.0 34.0 5 33.44175 34.0 33.0 34.0 33.0 34.0 6 37.62025 38.0 38.0 38.0 38.0 38.0 7 37.129 38.0 38.0 38.0 37.0 38.0 8 37.50475 38.0 38.0 38.0 38.0 38.0 9 37.52975 38.0 38.0 38.0 38.0 38.0 10-14 37.5671 38.0 38.0 38.0 38.0 38.0 15-19 37.5202 38.0 38.0 38.0 38.0 38.0 20-24 37.44 38.0 38.0 38.0 38.0 38.0 25-29 37.50295 38.0 38.0 38.0 38.0 38.0 30-34 37.604049999999994 38.0 38.0 38.0 38.0 38.0 35-39 37.59695 38.0 38.0 38.0 38.0 38.0 40-44 37.5928 38.0 38.0 38.0 38.0 38.0 45-49 37.59010000000001 38.0 38.0 38.0 38.0 38.0 50-54 37.58115 38.0 38.0 38.0 38.0 38.0 55-59 37.55215 38.0 38.0 38.0 38.0 38.0 60-64 37.535999999999994 38.0 38.0 38.0 38.0 38.0 65-69 37.50985 38.0 38.0 38.0 38.0 38.0 70-74 37.39185 38.0 38.0 38.0 38.0 38.0 75-79 37.5021 38.0 38.0 38.0 38.0 38.0 80-84 37.4742 38.0 38.0 38.0 38.0 38.0 85-89 37.439550000000004 38.0 38.0 38.0 38.0 38.0 90-94 37.4199 38.0 38.0 38.0 38.0 38.0 95-99 37.3725 38.0 38.0 38.0 38.0 38.0 100-104 37.3107 38.0 38.0 38.0 37.6 38.0 105-109 37.20185 38.0 38.0 38.0 37.8 38.0 110-114 37.09685 38.0 38.0 38.0 37.2 38.0 115-119 37.08735 38.0 38.0 38.0 37.0 38.0 120-124 37.03574999999999 38.0 38.0 38.0 36.4 38.0 125-129 37.00105 38.0 38.0 38.0 36.0 38.0 130-134 36.96724999999999 38.0 38.0 38.0 36.0 38.0 135-139 36.90195 38.0 38.0 38.0 36.0 38.0 140-144 36.7899 38.0 38.0 38.0 35.4 38.0 145-149 36.67785 38.0 38.0 38.0 35.0 38.0 150-151 34.62375 38.0 35.5 38.0 28.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 0.0 5 0.0 6 1.0 7 0.0 8 2.0 9 1.0 10 1.0 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 2.0 17 0.0 18 1.0 19 2.0 20 3.0 21 4.0 22 2.0 23 4.0 24 2.0 25 7.0 26 10.0 27 9.0 28 8.0 29 12.0 30 13.0 31 18.0 32 19.0 33 28.0 34 37.0 35 80.0 36 212.0 37 3513.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.9 20.8 9.25 23.05 2 27.650000000000002 27.325 25.025 20.0 3 21.630407601900476 27.00675168792198 30.282570642660666 21.080270067516878 4 26.5081351689612 31.23904881101377 20.075093867334168 22.177722152690862 5 26.1195896922692 34.42581936452339 20.740555416562422 18.714035526644984 6 23.005751437859466 36.53413353338335 21.43035758939735 19.02975743935984 7 22.400000000000002 20.599999999999998 35.025 21.975 8 23.29246935201401 24.49337002752064 24.39329497122842 27.820865649236925 9 23.317488116087066 24.618463847885916 26.64498373780335 25.41906429822367 10-14 25.44535628502802 27.27181745396317 23.984187349879903 23.2986389111289 15-19 25.24665698402364 25.852656883858366 25.477037111233535 23.42364902088446 20-24 25.38361247618092 26.787684284424834 24.69160565640357 23.137097582990673 25-29 25.55044035228183 26.291032826261006 24.814851881505202 23.34367493995196 30-34 25.0 26.405 25.56 23.035 35-39 24.905 26.27 25.729999999999997 23.095 40-44 25.82 25.935000000000002 24.995 23.25 45-49 25.47 26.375 25.259999999999998 22.895 50-54 25.330000000000002 26.465 25.285000000000004 22.919999999999998 55-59 25.80387058058709 26.829024353653047 25.09376406460969 22.273341001150175 60-64 24.875 26.515 25.56 23.05 65-69 25.240000000000002 25.715 25.695 23.35 70-74 25.766225961538463 26.47235576923077 25.405649038461537 22.355769230769234 75-79 25.509999999999998 25.635 25.39 23.465 80-84 25.025 26.66 25.2 23.115 85-89 25.655 26.040000000000003 24.925 23.380000000000003 90-94 25.045 26.224999999999998 25.564999999999998 23.165 95-99 25.8 26.105 25.505 22.59 100-104 25.230000000000004 26.655 25.069999999999997 23.044999999999998 105-109 25.769269319434702 25.869499849654204 25.593865891550564 22.76736493936053 110-114 25.926483125219395 26.307607441953763 25.00376109523093 22.762148337595907 115-119 25.66686722823907 26.00782190132371 25.74709185720016 22.578219013237064 120-124 25.25899604624393 26.19988989540063 25.87958560632601 22.66152845202943 125-129 25.0 26.965 25.55 22.485 130-134 25.845000000000002 25.81 25.580000000000002 22.765 135-139 25.695 26.255 25.71 22.34 140-144 25.605 26.55 25.515 22.33 145-149 25.669999999999998 26.39 25.535000000000004 22.405 150-151 25.224999999999998 27.3625 25.4 22.0125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.5 26 2.0 27 3.0 28 3.5 29 4.5 30 5.5 31 9.5 32 13.0 33 15.0 34 23.5 35 34.0 36 50.0 37 67.5 38 84.0 39 115.0 40 134.0 41 151.0 42 185.0 43 203.5 44 231.0 45 240.5 46 221.0 47 216.0 48 197.5 49 175.5 50 166.5 51 142.5 52 131.5 53 138.0 54 123.0 55 101.5 56 82.0 57 67.0 58 67.0 59 61.5 60 54.5 61 55.0 62 45.5 63 44.5 64 47.5 65 41.0 66 42.0 67 40.5 68 36.5 69 34.5 70 25.0 71 18.5 72 15.5 73 10.5 74 5.0 75 2.5 76 4.5 77 3.0 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.125 5 0.075 6 0.025 7 0.0 8 0.075 9 0.075 10-14 0.08 15-19 0.165 20-24 0.29 25-29 0.08 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.015 60-64 0.0 65-69 0.0 70-74 0.16 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.22999999999999998 110-114 0.295 115-119 0.27999999999999997 120-124 0.095 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49660206393153 98.825 2 0.4027183488547697 0.8 3 0.07550969041026932 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.025169896803423106 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCGGGACTACCCGCTGAGTTTAAGCATATAAATAAGCGGAGGAGAAGAA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.2 0.0 0.0 0.0 0.0 120-121 0.2 0.0 0.0 0.0 0.0 122-123 0.21250000000000002 0.0 0.0 0.0 0.0 124-125 0.225 0.0 0.0 0.0 0.0 126-127 0.25 0.0 0.0 0.0 0.0 128-129 0.2625 0.0 0.0 0.0 0.0 130-131 0.3125 0.0 0.0 0.0 0.0 132-133 0.3375 0.0 0.0 0.0 0.0 134-135 0.4 0.0 0.0 0.0 0.0 136-137 0.4125 0.0 0.0 0.0 0.0 138-139 0.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 297583 spots for SRR6031172.sra Written 297583 spots for SRR6031172.sra Read 297583 spots for SRR6031172.sra Written 297583 spots for SRR6031172.sra Read 297583 spots for SRR6031172.sra Written 297583 spots for SRR6031172.sra Read 297583 spots for SRR6031172.sra Written 297583 spots for SRR6031172.sra Read 297583 spots for SRR6031172.sra Written 297583 spots for SRR6031172.sra Read 297583 spots for SRR6031172.sra Written 297583 spots for SRR6031172.sra Read 297585 spots for SRR6031172.sra Written 297585 spots for SRR6031172.sra Read 297583 spots for SRR6031172.sra Written 297583 spots for SRR6031172.sra Read 297583 spots for SRR6031172.sra Written 297583 spots for SRR6031172.sra Read 297583 spots for SRR6031172.sra Written 297583 spots for SRR6031172.sra Read 297583 spots for SRR6031172.sra Written 297583 spots for SRR6031172.sra Read 297583 spots for SRR6031172.sra Written 297583 spots for SRR6031172.sra Read 297583 spots for SRR6031172.sra Written 297583 spots for SRR6031172.sra Read 297583 spots for SRR6031172.sra Written 297583 spots for SRR6031172.sra Read 297583 spots for SRR6031172.sra Written 297583 spots for SRR6031172.sra Read 297583 spots for SRR6031172.sra Written 297583 spots for SRR6031172.sra Read 297583 spots for SRR6031172.sra Written 297583 spots for SRR6031172.sra Read 297583 spots for SRR6031172.sra Written 297583 spots for SRR6031172.sra Read 297583 spots for SRR6031172.sra Written 297583 spots for SRR6031172.sra Read 297583 spots for SRR6031172.sra Written 297583 spots for SRR6031172.sra SRR ids: ['SRR6031172.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3m23lkt1 SRR6031172.sra spots: 5951662 blocks: [[1, 297583], [297584, 595166], [595167, 892749], [892750, 1190332], [1190333, 1487915], [1487916, 1785498], [1785499, 2083081], [2083082, 2380664], [2380665, 2678247], [2678248, 2975830], [2975831, 3273413], [3273414, 3570996], [3570997, 3868579], [3868580, 4166162], [4166163, 4463745], [4463746, 4761328], [4761329, 5058911], [5058912, 5356494], [5356495, 5654077], [5654078, 5951662]] SRR6031172 file size 2003029 SRR6031172 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031172 SRR6031172_1.fastq SRR6031172_2.fastq Input file: SRR6031172_1.fastq Paired file: SRR6031172_2.fastq trimmed: SRR6031172-trimmed-pair1.fastq, SRR6031172-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:36:18 2024 >> started Tue Dec 10 00:36:24 2024 >> done (6.232s) 5951662 read pairs processed; of these: 4781 ( 0.08%) short read pairs filtered out after trimming by size control 3912 ( 0.07%) empty read pairs filtered out after trimming by size control 5942969 (99.85%) read pairs available; of these: 1199010 (20.18%) trimmed read pairs available after processing 4743959 (79.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 4 0.00% 21 4 0.00% 22 5 0.00% 23 5 0.00% 24 2 0.00% 25 2 0.00% 26 6 0.00% 27 3 0.00% 28 7 0.00% 29 3 0.00% 30 0 0.00% 31 6 0.00% 32 4 0.00% 33 5 0.00% 34 4 0.00% 35 7 0.00% 36 2 0.00% 37 5 0.00% 38 5 0.00% 39 7 0.00% 40 2 0.00% 41 4 0.00% 42 8 0.00% 43 7 0.00% 44 3 0.00% 45 2 0.00% 46 6 0.00% 47 9 0.00% 48 6 0.00% 49 6 0.00% 50 11 0.00% 51 6 0.00% 52 10 0.00% 53 14 0.00% 54 11 0.00% 55 7 0.00% 56 14 0.00% 57 19 0.00% 58 8 0.00% 59 14 0.00% 60 18 0.00% 61 21 0.00% 62 22 0.00% 63 23 0.00% 64 33 0.00% 65 31 0.00% 66 32 0.00% 67 34 0.00% 68 41 0.00% 69 48 0.00% 70 64 0.00% 71 62 0.00% 72 63 0.00% 73 92 0.00% 74 103 0.00% 75 96 0.00% 76 100 0.00% 77 114 0.00% 78 111 0.00% 79 127 0.00% 80 143 0.00% 81 150 0.00% 82 183 0.00% 83 231 0.00% 84 422 0.01% 85 590 0.01% 86 567 0.01% 87 634 0.01% 88 633 0.01% 89 607 0.01% 90 548 0.01% 91 580 0.01% 92 637 0.01% 93 660 0.01% 94 664 0.01% 95 653 0.01% 96 692 0.01% 97 695 0.01% 98 741 0.01% 99 763 0.01% 100 769 0.01% 101 810 0.01% 102 870 0.01% 103 874 0.01% 104 974 0.02% 105 1011 0.02% 106 1064 0.02% 107 1013 0.02% 108 1023 0.02% 109 1169 0.02% 110 1166 0.02% 111 1296 0.02% 112 1361 0.02% 113 1298 0.02% 114 1390 0.02% 115 1475 0.02% 116 1581 0.03% 117 1577 0.03% 118 1706 0.03% 119 1719 0.03% 120 1909 0.03% 121 1840 0.03% 122 2107 0.04% 123 2034 0.03% 124 2275 0.04% 125 2365 0.04% 126 2367 0.04% 127 2505 0.04% 128 2568 0.04% 129 2736 0.05% 130 2894 0.05% 131 3069 0.05% 132 3361 0.06% 133 3496 0.06% 134 3711 0.06% 135 3947 0.07% 136 4347 0.07% 137 4543 0.08% 138 5067 0.09% 139 5393 0.09% 140 5926 0.10% 141 6632 0.11% 142 7451 0.13% 143 8682 0.15% 144 10451 0.18% 145 13116 0.22% 146 17172 0.29% 147 24486 0.41% 148 41429 0.70% 149 94198 1.59% 150 870502 14.65% 151 4743959 79.82% 5942969 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=32 prefix-density=0.41 prefix-fanout=2.4 sequence=CCCAGCTCACGTTCCCTATTGGTGGGTGAACAATCCAACACTTGGTGAATTCTGCTTCACAATGATAGGAAGAGCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTAGCTTCAAACTCCGAAGATCTAAAGGATCGATAGGCCACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTTTTACCCTTTTGTTCCACACGAGATTTCTGTTCTCGTTGAGCTCATCTTAGGACACCTGCGTTATCTTTTAACAGATGTGCCGCCCCAGCCAAACTCCCCACCTGACAATGTCTTCCGCCCGGATCGGCCCGGTCAGACCGGGCCTTGGAGCCAAAAGGAGGGGACTTGCCCCGCTTCCGACCCACGGAATAAGTAAAATAACGTTAAAAGTAGTGGTATTTCACTTGCGCCCGTAAAGGCTCCCACTTATCCTACACCTCTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=12 fanout-score=106.03 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=22.1 sequence=ATCTTCTTCTTGTCGTCCGC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=21.67 fanout-score-rank=8 prefix-density=0.60 prefix-fanout=10.0 sequence=AGGAAGAAGAAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=631.51 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=20.4 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR6031172 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:37:42 Started mapping on | Dec 10 00:37:43 Finished on | Dec 10 00:38:22 Mapping speed, Million of reads per hour | 548.58 Number of input reads | 5942969 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 5269665 Uniquely mapped reads % | 88.67% Average mapped length | 300.01 Number of splices: Total | 6008096 Number of splices: Annotated (sjdb) | 5709205 Number of splices: GT/AG | 5930570 Number of splices: GC/AG | 69804 Number of splices: AT/AC | 4098 Number of splices: Non-canonical | 3624 Mismatch rate per base, % | 0.06% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 55633 % of reads mapped to multiple loci | 0.94% Number of reads mapped to too many loci | 34228 % of reads mapped to too many loci | 0.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.13% % of reads unmapped: other | 4.69% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 621573 621573 621573 N_multimapping 55633 55633 55633 N_noFeature 174976 5114032 217738 N_ambiguous 132560 1151 19839 UnstrandedReadsAssigned:4962129 PositiveStrandReadsAssigned:154482 NegativeStrandReadsAssigned:5032088 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6031172 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6031172-trimmed-pair1.fastq SRR6031172-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,942,969 reads, 5,088,612 reads pseudoaligned [quant] estimated average fragment length: 454.578 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52973 SRR6031172.ke.tsv 35125 SRR6031172.se.tsv 88098 total ==> SRR6031172.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 484.26 0 0 PNS24247 1044 590.422 33.1227 15.4649 PNS24249 1928 1474.42 11.5566 2.1607 PNS24246 1044 590.422 33.1227 15.4649 PNS24248 1044 590.422 33.1227 15.4649 PNS24244 1471 1017.42 27.0754 7.336 PNS24243 293 63.8756 0 0 KQK14069 1603 1149.42 817.746 196.121 KQK14071 474 129.855 2.31331 4.91089 ==> SRR6031172.se.tsv <== BRADI_1g14170v3 869 BRADI_1g53295v3 25 BRADI_1g59795v3 149 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 176 BRADI_1g74790v3 99 BRADI_1g09890v3 0 BRADI_1g77505v3 43 BRADI_1g48960v3 0 SRR6031172 completed mapping pipeline successfully