Starting /dee2/code/volunteer_pipeline.sh SRR6031175 current disk space = 1523687645184 free memory = 1569640340 SRR6031175 SRAfilesize e8a5b72e322af98129b6d60aae83d1b0 SRR6031175.sra SRR6031175.sra file validated SRR6031175 is paired end SRR6031175 is conventional basespace SRR6031175 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031175_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.53475 18.0 18.0 30.0 18.0 32.0 2 30.70125 32.0 27.0 32.0 27.0 33.0 3 31.43075 33.0 31.0 33.0 29.0 33.0 4 32.34875 33.0 32.0 33.0 31.0 33.0 5 33.08825 33.0 33.0 34.0 33.0 34.0 6 37.54925 38.0 38.0 38.0 37.0 38.0 7 37.79325 38.0 38.0 38.0 38.0 38.0 8 37.8155 38.0 38.0 38.0 38.0 38.0 9 37.78525 38.0 38.0 38.0 38.0 38.0 10-14 37.8291 38.0 38.0 38.0 38.0 38.0 15-19 37.8293 38.0 38.0 38.0 38.0 38.0 20-24 37.8231 38.0 38.0 38.0 38.0 38.0 25-29 37.769099999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.7875 38.0 38.0 38.0 38.0 38.0 35-39 37.7983 38.0 38.0 38.0 38.0 38.0 40-44 37.75325 38.0 38.0 38.0 38.0 38.0 45-49 37.72425 38.0 38.0 38.0 38.0 38.0 50-54 37.67615 38.0 38.0 38.0 38.0 38.0 55-59 37.635149999999996 38.0 38.0 38.0 38.0 38.0 60-64 37.6162 38.0 38.0 38.0 38.0 38.0 65-69 37.59255 38.0 38.0 38.0 38.0 38.0 70-74 37.57585 38.0 38.0 38.0 38.0 38.0 75-79 37.52135 38.0 38.0 38.0 37.6 38.0 80-84 37.4634 38.0 38.0 38.0 37.0 38.0 85-89 37.42715 38.0 38.0 38.0 37.0 38.0 90-94 37.3854 38.0 38.0 38.0 37.0 38.0 95-99 37.3081 38.0 38.0 38.0 36.8 38.0 100-104 37.2455 38.0 38.0 38.0 36.2 38.0 105-109 37.1502 38.0 38.0 38.0 36.0 38.0 110-114 37.015550000000005 38.0 38.0 38.0 35.8 38.0 115-119 36.99934999999999 38.0 38.0 38.0 35.6 38.0 120-124 36.83665 38.0 38.0 38.0 35.0 38.0 125-129 36.674800000000005 38.0 38.0 38.0 34.4 38.0 130-134 36.6419 38.0 38.0 38.0 34.4 38.0 135-139 36.437 38.0 38.0 38.0 34.0 38.0 140-144 36.23765 38.0 38.0 38.0 33.6 38.0 145-149 35.89795 38.0 36.2 38.0 33.0 38.0 150-151 32.94725 37.0 33.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 4.0 20 0.0 21 2.0 22 0.0 23 3.0 24 4.0 25 2.0 26 3.0 27 6.0 28 11.0 29 10.0 30 11.0 31 9.0 32 23.0 33 41.0 34 90.0 35 143.0 36 532.0 37 3105.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.35140562248996 11.696787148594376 8.885542168674698 29.066265060240966 2 24.025 11.799999999999999 33.375 30.8 3 19.85 16.875 27.325 35.949999999999996 4 23.200000000000003 21.525 24.4 30.875000000000004 5 23.825 27.650000000000002 24.825 23.7 6 23.150000000000002 32.300000000000004 24.5 20.05 7 16.400000000000002 26.275 38.6 18.725 8 18.575 26.875 30.175 24.375 9 18.3 23.875 34.599999999999994 23.225 10-14 21.47 28.38 27.500000000000004 22.650000000000002 15-19 20.855 26.665 28.04 24.44 20-24 21.365000000000002 27.155 27.250000000000004 24.23 25-29 20.715 27.265 27.375 24.645 30-34 21.18 26.525 27.555000000000003 24.740000000000002 35-39 20.685000000000002 26.705000000000002 27.54 25.069999999999997 40-44 21.77 26.825 27.265 24.14 45-49 21.2 26.8 27.389999999999997 24.610000000000003 50-54 21.310000000000002 27.265 26.77 24.654999999999998 55-59 21.295 27.089999999999996 27.345000000000002 24.27 60-64 21.5 26.795 27.455000000000002 24.25 65-69 20.895 26.555 28.01 24.54 70-74 21.01 26.355 28.16 24.474999999999998 75-79 20.974999999999998 26.52 28.21 24.295 80-84 21.16 26.31 27.395000000000003 25.135 85-89 21.205 26.845000000000002 27.27 24.68 90-94 21.67 27.08 26.884999999999998 24.365000000000002 95-99 20.974999999999998 26.525 27.68 24.82 100-104 21.055 26.815 27.229999999999997 24.9 105-109 21.08 26.85 27.400000000000002 24.67 110-114 21.044999999999998 26.784999999999997 27.575 24.595 115-119 21.505 27.01 26.96 24.525 120-124 21.705 27.500000000000004 26.555 24.240000000000002 125-129 21.415 26.840000000000003 27.08 24.665 130-134 21.67 26.96 26.674999999999997 24.695 135-139 21.45 26.795 27.58 24.175 140-144 21.555 26.540000000000003 27.250000000000004 24.654999999999998 145-149 21.404999999999998 26.590000000000003 27.3 24.705 150-151 20.5875 26.937499999999996 27.400000000000002 25.074999999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 1.0 26 0.0 27 1.5 28 4.0 29 5.0 30 10.5 31 13.5 32 21.5 33 35.0 34 44.5 35 51.0 36 68.5 37 84.5 38 105.5 39 147.0 40 171.5 41 200.5 42 227.0 43 231.0 44 239.0 45 244.5 46 249.5 47 240.0 48 220.0 49 210.0 50 178.0 51 138.0 52 127.0 53 122.5 54 98.0 55 74.5 56 61.5 57 48.5 58 43.0 59 43.5 60 36.5 61 26.0 62 26.5 63 27.0 64 23.0 65 18.0 66 13.0 67 15.0 68 12.0 69 8.5 70 10.0 71 8.0 72 4.5 73 2.5 74 2.0 75 1.5 76 0.5 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 98.86162408297496 97.7 2 1.1130786744244878 2.1999999999999997 3 0.0 0.0 4 0.025297242600556536 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.325 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.4375 0.0 0.0 0.0 0.0 122-123 0.45 0.0 0.0 0.0 0.0 124-125 0.4875 0.0 0.0 0.0 0.0 126-127 0.5375000000000001 0.0 0.0 0.0 0.0 128-129 0.6625000000000001 0.0 0.0 0.0 0.0 130-131 0.7375 0.0 0.0 0.0 0.0 132-133 0.8 0.0 0.0 0.0 0.0 134-135 0.875 0.0 0.0 0.0 0.0 136-137 0.9 0.0 0.0 0.0 0.0 138-139 0.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCAAGG 10 0.006830828 145.0 1 >>END_MODULE SRR6031175 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031175_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.53275 34.0 33.0 34.0 33.0 34.0 2 32.68275 34.0 33.0 34.0 33.0 34.0 3 32.77325 34.0 33.0 34.0 33.0 34.0 4 32.6755 34.0 33.0 34.0 33.0 34.0 5 32.7795 34.0 33.0 34.0 33.0 34.0 6 36.765 38.0 38.0 38.0 38.0 38.0 7 36.7355 38.0 38.0 38.0 38.0 38.0 8 36.74375 38.0 38.0 38.0 38.0 38.0 9 36.75975 38.0 38.0 38.0 38.0 38.0 10-14 36.74655 38.0 38.0 38.0 38.0 38.0 15-19 36.6114 38.0 38.0 38.0 38.0 38.0 20-24 36.64685 38.0 38.0 38.0 38.0 38.0 25-29 36.656349999999996 38.0 38.0 38.0 38.0 38.0 30-34 36.9007 38.0 38.0 38.0 38.0 38.0 35-39 36.997 38.0 38.0 38.0 38.0 38.0 40-44 37.0233 38.0 38.0 38.0 38.0 38.0 45-49 36.999750000000006 38.0 38.0 38.0 38.0 38.0 50-54 36.953250000000004 38.0 38.0 38.0 38.0 38.0 55-59 36.72425 38.0 38.0 38.0 38.0 38.0 60-64 36.769549999999995 38.0 38.0 38.0 38.0 38.0 65-69 36.725300000000004 38.0 38.0 38.0 38.0 38.0 70-74 36.5527 38.0 38.0 38.0 37.8 38.0 75-79 36.660250000000005 38.0 38.0 38.0 38.0 38.0 80-84 36.8596 38.0 38.0 38.0 37.8 38.0 85-89 36.834649999999996 38.0 38.0 38.0 37.8 38.0 90-94 36.8038 38.0 38.0 38.0 37.4 38.0 95-99 36.7962 38.0 38.0 38.0 37.2 38.0 100-104 36.61039999999999 38.0 38.0 38.0 37.0 38.0 105-109 36.3908 38.0 38.0 38.0 36.4 38.0 110-114 36.27455 38.0 38.0 38.0 36.0 38.0 115-119 36.1458 38.0 38.0 38.0 35.8 38.0 120-124 36.11345 38.0 38.0 38.0 35.2 38.0 125-129 36.33605 38.0 38.0 38.0 35.4 38.0 130-134 36.313649999999996 38.0 38.0 38.0 35.0 38.0 135-139 36.27205 38.0 38.0 38.0 35.0 38.0 140-144 36.151799999999994 38.0 38.0 38.0 35.0 38.0 145-149 35.88969999999999 38.0 38.0 38.0 34.2 38.0 150-151 33.328125 37.0 35.0 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 73.0 3 3.0 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 7.0 17 3.0 18 7.0 19 6.0 20 9.0 21 8.0 22 5.0 23 5.0 24 0.0 25 7.0 26 6.0 27 6.0 28 9.0 29 6.0 30 14.0 31 12.0 32 16.0 33 25.0 34 63.0 35 90.0 36 214.0 37 3401.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.465982028241335 22.721437740693197 10.141206675224646 23.671373555840823 2 27.740778688524593 30.071721311475407 24.410860655737704 17.776639344262296 3 21.839080459770116 27.68837803320562 30.191570881226053 20.28097062579821 4 25.672559569561876 32.64155777606969 21.521906225980015 20.16397642838842 5 27.08014293006636 32.159264931087286 21.694742215416028 19.06584992343032 6 23.998973305954827 35.600616016427104 21.560574948665298 18.83983572895277 7 22.573189522342066 22.39342578325629 34.82280431432974 20.210580380071903 8 23.29997433923531 25.532460867333846 25.58378239671542 25.58378239671542 9 24.160901870356135 23.77658211632078 27.44043043812452 24.622085575198565 10-14 24.856321839080458 27.632389162561577 25.20012315270936 22.311165845648603 15-19 24.494416713837285 27.09308907528431 25.64709514742963 22.765399063448776 20-24 24.98842890203137 26.8860889688866 26.520956544098738 21.604525584983286 25-29 25.010275380189068 26.916358405260993 26.068639539662968 22.00472667488697 30-34 24.932470312420367 26.522603333163445 26.018041893889198 22.526884460526986 35-39 24.74824534635337 26.930119011290817 26.060421116875194 22.26121452548062 40-44 24.492179565305708 27.442616290879545 25.9699370302661 22.09526711354865 45-49 24.92396593673966 26.890713706407137 26.20640713706407 21.97891321978913 50-54 24.62023065589595 26.99791698419956 26.494944876289182 21.886907483615303 55-59 25.112751127511274 26.865518655186555 26.142886428864287 21.878843788437884 60-64 24.731622533483282 26.546365402310602 27.093344238830387 21.62866782537573 65-69 24.57227743059113 27.246183792644196 25.898985759655773 22.282553017108903 70-74 24.587467228705083 27.24001439366679 26.078239860175806 22.09427851745232 75-79 24.450015348408883 26.85971554282206 26.68576690883045 22.004502199938607 80-84 25.390070921985814 26.72239108409321 26.20567375886525 21.681864235055727 85-89 24.821762653587502 27.572432623754867 25.68640339788643 21.919401324771197 90-94 24.959604120379723 27.539890931125026 26.297717632801454 21.2027873156938 95-99 24.264705882352942 27.003042596348887 26.272819472616632 22.459432048681542 100-104 24.763898106079942 26.62208382255347 26.47404155393333 22.139976517433254 105-109 25.06672141244098 27.25826319031 25.898172859782388 21.77684253746664 110-114 24.96787788456597 27.5273680423498 26.50459988693015 21.00015418615408 115-119 24.49925338551053 27.25400339838319 26.507388908913033 21.739354307193246 120-124 24.59983583008414 27.1547301457008 26.49805048224913 21.747383541965934 125-129 25.29642257391481 27.88153274642512 25.983410513459877 20.838634166200194 130-134 25.33691356773736 27.398925929678793 26.264059175195055 21.000101327388794 135-139 24.57494576459311 27.132838908228646 26.60309772463549 21.68911760254276 140-144 24.643451091064858 27.319457743284786 26.618958826790305 21.41813233886005 145-149 25.017600321834454 26.993865030674847 26.36528210801569 21.623252539475008 150-151 25.5987834241541 26.257762007350145 26.207071347104293 21.93638322139146 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 34.0 1 18.0 2 2.5 3 3.0 4 3.0 5 2.5 6 2.5 7 3.5 8 3.0 9 2.5 10 3.0 11 1.5 12 0.5 13 0.5 14 0.0 15 1.0 16 3.0 17 3.0 18 1.5 19 2.0 20 2.5 21 3.5 22 4.5 23 4.5 24 4.0 25 2.0 26 2.5 27 4.0 28 5.5 29 7.0 30 9.0 31 12.0 32 17.5 33 25.0 34 36.5 35 47.0 36 63.0 37 87.0 38 116.5 39 146.0 40 170.5 41 189.5 42 210.0 43 234.5 44 262.0 45 243.0 46 213.0 47 215.0 48 192.5 49 165.5 50 130.0 51 108.5 52 101.5 53 95.0 54 88.5 55 77.0 56 65.5 57 59.0 58 55.5 59 51.0 60 46.0 61 42.0 62 41.5 63 37.5 64 36.5 65 32.0 66 29.5 67 29.0 68 24.0 69 18.0 70 13.5 71 12.0 72 10.5 73 9.0 74 8.5 75 4.0 76 2.0 77 2.5 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.625 2 2.4 3 2.125 4 2.4250000000000003 5 2.0500000000000003 6 2.6 7 2.65 8 2.5749999999999997 9 2.4250000000000003 10-14 2.56 15-19 2.835 20-24 2.775 25-29 2.68 30-34 1.8950000000000002 35-39 1.69 40-44 1.54 45-49 1.3599999999999999 50-54 1.585 55-59 2.44 60-64 2.19 65-69 2.39 70-74 2.735 75-79 2.27 80-84 1.3 85-89 1.115 90-94 0.98 95-99 1.4000000000000001 100-104 2.0549999999999997 105-109 2.58 110-114 2.715 115-119 2.895 120-124 2.54 125-129 1.745 130-134 1.31 135-139 0.895 140-144 0.7849999999999999 145-149 0.5700000000000001 150-151 1.3625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.87583035258048 96.75 2 1.0219724067450178 2.0 3 0.02554931016862545 0.075 4 0.02554931016862545 0.1 5 0.02554931016862545 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02554931016862545 0.95 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 38 0.95 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.325 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.45 0.0 0.0 0.0 0.0 120-121 0.4875 0.0 0.0 0.0 0.0 122-123 0.5 0.0 0.0 0.0 0.0 124-125 0.5375000000000001 0.0 0.0 0.0 0.0 126-127 0.5874999999999999 0.0 0.0 0.0 0.0 128-129 0.7124999999999999 0.0 0.0 0.0 0.0 130-131 0.7875000000000001 0.0 0.0 0.0 0.0 132-133 0.8500000000000001 0.0 0.0 0.0 0.0 134-135 0.925 0.0 0.0 0.0 0.0 136-137 0.95 0.0 0.0 0.0 0.0 138-139 1.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 672003 spots for SRR6031175.sra Written 672003 spots for SRR6031175.sra Read 672003 spots for SRR6031175.sra Written 672003 spots for SRR6031175.sra Read 672003 spots for SRR6031175.sra Written 672003 spots for SRR6031175.sra Read 672003 spots for SRR6031175.sra Written 672003 spots for SRR6031175.sra Read 672003 spots for SRR6031175.sra Written 672003 spots for SRR6031175.sra Read 672003 spots for SRR6031175.sra Written 672003 spots for SRR6031175.sra Read 672003 spots for SRR6031175.sra Written 672003 spots for SRR6031175.sra Read 672003 spots for SRR6031175.sra Written 672003 spots for SRR6031175.sra Read 672003 spots for SRR6031175.sra Written 672003 spots for SRR6031175.sra Read 672003 spots for SRR6031175.sra Written 672003 spots for SRR6031175.sra Read 672003 spots for SRR6031175.sra Written 672003 spots for SRR6031175.sra Read 672003 spots for SRR6031175.sra Written 672003 spots for SRR6031175.sra Read 672003 spots for SRR6031175.sra Written 672003 spots for SRR6031175.sra Read 672003 spots for SRR6031175.sra Written 672003 spots for SRR6031175.sra Read 672003 spots for SRR6031175.sra Written 672003 spots for SRR6031175.sra Read 672020 spots for SRR6031175.sra Written 672020 spots for SRR6031175.sra Read 672003 spots for SRR6031175.sra Written 672003 spots for SRR6031175.sra Read 672003 spots for SRR6031175.sra Written 672003 spots for SRR6031175.sra Read 672003 spots for SRR6031175.sra Written 672003 spots for SRR6031175.sra Read 672003 spots for SRR6031175.sra Written 672003 spots for SRR6031175.sra SRR ids: ['SRR6031175.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ovigyspn SRR6031175.sra spots: 13440077 blocks: [[1, 672003], [672004, 1344006], [1344007, 2016009], [2016010, 2688012], [2688013, 3360015], [3360016, 4032018], [4032019, 4704021], [4704022, 5376024], [5376025, 6048027], [6048028, 6720030], [6720031, 7392033], [7392034, 8064036], [8064037, 8736039], [8736040, 9408042], [9408043, 10080045], [10080046, 10752048], [10752049, 11424051], [11424052, 12096054], [12096055, 12768057], [12768058, 13440077]] SRR6031175 file size 4532700 SRR6031175 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031175 SRR6031175_1.fastq SRR6031175_2.fastq Input file: SRR6031175_1.fastq Paired file: SRR6031175_2.fastq trimmed: SRR6031175-trimmed-pair1.fastq, SRR6031175-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:36:35 2024 >> started Tue Dec 10 00:36:51 2024 >> done (15.434s) 13440077 read pairs processed; of these: 9731 ( 0.07%) short read pairs filtered out after trimming by size control 25591 ( 0.19%) empty read pairs filtered out after trimming by size control 13404755 (99.74%) read pairs available; of these: 3711287 (27.69%) trimmed read pairs available after processing 9693468 (72.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 3 0.00% 21 5 0.00% 22 5 0.00% 23 4 0.00% 24 6 0.00% 25 6 0.00% 26 7 0.00% 27 2 0.00% 28 5 0.00% 29 12 0.00% 30 9 0.00% 31 5 0.00% 32 5 0.00% 33 6 0.00% 34 6 0.00% 35 6 0.00% 36 13 0.00% 37 10 0.00% 38 8 0.00% 39 8 0.00% 40 8 0.00% 41 10 0.00% 42 12 0.00% 43 16 0.00% 44 7 0.00% 45 19 0.00% 46 6 0.00% 47 17 0.00% 48 19 0.00% 49 15 0.00% 50 21 0.00% 51 23 0.00% 52 26 0.00% 53 22 0.00% 54 35 0.00% 55 39 0.00% 56 48 0.00% 57 33 0.00% 58 49 0.00% 59 45 0.00% 60 43 0.00% 61 67 0.00% 62 64 0.00% 63 79 0.00% 64 74 0.00% 65 109 0.00% 66 91 0.00% 67 138 0.00% 68 121 0.00% 69 154 0.00% 70 172 0.00% 71 204 0.00% 72 217 0.00% 73 243 0.00% 74 265 0.00% 75 311 0.00% 76 337 0.00% 77 424 0.00% 78 427 0.00% 79 416 0.00% 80 497 0.00% 81 578 0.00% 82 593 0.00% 83 709 0.01% 84 1110 0.01% 85 1484 0.01% 86 1516 0.01% 87 1450 0.01% 88 1578 0.01% 89 1490 0.01% 90 1555 0.01% 91 1707 0.01% 92 1731 0.01% 93 1782 0.01% 94 1836 0.01% 95 1943 0.01% 96 2091 0.02% 97 2123 0.02% 98 2173 0.02% 99 2390 0.02% 100 2319 0.02% 101 2485 0.02% 102 2616 0.02% 103 2782 0.02% 104 2769 0.02% 105 2993 0.02% 106 3220 0.02% 107 3045 0.02% 108 3257 0.02% 109 3454 0.03% 110 3551 0.03% 111 3727 0.03% 112 3943 0.03% 113 3919 0.03% 114 4268 0.03% 115 4549 0.03% 116 4451 0.03% 117 4858 0.04% 118 5045 0.04% 119 5030 0.04% 120 5197 0.04% 121 5376 0.04% 122 5622 0.04% 123 6014 0.04% 124 6416 0.05% 125 6672 0.05% 126 6908 0.05% 127 7003 0.05% 128 7599 0.06% 129 7820 0.06% 130 8292 0.06% 131 8746 0.07% 132 9289 0.07% 133 10021 0.07% 134 10723 0.08% 135 11056 0.08% 136 12023 0.09% 137 12882 0.10% 138 13779 0.10% 139 15244 0.11% 140 16965 0.13% 141 19415 0.14% 142 21276 0.16% 143 24761 0.18% 144 31489 0.23% 145 43553 0.32% 146 72039 0.54% 147 76911 0.57% 148 143063 1.07% 149 356478 2.66% 150 2621473 19.56% 151 9693468 72.31% 13404755 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=12.88 fanout-score-rank=13 prefix-density=0.32 prefix-fanout=6.3 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=20 fanout-score=412.69 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=35.4 sequence=TCTTCTTCTTGTC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=4.14 fanout-score-rank=24 prefix-density=0.19 prefix-fanout=3.4 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=19 fanout-score=296.64 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=29.5 sequence=CAAGAAGAAGAT SRR6031175 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:37:40 Started mapping on | Dec 10 00:37:40 Finished on | Dec 10 00:38:52 Mapping speed, Million of reads per hour | 670.24 Number of input reads | 13404755 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 12644621 Uniquely mapped reads % | 94.33% Average mapped length | 299.30 Number of splices: Total | 15352126 Number of splices: Annotated (sjdb) | 14676861 Number of splices: GT/AG | 15158351 Number of splices: GC/AG | 173937 Number of splices: AT/AC | 10158 Number of splices: Non-canonical | 9680 Mismatch rate per base, % | 0.16% Deletion rate per base | 0.00% Deletion average length | 1.34 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 167846 % of reads mapped to multiple loci | 1.25% Number of reads mapped to too many loci | 19325 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.98% % of reads unmapped: other | 1.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 599392 599392 599392 N_multimapping 167846 167846 167846 N_noFeature 563508 12320603 656574 N_ambiguous 285500 2378 55198 UnstrandedReadsAssigned:11795613 PositiveStrandReadsAssigned:321640 NegativeStrandReadsAssigned:11932849 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6031175 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6031175-trimmed-pair1.fastq SRR6031175-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,404,755 reads, 12,057,452 reads pseudoaligned [quant] estimated average fragment length: 405.596 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52973 SRR6031175.ke.tsv 35125 SRR6031175.se.tsv 88098 total ==> SRR6031175.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 532.173 0 0 PNS24247 1044 639.404 56.1023 11.4079 PNS24249 1928 1523.4 22.0195 1.87928 PNS24246 1044 639.404 56.1023 11.4079 PNS24248 1044 639.404 56.1023 11.4079 PNS24244 1471 1066.4 62.6735 7.64118 PNS24243 293 67.8227 0 0 KQK14069 1603 1198.4 2397.63 260.122 KQK14071 474 143.742 13.5826 12.2856 ==> SRR6031175.se.tsv <== BRADI_1g14170v3 2776 BRADI_1g53295v3 50 BRADI_1g59795v3 470 BRADI_1g07683v3 0 BRADI_1g00485v3 29 BRADI_1g20270v3 839 BRADI_1g74790v3 91 BRADI_1g09890v3 0 BRADI_1g77505v3 169 BRADI_1g48960v3 0 SRR6031175 completed mapping pipeline successfully