Starting /dee2/code/volunteer_pipeline.sh SRR6031173 current disk space = 1523687645184 free memory = 1569644076 SRR6031173 SRAfilesize 1c3f8634be730e4887fba111f1feb5a4 SRR6031173.sra SRR6031173.sra file validated SRR6031173 is paired end SRR6031173 is conventional basespace SRR6031173 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031173_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.939 33.0 32.0 33.0 30.0 33.0 2 33.05275 33.0 33.0 34.0 33.0 34.0 3 33.22925 33.0 33.0 34.0 33.0 34.0 4 33.5775 34.0 33.0 34.0 33.0 34.0 5 33.72875 34.0 34.0 34.0 33.0 34.0 6 37.613 38.0 38.0 38.0 37.0 38.0 7 37.76275 38.0 38.0 38.0 38.0 38.0 8 37.81875 38.0 38.0 38.0 38.0 38.0 9 37.84175 38.0 38.0 38.0 38.0 38.0 10-14 37.8514 38.0 38.0 38.0 38.0 38.0 15-19 37.858850000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.8628 38.0 38.0 38.0 38.0 38.0 25-29 37.8252 38.0 38.0 38.0 38.0 38.0 30-34 37.83630000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.827349999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.81945 38.0 38.0 38.0 38.0 38.0 45-49 37.7848 38.0 38.0 38.0 38.0 38.0 50-54 37.75965 38.0 38.0 38.0 38.0 38.0 55-59 37.704499999999996 38.0 38.0 38.0 38.0 38.0 60-64 37.680049999999994 38.0 38.0 38.0 38.0 38.0 65-69 37.6917 38.0 38.0 38.0 38.0 38.0 70-74 37.6864 38.0 38.0 38.0 38.0 38.0 75-79 37.6528 38.0 38.0 38.0 38.0 38.0 80-84 37.63955 38.0 38.0 38.0 38.0 38.0 85-89 37.61295 38.0 38.0 38.0 38.0 38.0 90-94 37.6104 38.0 38.0 38.0 38.0 38.0 95-99 37.50245 38.0 38.0 38.0 37.8 38.0 100-104 37.4774 38.0 38.0 38.0 37.6 38.0 105-109 37.4138 38.0 38.0 38.0 37.2 38.0 110-114 37.39640000000001 38.0 38.0 38.0 37.0 38.0 115-119 37.3431 38.0 38.0 38.0 36.8 38.0 120-124 37.22205 38.0 38.0 38.0 36.0 38.0 125-129 37.18845 38.0 38.0 38.0 36.0 38.0 130-134 37.0083 38.0 38.0 38.0 35.6 38.0 135-139 37.033699999999996 38.0 38.0 38.0 35.8 38.0 140-144 36.82684999999999 38.0 38.0 38.0 35.2 38.0 145-149 36.5197 38.0 38.0 38.0 34.8 38.0 150-151 34.62625 38.0 36.0 38.0 29.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 1.0 21 3.0 22 1.0 23 1.0 24 1.0 25 2.0 26 3.0 27 4.0 28 4.0 29 5.0 30 12.0 31 13.0 32 16.0 33 36.0 34 51.0 35 79.0 36 240.0 37 3527.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.4259954921112 13.022789882294013 10.418231905835212 33.13298271975958 2 23.875 14.499999999999998 33.525 28.1 3 19.775000000000002 19.175 26.450000000000003 34.599999999999994 4 23.0 25.025 22.625 29.349999999999998 5 24.474999999999998 27.375 25.35 22.8 6 22.768304914744235 32.52256770310933 24.5987963891675 20.110330992978938 7 18.099999999999998 26.05 38.05 17.8 8 21.3 26.375 26.650000000000002 25.674999999999997 9 18.525 23.325000000000003 32.824999999999996 25.324999999999996 10-14 21.404999999999998 27.71 26.58 24.305 15-19 21.365000000000002 26.905 26.900000000000002 24.83 20-24 21.995 26.855 26.69 24.46 25-29 21.185000000000002 27.375 27.150000000000002 24.29 30-34 21.615000000000002 26.82 26.950000000000003 24.615000000000002 35-39 21.545 26.895000000000003 27.16 24.4 40-44 21.355 27.150000000000002 27.16 24.335 45-49 21.685 27.389999999999997 26.345000000000002 24.58 50-54 21.905 26.479999999999997 27.21 24.404999999999998 55-59 21.725 26.810000000000002 26.43 25.035 60-64 21.91 27.04 26.155 24.895 65-69 21.37 26.474999999999998 27.115000000000002 25.040000000000003 70-74 21.51 27.11 26.640000000000004 24.740000000000002 75-79 22.045 26.119999999999997 26.71 25.124999999999996 80-84 22.065 26.619999999999997 27.084999999999997 24.23 85-89 21.945 26.700000000000003 26.900000000000002 24.455 90-94 21.81 26.75 26.534999999999997 24.905 95-99 22.35 26.25 25.8 25.6 100-104 22.33 26.46 26.700000000000003 24.51 105-109 22.6 26.41 26.325 24.665 110-114 22.06 26.8 26.465 24.675 115-119 22.415 26.38 26.540000000000003 24.665 120-124 21.675 26.575 26.52 25.230000000000004 125-129 22.085 26.025 26.700000000000003 25.19 130-134 22.43 26.44 26.3 24.83 135-139 21.745 26.55 26.779999999999998 24.925 140-144 21.985 25.82 27.169999999999998 25.025 145-149 22.435 26.245 26.955000000000002 24.365000000000002 150-151 21.762500000000003 26.424999999999997 26.2875 25.525 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.5 26 1.5 27 2.0 28 1.5 29 3.0 30 8.0 31 16.5 32 24.0 33 26.5 34 31.0 35 36.0 36 50.0 37 82.5 38 103.0 39 129.5 40 165.5 41 182.5 42 190.0 43 220.0 44 245.0 45 241.0 46 239.0 47 233.0 48 224.0 49 195.5 50 174.0 51 175.0 52 153.5 53 131.0 54 113.0 55 89.0 56 71.5 57 60.0 58 62.0 59 56.5 60 41.0 61 31.5 62 26.5 63 23.5 64 23.5 65 23.0 66 17.0 67 14.5 68 13.5 69 12.0 70 10.5 71 5.5 72 4.0 73 4.5 74 5.0 75 2.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.3 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.21250000000000002 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.225 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.225 0.0 0.0 0.0 0.0 122-123 0.2625 0.0 0.0 0.0 0.0 124-125 0.3125 0.0 0.0 0.0 0.0 126-127 0.325 0.0 0.0 0.0 0.0 128-129 0.35 0.0 0.0 0.0 0.0 130-131 0.35 0.0 0.0 0.0 0.0 132-133 0.35 0.0 0.0 0.0 0.0 134-135 0.3625 0.0 0.0 0.0 0.0 136-137 0.375 0.0 0.0 0.0 0.0 138-139 0.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTTGGT 10 0.006832588 144.9875 7 TCACCAT 10 0.006832588 144.9875 4 >>END_MODULE SRR6031173 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031173_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.33525 34.0 33.0 34.0 33.0 34.0 2 33.503 34.0 33.0 34.0 33.0 34.0 3 33.56725 34.0 33.0 34.0 33.0 34.0 4 33.56675 34.0 33.0 34.0 33.0 34.0 5 33.5505 34.0 33.0 34.0 33.0 34.0 6 37.7415 38.0 38.0 38.0 38.0 38.0 7 37.18725 38.0 38.0 38.0 37.0 38.0 8 37.5895 38.0 38.0 38.0 38.0 38.0 9 37.6355 38.0 38.0 38.0 38.0 38.0 10-14 37.65675 38.0 38.0 38.0 38.0 38.0 15-19 37.6075 38.0 38.0 38.0 38.0 38.0 20-24 37.52290000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.6437 38.0 38.0 38.0 38.0 38.0 30-34 37.73025 38.0 38.0 38.0 38.0 38.0 35-39 37.7202 38.0 38.0 38.0 38.0 38.0 40-44 37.7335 38.0 38.0 38.0 38.0 38.0 45-49 37.72885 38.0 38.0 38.0 38.0 38.0 50-54 37.7205 38.0 38.0 38.0 38.0 38.0 55-59 37.6827 38.0 38.0 38.0 38.0 38.0 60-64 37.68605 38.0 38.0 38.0 38.0 38.0 65-69 37.654849999999996 38.0 38.0 38.0 38.0 38.0 70-74 37.5055 38.0 38.0 38.0 38.0 38.0 75-79 37.63955 38.0 38.0 38.0 38.0 38.0 80-84 37.62015 38.0 38.0 38.0 38.0 38.0 85-89 37.58135 38.0 38.0 38.0 38.0 38.0 90-94 37.541250000000005 38.0 38.0 38.0 38.0 38.0 95-99 37.5284 38.0 38.0 38.0 38.0 38.0 100-104 37.525549999999996 38.0 38.0 38.0 38.0 38.0 105-109 37.2988 38.0 38.0 38.0 38.0 38.0 110-114 37.23315 38.0 38.0 38.0 38.0 38.0 115-119 37.13695 38.0 38.0 38.0 37.2 38.0 120-124 37.13665 38.0 38.0 38.0 37.0 38.0 125-129 37.21045 38.0 38.0 38.0 36.4 38.0 130-134 37.1493 38.0 38.0 38.0 36.0 38.0 135-139 37.11175 38.0 38.0 38.0 36.0 38.0 140-144 37.021950000000004 38.0 38.0 38.0 36.0 38.0 145-149 36.95205 38.0 38.0 38.0 36.0 38.0 150-151 34.922125 38.0 36.0 38.0 29.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 2.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 3.0 22 2.0 23 3.0 24 3.0 25 3.0 26 3.0 27 11.0 28 7.0 29 14.0 30 16.0 31 21.0 32 18.0 33 21.0 34 39.0 35 65.0 36 192.0 37 3571.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.475 21.475 12.825000000000001 26.224999999999998 2 27.950000000000003 28.249999999999996 23.775 20.025000000000002 3 22.075 30.599999999999998 26.775 20.549999999999997 4 24.20605151287822 32.53313328332083 19.629907476869217 23.63090772693173 5 25.087543771885944 33.54177088544272 21.68584292146073 19.684842421210604 6 23.861930965482742 34.91745872936468 20.860430215107552 20.36018009004502 7 22.15 21.15 33.775 22.925 8 24.680851063829788 24.105131414267834 23.829787234042556 27.384230287859822 9 22.8342513770656 23.43515272909364 28.04206309464196 25.6885327991988 10-14 24.76214321482223 26.820230345518276 24.221331997996995 24.196294441662495 15-19 24.667836550513915 26.25720732013036 25.36976685886187 23.70518927049386 20-24 24.360584895231398 26.114265614793226 25.8027234812321 23.72242600874328 25-29 24.74841035397787 26.26545836879788 25.158964602212986 23.827166675011267 30-34 24.985 26.279999999999998 25.435000000000002 23.3 35-39 25.314999999999998 26.305 25.44 22.939999999999998 40-44 25.240000000000002 26.135 25.055 23.57 45-49 24.89 25.755 25.885 23.47 50-54 24.9 26.525 25.495 23.080000000000002 55-59 25.196299074768692 25.991497874468617 25.426356589147286 23.385846461615404 60-64 24.610000000000003 26.41 25.430000000000003 23.549999999999997 65-69 25.430000000000003 26.31 25.305 22.955000000000002 70-74 25.536609829488466 25.616850551654963 25.446339017051155 23.400200601805416 75-79 25.515 26.275 25.580000000000002 22.63 80-84 24.865000000000002 26.105 26.015 23.015 85-89 25.745 25.75 25.314999999999998 23.189999999999998 90-94 24.54 26.665 25.52 23.275000000000002 95-99 25.095 26.75 25.474999999999998 22.68 100-104 24.355 27.02 25.290000000000003 23.335 105-109 24.85694207408895 26.49834353980524 25.499447846601747 23.145266539504068 110-114 24.929619947717676 26.266840941081842 25.71385481600644 23.08968429519405 115-119 25.55778894472362 26.27638190954774 25.663316582914575 22.50251256281407 120-124 25.02755234946398 26.350065123735096 25.58861837491233 23.03376415188859 125-129 25.25 26.784999999999997 25.39 22.575 130-134 25.335 25.885 25.965 22.814999999999998 135-139 25.415 26.5 25.75 22.335 140-144 24.474999999999998 26.255 26.029999999999998 23.24 145-149 25.575 26.169999999999998 26.179999999999996 22.075 150-151 24.925 26.025 26.150000000000002 22.900000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 2.0 28 3.0 29 2.5 30 7.0 31 12.0 32 15.0 33 23.5 34 30.0 35 40.5 36 54.5 37 67.0 38 79.0 39 104.0 40 136.5 41 171.0 42 198.0 43 199.5 44 210.0 45 234.0 46 230.5 47 213.5 48 206.0 49 177.5 50 161.5 51 153.5 52 123.5 53 122.0 54 116.0 55 92.0 56 77.5 57 69.0 58 65.0 59 64.5 60 67.5 61 57.5 62 55.5 63 53.5 64 44.5 65 39.0 66 30.0 67 35.5 68 41.0 69 31.5 70 23.0 71 18.0 72 15.0 73 8.5 74 6.5 75 7.0 76 2.5 77 0.5 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.05 6 0.05 7 0.0 8 0.125 9 0.15 10-14 0.15 15-19 0.27499999999999997 20-24 0.49500000000000005 25-29 0.135 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.025 60-64 0.0 65-69 0.0 70-74 0.3 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.38999999999999996 110-114 0.54 115-119 0.5 120-124 0.19 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.21250000000000002 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.225 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.225 0.0 0.0 0.0 0.0 122-123 0.2625 0.0 0.0 0.0 0.0 124-125 0.3125 0.0 0.0 0.0 0.0 126-127 0.325 0.0 0.0 0.0 0.0 128-129 0.35 0.0 0.0 0.0 0.0 130-131 0.35 0.0 0.0 0.0 0.0 132-133 0.35 0.0 0.0 0.0 0.0 134-135 0.3625 0.0 0.0 0.0 0.0 136-137 0.375 0.0 0.0 0.0 0.0 138-139 0.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCAAC 10 0.0065840036 146.77216 1 AGCAACC 10 0.0065840036 146.77216 2 TCCTAGT 10 0.0068396386 144.9375 6 >>END_MODULE Read 299303 spots for SRR6031173.sra Written 299303 spots for SRR6031173.sra Read 299303 spots for SRR6031173.sra Written 299303 spots for SRR6031173.sra Read 299303 spots for SRR6031173.sra Written 299303 spots for SRR6031173.sra Read 299303 spots for SRR6031173.sra Written 299303 spots for SRR6031173.sra Read 299303 spots for SRR6031173.sra Written 299303 spots for SRR6031173.sra Read 299303 spots for SRR6031173.sra Written 299303 spots for SRR6031173.sra Read 299303 spots for SRR6031173.sra Written 299303 spots for SRR6031173.sra Read 299303 spots for SRR6031173.sra Written 299303 spots for SRR6031173.sra Read 299303 spots for SRR6031173.sra Written 299303 spots for SRR6031173.sra Read 299303 spots for SRR6031173.sra Written 299303 spots for SRR6031173.sra Read 299303 spots for SRR6031173.sra Written 299303 spots for SRR6031173.sra Read 299303 spots for SRR6031173.sra Written 299303 spots for SRR6031173.sra Read 299303 spots for SRR6031173.sra Written 299303 spots for SRR6031173.sra Read 299303 spots for SRR6031173.sra Written 299303 spots for SRR6031173.sra Read 299312 spots for SRR6031173.sra Written 299312 spots for SRR6031173.sra Read 299303 spots for SRR6031173.sra Written 299303 spots for SRR6031173.sra Read 299303 spots for SRR6031173.sra Written 299303 spots for SRR6031173.sra Read 299303 spots for SRR6031173.sra Written 299303 spots for SRR6031173.sra Read 299303 spots for SRR6031173.sra Written 299303 spots for SRR6031173.sra Read 299303 spots for SRR6031173.sra Written 299303 spots for SRR6031173.sra SRR ids: ['SRR6031173.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7rz0r7bf SRR6031173.sra spots: 5986069 blocks: [[1, 299303], [299304, 598606], [598607, 897909], [897910, 1197212], [1197213, 1496515], [1496516, 1795818], [1795819, 2095121], [2095122, 2394424], [2394425, 2693727], [2693728, 2993030], [2993031, 3292333], [3292334, 3591636], [3591637, 3890939], [3890940, 4190242], [4190243, 4489545], [4489546, 4788848], [4788849, 5088151], [5088152, 5387454], [5387455, 5686757], [5686758, 5986069]] SRR6031173 file size 2014621 SRR6031173 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031173 SRR6031173_1.fastq SRR6031173_2.fastq Input file: SRR6031173_1.fastq Paired file: SRR6031173_2.fastq trimmed: SRR6031173-trimmed-pair1.fastq, SRR6031173-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:35:17 2024 >> started Tue Dec 10 00:35:23 2024 >> done (6.640s) 5986069 read pairs processed; of these: 3085 ( 0.05%) short read pairs filtered out after trimming by size control 3254 ( 0.05%) empty read pairs filtered out after trimming by size control 5979730 (99.89%) read pairs available; of these: 1174799 (19.65%) trimmed read pairs available after processing 4804931 (80.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 2 0.00% 21 2 0.00% 22 4 0.00% 23 4 0.00% 24 1 0.00% 25 3 0.00% 26 3 0.00% 27 1 0.00% 28 3 0.00% 29 2 0.00% 30 3 0.00% 31 5 0.00% 32 1 0.00% 33 4 0.00% 34 2 0.00% 35 1 0.00% 36 0 0.00% 37 1 0.00% 38 3 0.00% 39 3 0.00% 40 1 0.00% 41 1 0.00% 42 2 0.00% 43 4 0.00% 44 2 0.00% 45 2 0.00% 46 1 0.00% 47 3 0.00% 48 2 0.00% 49 3 0.00% 50 3 0.00% 51 6 0.00% 52 7 0.00% 53 7 0.00% 54 7 0.00% 55 8 0.00% 56 4 0.00% 57 9 0.00% 58 11 0.00% 59 12 0.00% 60 15 0.00% 61 9 0.00% 62 18 0.00% 63 16 0.00% 64 10 0.00% 65 11 0.00% 66 14 0.00% 67 24 0.00% 68 23 0.00% 69 25 0.00% 70 37 0.00% 71 34 0.00% 72 34 0.00% 73 33 0.00% 74 45 0.00% 75 43 0.00% 76 59 0.00% 77 65 0.00% 78 77 0.00% 79 51 0.00% 80 81 0.00% 81 82 0.00% 82 104 0.00% 83 117 0.00% 84 272 0.00% 85 401 0.01% 86 378 0.01% 87 529 0.01% 88 688 0.01% 89 711 0.01% 90 747 0.01% 91 621 0.01% 92 598 0.01% 93 605 0.01% 94 613 0.01% 95 547 0.01% 96 509 0.01% 97 499 0.01% 98 482 0.01% 99 574 0.01% 100 566 0.01% 101 612 0.01% 102 635 0.01% 103 637 0.01% 104 670 0.01% 105 689 0.01% 106 715 0.01% 107 798 0.01% 108 885 0.01% 109 1017 0.02% 110 1056 0.02% 111 1105 0.02% 112 1196 0.02% 113 1452 0.02% 114 1756 0.03% 115 2351 0.04% 116 2458 0.04% 117 2135 0.04% 118 1741 0.03% 119 1524 0.03% 120 1702 0.03% 121 1833 0.03% 122 1992 0.03% 123 2117 0.04% 124 2044 0.03% 125 1999 0.03% 126 2188 0.04% 127 2173 0.04% 128 2345 0.04% 129 2326 0.04% 130 2517 0.04% 131 2622 0.04% 132 2781 0.05% 133 3091 0.05% 134 3188 0.05% 135 3469 0.06% 136 3734 0.06% 137 4086 0.07% 138 4638 0.08% 139 4989 0.08% 140 5350 0.09% 141 6056 0.10% 142 6946 0.12% 143 8023 0.13% 144 9727 0.16% 145 12415 0.21% 146 16367 0.27% 147 23635 0.40% 148 40024 0.67% 149 92456 1.55% 150 864022 14.45% 151 4804931 80.35% 5979730 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=8.58 fanout-score-rank=20 prefix-density=0.25 prefix-fanout=5.3 sequence=CTTGATGACACCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=282.84 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=26.0 sequence=CTTCTTCTTGAT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=27.16 fanout-score-rank=8 prefix-density=0.60 prefix-fanout=11.3 sequence=AGGAAGAAGAAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=31 fanout-score=279.42 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=18.4 sequence=CCGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR6031173 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:36:18 Started mapping on | Dec 10 00:36:18 Finished on | Dec 10 00:37:30 Mapping speed, Million of reads per hour | 298.99 Number of input reads | 5979730 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 5532778 Uniquely mapped reads % | 92.53% Average mapped length | 300.45 Number of splices: Total | 6472013 Number of splices: Annotated (sjdb) | 6156043 Number of splices: GT/AG | 6387540 Number of splices: GC/AG | 76333 Number of splices: AT/AC | 4656 Number of splices: Non-canonical | 3484 Mismatch rate per base, % | 0.06% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 64205 % of reads mapped to multiple loci | 1.07% Number of reads mapped to too many loci | 5682 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.50% % of reads unmapped: other | 0.80% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 385272 385272 385272 N_multimapping 64205 64205 64205 N_noFeature 169940 5383811 208429 N_ambiguous 130422 1169 20055 UnstrandedReadsAssigned:5232416 PositiveStrandReadsAssigned:147798 NegativeStrandReadsAssigned:5304294 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6031173 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6031173-trimmed-pair1.fastq SRR6031173-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,979,730 reads, 5,342,484 reads pseudoaligned [quant] estimated average fragment length: 457.267 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52973 SRR6031173.ke.tsv 35125 SRR6031173.se.tsv 88098 total ==> SRR6031173.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 481.359 0 0 PNS24247 1044 587.733 28.7087 12.5985 PNS24249 1928 1471.73 12.3193 2.15896 PNS24246 1044 587.733 28.7087 12.5985 PNS24248 1044 587.733 28.7087 12.5985 PNS24244 1471 1014.73 32.5547 8.27462 PNS24243 293 60.9801 0 0 KQK14069 1603 1146.73 1425.41 320.6 KQK14071 474 120.791 4.79807 10.2451 ==> SRR6031173.se.tsv <== BRADI_1g14170v3 1543 BRADI_1g53295v3 16 BRADI_1g59795v3 140 BRADI_1g07683v3 0 BRADI_1g00485v3 22 BRADI_1g20270v3 277 BRADI_1g74790v3 54 BRADI_1g09890v3 0 BRADI_1g77505v3 57 BRADI_1g48960v3 0 SRR6031173 completed mapping pipeline successfully