Starting /dee2/code/volunteer_pipeline.sh SRR6031176 current disk space = 1523691126784 free memory = 1397589268 SRR6031176 SRAfilesize 5b962694edd3a09cca2a8e851d1ffb94 SRR6031176.sra SRR6031176.sra file validated SRR6031176 is paired end SRR6031176 is conventional basespace SRR6031176 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031176_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.58025 18.0 18.0 25.0 18.0 32.0 2 28.071 29.0 27.0 31.0 25.0 33.0 3 28.23775 29.0 27.0 31.0 25.0 33.0 4 30.30025 31.0 29.0 33.0 27.0 33.0 5 32.236 33.0 32.0 33.0 32.0 33.0 6 36.73575 38.0 37.0 38.0 35.0 38.0 7 37.4575 38.0 38.0 38.0 37.0 38.0 8 37.52025 38.0 38.0 38.0 37.0 38.0 9 37.69775 38.0 38.0 38.0 38.0 38.0 10-14 37.72215 38.0 38.0 38.0 38.0 38.0 15-19 37.781400000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.85295 38.0 38.0 38.0 38.0 38.0 25-29 37.8297 38.0 38.0 38.0 38.0 38.0 30-34 37.8107 38.0 38.0 38.0 38.0 38.0 35-39 37.8254 38.0 38.0 38.0 38.0 38.0 40-44 37.80800000000001 38.0 38.0 38.0 38.0 38.0 45-49 37.7746 38.0 38.0 38.0 38.0 38.0 50-54 37.76155 38.0 38.0 38.0 38.0 38.0 55-59 37.7304 38.0 38.0 38.0 38.0 38.0 60-64 37.727850000000004 38.0 38.0 38.0 38.0 38.0 65-69 37.72355 38.0 38.0 38.0 38.0 38.0 70-74 37.7031 38.0 38.0 38.0 38.0 38.0 75-79 37.69154999999999 38.0 38.0 38.0 38.0 38.0 80-84 37.65085 38.0 38.0 38.0 38.0 38.0 85-89 37.63945 38.0 38.0 38.0 38.0 38.0 90-94 37.6075 38.0 38.0 38.0 38.0 38.0 95-99 37.5455 38.0 38.0 38.0 38.0 38.0 100-104 37.553000000000004 38.0 38.0 38.0 38.0 38.0 105-109 37.50545 38.0 38.0 38.0 38.0 38.0 110-114 37.433499999999995 38.0 38.0 38.0 38.0 38.0 115-119 37.4215 38.0 38.0 38.0 37.8 38.0 120-124 37.3295 38.0 38.0 38.0 37.0 38.0 125-129 37.25855 38.0 38.0 38.0 36.4 38.0 130-134 37.13925 38.0 38.0 38.0 36.0 38.0 135-139 37.147200000000005 38.0 38.0 38.0 36.0 38.0 140-144 36.960300000000004 38.0 38.0 38.0 35.8 38.0 145-149 36.672399999999996 38.0 38.0 38.0 35.0 38.0 150-151 34.951625 38.0 36.0 38.0 30.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 0.0 16 1.0 17 0.0 18 0.0 19 1.0 20 0.0 21 1.0 22 0.0 23 0.0 24 2.0 25 3.0 26 2.0 27 8.0 28 3.0 29 13.0 30 10.0 31 11.0 32 19.0 33 28.0 34 36.0 35 88.0 36 287.0 37 3483.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.68905036331747 12.227511901779001 6.69005261839138 30.39338511651215 2 24.25 13.700000000000001 34.075 27.975 3 19.85 18.975 24.05 37.125 4 21.425 24.25 23.525 30.8 5 25.525 26.35 24.55 23.575 6 23.258145363408524 31.428571428571427 22.506265664160402 22.807017543859647 7 15.675 27.05 38.550000000000004 18.725 8 18.375 27.025 28.875 25.724999999999998 9 19.675 23.3 32.725 24.3 10-14 21.395 28.02 26.340000000000003 24.245 15-19 22.040000000000003 26.66 27.150000000000002 24.15 20-24 22.13 26.865 26.640000000000004 24.365000000000002 25-29 21.834999999999997 27.060000000000002 26.46 24.645 30-34 21.5 27.71 26.619999999999997 24.169999999999998 35-39 21.685 27.255000000000003 26.14 24.92 40-44 21.395 27.83 26.155 24.62 45-49 21.535 27.055 26.705000000000002 24.705 50-54 21.33 26.5 26.779999999999998 25.39 55-59 21.145 26.825 26.810000000000002 25.22 60-64 21.795 26.85 26.790000000000003 24.565 65-69 22.13 26.97 26.235000000000003 24.665 70-74 21.65 27.05 26.345000000000002 24.955 75-79 21.78 26.474999999999998 26.3 25.445 80-84 21.84 26.8 26.825 24.535 85-89 21.595 26.86 26.905 24.64 90-94 21.755 27.155 26.045 25.045 95-99 21.98 26.565 26.325 25.130000000000003 100-104 22.005 26.58 26.540000000000003 24.875 105-109 21.94 26.334999999999997 26.779999999999998 24.945 110-114 21.64 26.715 27.04 24.605 115-119 22.040000000000003 27.284999999999997 26.14 24.535 120-124 21.91 26.900000000000002 26.095000000000002 25.095 125-129 21.825 26.515 27.08 24.58 130-134 22.264999999999997 26.090000000000003 26.31 25.335 135-139 21.91 26.125 26.724999999999998 25.240000000000002 140-144 21.91 25.915 27.015 25.16 145-149 22.470000000000002 26.005 26.424999999999997 25.1 150-151 21.925 25.8 25.912499999999998 26.3625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.5 28 5.0 29 6.5 30 9.5 31 11.5 32 16.0 33 28.5 34 38.0 35 48.5 36 59.5 37 78.5 38 99.5 39 119.5 40 153.0 41 191.0 42 201.0 43 196.0 44 209.0 45 232.5 46 245.5 47 231.0 48 225.5 49 213.0 50 188.0 51 168.0 52 146.0 53 128.0 54 110.5 55 90.0 56 86.0 57 75.5 58 53.5 59 51.0 60 45.0 61 38.5 62 32.5 63 26.5 64 23.0 65 21.5 66 20.5 67 18.0 68 15.5 69 11.5 70 7.5 71 3.5 72 3.5 73 4.5 74 2.5 75 2.0 76 2.0 77 2.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.25 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.2625 0.0 0.0 0.0 0.0 118-119 0.3 0.0 0.0 0.0 0.0 120-121 0.325 0.0 0.0 0.0 0.0 122-123 0.3625 0.0 0.0 0.0 0.0 124-125 0.4 0.0 0.0 0.0 0.0 126-127 0.4125 0.0 0.0 0.0 0.0 128-129 0.4375 0.0 0.0 0.0 0.0 130-131 0.45 0.0 0.0 0.0 0.0 132-133 0.45 0.0 0.0 0.0 0.0 134-135 0.4625 0.0 0.0 0.0 0.0 136-137 0.5125 0.0 0.0 0.0 0.0 138-139 0.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATCAGT 10 0.006585701 146.75949 5 TCGCAAA 10 0.006585701 146.75949 2 >>END_MODULE SRR6031176 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031176_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.26 34.0 33.0 34.0 33.0 34.0 2 33.39025 34.0 33.0 34.0 33.0 34.0 3 33.4395 34.0 33.0 34.0 33.0 34.0 4 33.458 34.0 33.0 34.0 33.0 34.0 5 33.41575 34.0 33.0 34.0 33.0 34.0 6 37.56575 38.0 38.0 38.0 38.0 38.0 7 36.97225 38.0 38.0 38.0 37.0 38.0 8 37.42925 38.0 38.0 38.0 37.0 38.0 9 37.457 38.0 38.0 38.0 38.0 38.0 10-14 37.50505 38.0 38.0 38.0 38.0 38.0 15-19 37.48235 38.0 38.0 38.0 38.0 38.0 20-24 37.357150000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.48499999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.5739 38.0 38.0 38.0 38.0 38.0 35-39 37.5896 38.0 38.0 38.0 38.0 38.0 40-44 37.570800000000006 38.0 38.0 38.0 38.0 38.0 45-49 37.5924 38.0 38.0 38.0 38.0 38.0 50-54 37.557050000000004 38.0 38.0 38.0 38.0 38.0 55-59 37.553399999999996 38.0 38.0 38.0 38.0 38.0 60-64 37.578900000000004 38.0 38.0 38.0 38.0 38.0 65-69 37.5224 38.0 38.0 38.0 38.0 38.0 70-74 37.3243 38.0 38.0 38.0 38.0 38.0 75-79 37.4948 38.0 38.0 38.0 38.0 38.0 80-84 37.48945 38.0 38.0 38.0 38.0 38.0 85-89 37.4007 38.0 38.0 38.0 38.0 38.0 90-94 37.38555 38.0 38.0 38.0 38.0 38.0 95-99 37.36815 38.0 38.0 38.0 38.0 38.0 100-104 37.312200000000004 38.0 38.0 38.0 37.8 38.0 105-109 37.0876 38.0 38.0 38.0 37.2 38.0 110-114 37.04575 38.0 38.0 38.0 37.0 38.0 115-119 36.96765 38.0 38.0 38.0 36.6 38.0 120-124 36.95435 38.0 38.0 38.0 36.0 38.0 125-129 37.04215000000001 38.0 38.0 38.0 36.2 38.0 130-134 36.975899999999996 38.0 38.0 38.0 36.0 38.0 135-139 36.9351 38.0 38.0 38.0 36.0 38.0 140-144 36.735949999999995 38.0 38.0 38.0 35.0 38.0 145-149 36.6515 38.0 38.0 38.0 35.0 38.0 150-151 34.725375 38.0 36.0 38.0 29.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 2.0 12 2.0 13 2.0 14 0.0 15 1.0 16 1.0 17 2.0 18 1.0 19 2.0 20 6.0 21 3.0 22 5.0 23 3.0 24 3.0 25 3.0 26 5.0 27 7.0 28 11.0 29 12.0 30 22.0 31 21.0 32 27.0 33 21.0 34 52.0 35 74.0 36 209.0 37 3495.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.35 22.1 9.35 24.2 2 27.35 29.375 24.975 18.3 3 22.375 28.475 29.375 19.775000000000002 4 25.344008006004504 31.798849136852642 20.79059294470853 22.066549912434326 5 26.063031515757878 33.54177088544272 20.785392696348172 19.609804902451224 6 24.112056028014006 35.942971485742866 20.935467733866933 19.009504752376188 7 23.775 21.725 33.300000000000004 21.2 8 22.96518908089156 25.144002003506138 25.169045830202858 26.72176308539945 9 23.471943887775552 24.799599198396795 27.229458917835668 24.498997995991985 10-14 25.677367656633443 27.35513597435769 24.06971502979917 22.897781339209697 15-19 24.258841234010532 26.917481815901677 24.996237772761475 23.82743917732631 20-24 24.8454385524001 26.63483287258105 25.031414928373962 23.488313646644883 25-29 24.962451186542506 25.85861620106138 25.7034144387704 23.475518173625716 30-34 25.074999999999996 26.115 25.174999999999997 23.635 35-39 25.040000000000003 26.779999999999998 24.945 23.235 40-44 24.935 26.229999999999997 25.095 23.74 45-49 25.395 26.205000000000002 25.119999999999997 23.28 50-54 25.374999999999996 26.015 25.25 23.36 55-59 25.500100020004002 26.255251050210042 25.08001600320064 23.164632926585316 60-64 25.064999999999998 26.605 25.495 22.835 65-69 25.195 26.490000000000002 25.419999999999998 22.895 70-74 25.037624159727102 26.1864151700612 25.443965084779773 23.331995585431926 75-79 25.575 26.14 24.9 23.385 80-84 25.415 26.38 25.825 22.38 85-89 26.029999999999998 26.255 24.560000000000002 23.155 90-94 25.509999999999998 26.555 25.255 22.68 95-99 25.290000000000003 26.55 25.430000000000003 22.73 100-104 25.765 26.125 25.445 22.665 105-109 25.39037003564794 25.79203695335643 25.797057789827786 23.020535221167844 110-114 25.125678664789863 26.653931228634626 25.296601648904083 22.923788457671428 115-119 25.54539057002111 26.00784156026943 25.540363928822764 22.906403940886698 120-124 25.432135878551033 26.59952903452077 25.41710506538404 22.551230021544168 125-129 25.295 26.96 25.335 22.41 130-134 25.635 26.405 25.6 22.36 135-139 25.185000000000002 26.655 25.619999999999997 22.54 140-144 25.169999999999998 26.735 25.52 22.575 145-149 25.185000000000002 26.939999999999998 25.46 22.415 150-151 25.2875 26.35 25.2875 23.075000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 2.0 27 2.0 28 2.0 29 4.0 30 5.0 31 6.5 32 12.0 33 17.0 34 22.0 35 36.0 36 48.0 37 64.0 38 90.5 39 108.5 40 139.5 41 166.0 42 187.5 43 221.0 44 219.0 45 220.0 46 225.5 47 221.0 48 217.5 49 191.0 50 165.5 51 150.0 52 136.5 53 116.0 54 110.0 55 102.0 56 83.0 57 67.0 58 61.0 59 66.0 60 56.0 61 53.0 62 52.5 63 45.5 64 41.0 65 39.5 66 38.0 67 33.5 68 30.5 69 25.0 70 26.5 71 23.5 72 12.5 73 11.0 74 10.0 75 6.0 76 2.5 77 2.0 78 2.5 79 1.0 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.075 5 0.05 6 0.05 7 0.0 8 0.17500000000000002 9 0.2 10-14 0.165 15-19 0.325 20-24 0.525 25-29 0.13 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.02 60-64 0.0 65-69 0.0 70-74 0.33 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.415 110-114 0.54 115-119 0.53 120-124 0.20500000000000002 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.2375 0.0 0.0 0.0 0.0 118-119 0.275 0.0 0.0 0.0 0.0 120-121 0.3 0.0 0.0 0.0 0.0 122-123 0.3375 0.0 0.0 0.0 0.0 124-125 0.375 0.0 0.0 0.0 0.0 126-127 0.3875 0.0 0.0 0.0 0.0 128-129 0.4125 0.0 0.0 0.0 0.0 130-131 0.425 0.0 0.0 0.0 0.0 132-133 0.4375 0.0 0.0 0.0 0.0 134-135 0.4625 0.0 0.0 0.0 0.0 136-137 0.5125 0.0 0.0 0.0 0.0 138-139 0.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 311858 spots for SRR6031176.sra Written 311858 spots for SRR6031176.sra Read 311858 spots for SRR6031176.sra Written 311858 spots for SRR6031176.sra Read 311858 spots for SRR6031176.sra Written 311858 spots for SRR6031176.sra Read 311858 spots for SRR6031176.sra Written 311858 spots for SRR6031176.sra Read 311858 spots for SRR6031176.sra Written 311858 spots for SRR6031176.sra Read 311858 spots for SRR6031176.sra Written 311858 spots for SRR6031176.sra Read 311858 spots for SRR6031176.sra Written 311858 spots for SRR6031176.sra Read 311858 spots for SRR6031176.sra Written 311858 spots for SRR6031176.sra Read 311858 spots for SRR6031176.sra Written 311858 spots for SRR6031176.sra Read 311858 spots for SRR6031176.sra Written 311858 spots for SRR6031176.sra Read 311858 spots for SRR6031176.sra Written 311858 spots for SRR6031176.sra Read 311858 spots for SRR6031176.sra Written 311858 spots for SRR6031176.sra Read 311858 spots for SRR6031176.sra Written 311858 spots for SRR6031176.sra Read 311858 spots for SRR6031176.sra Written 311858 spots for SRR6031176.sra Read 311858 spots for SRR6031176.sra Written 311858 spots for SRR6031176.sra Read 311872 spots for SRR6031176.sra Written 311872 spots for SRR6031176.sra Read 311858 spots for SRR6031176.sra Written 311858 spots for SRR6031176.sra Read 311858 spots for SRR6031176.sra Written 311858 spots for SRR6031176.sra Read 311858 spots for SRR6031176.sra Written 311858 spots for SRR6031176.sra Read 311858 spots for SRR6031176.sra Written 311858 spots for SRR6031176.sra SRR ids: ['SRR6031176.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_750e8qb5 SRR6031176.sra spots: 6237174 blocks: [[1, 311858], [311859, 623716], [623717, 935574], [935575, 1247432], [1247433, 1559290], [1559291, 1871148], [1871149, 2183006], [2183007, 2494864], [2494865, 2806722], [2806723, 3118580], [3118581, 3430438], [3430439, 3742296], [3742297, 4054154], [4054155, 4366012], [4366013, 4677870], [4677871, 4989728], [4989729, 5301586], [5301587, 5613444], [5613445, 5925302], [5925303, 6237174]] SRR6031176 file size 2099222 SRR6031176 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031176 SRR6031176_1.fastq SRR6031176_2.fastq Input file: SRR6031176_1.fastq Paired file: SRR6031176_2.fastq trimmed: SRR6031176-trimmed-pair1.fastq, SRR6031176-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:36:02 2024 >> started Tue Dec 10 00:36:09 2024 >> done (6.856s) 6237174 read pairs processed; of these: 3752 ( 0.06%) short read pairs filtered out after trimming by size control 3914 ( 0.06%) empty read pairs filtered out after trimming by size control 6229508 (99.88%) read pairs available; of these: 1193604 (19.16%) trimmed read pairs available after processing 5035904 (80.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 2 0.00% 21 2 0.00% 22 3 0.00% 23 2 0.00% 24 5 0.00% 25 2 0.00% 26 6 0.00% 27 3 0.00% 28 3 0.00% 29 2 0.00% 30 0 0.00% 31 4 0.00% 32 4 0.00% 33 2 0.00% 34 3 0.00% 35 3 0.00% 36 3 0.00% 37 1 0.00% 38 2 0.00% 39 5 0.00% 40 4 0.00% 41 6 0.00% 42 3 0.00% 43 4 0.00% 44 7 0.00% 45 2 0.00% 46 1 0.00% 47 4 0.00% 48 5 0.00% 49 8 0.00% 50 5 0.00% 51 3 0.00% 52 5 0.00% 53 7 0.00% 54 12 0.00% 55 13 0.00% 56 9 0.00% 57 10 0.00% 58 17 0.00% 59 11 0.00% 60 10 0.00% 61 13 0.00% 62 26 0.00% 63 21 0.00% 64 22 0.00% 65 20 0.00% 66 31 0.00% 67 29 0.00% 68 26 0.00% 69 36 0.00% 70 27 0.00% 71 40 0.00% 72 45 0.00% 73 54 0.00% 74 65 0.00% 75 57 0.00% 76 84 0.00% 77 94 0.00% 78 97 0.00% 79 90 0.00% 80 140 0.00% 81 121 0.00% 82 162 0.00% 83 149 0.00% 84 312 0.01% 85 443 0.01% 86 442 0.01% 87 557 0.01% 88 633 0.01% 89 771 0.01% 90 771 0.01% 91 722 0.01% 92 672 0.01% 93 712 0.01% 94 710 0.01% 95 689 0.01% 96 599 0.01% 97 664 0.01% 98 722 0.01% 99 653 0.01% 100 756 0.01% 101 780 0.01% 102 866 0.01% 103 864 0.01% 104 818 0.01% 105 909 0.01% 106 969 0.02% 107 951 0.02% 108 1094 0.02% 109 1112 0.02% 110 1175 0.02% 111 1316 0.02% 112 1266 0.02% 113 1496 0.02% 114 1832 0.03% 115 2173 0.03% 116 2403 0.04% 117 2349 0.04% 118 1924 0.03% 119 1816 0.03% 120 1932 0.03% 121 2176 0.03% 122 2337 0.04% 123 2443 0.04% 124 2480 0.04% 125 2503 0.04% 126 2681 0.04% 127 2666 0.04% 128 2740 0.04% 129 2912 0.05% 130 3026 0.05% 131 3250 0.05% 132 3489 0.06% 133 3602 0.06% 134 3907 0.06% 135 4305 0.07% 136 4573 0.07% 137 4854 0.08% 138 5403 0.09% 139 5928 0.10% 140 6348 0.10% 141 7253 0.12% 142 8126 0.13% 143 9168 0.15% 144 11088 0.18% 145 14018 0.23% 146 17827 0.29% 147 25152 0.40% 148 41568 0.67% 149 92366 1.48% 150 854885 13.72% 151 5035904 80.84% 6229508 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=10.39 fanout-score-rank=12 prefix-density=0.41 prefix-fanout=5.4 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=98.22 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=10.4 sequence=TTTCCAGAATTCAAGACGTTAACAGTTCTTGGCGCAAATAGCGCTGAATCGCTTCTTTAAAGGCTGCAGCGTCGTCCTCAAATTTCGCACTGACCATAATGTGATCCCTTCCGGCGGTCGGTATAAAATCAGGCAGTTTTTGATCACGTTTATTGTAAGCCGTCAGCATCGGGATATCATCTGCTTCA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=4.54 fanout-score-rank=24 prefix-density=0.29 prefix-fanout=3.7 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=130.76 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=9.9 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTT SRR6031176 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:37:03 Started mapping on | Dec 10 00:37:03 Finished on | Dec 10 00:38:16 Mapping speed, Million of reads per hour | 307.21 Number of input reads | 6229508 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 5927839 Uniquely mapped reads % | 95.16% Average mapped length | 300.29 Number of splices: Total | 6861843 Number of splices: Annotated (sjdb) | 6523127 Number of splices: GT/AG | 6775692 Number of splices: GC/AG | 78374 Number of splices: AT/AC | 4026 Number of splices: Non-canonical | 3751 Mismatch rate per base, % | 0.06% Deletion rate per base | 0.00% Deletion average length | 1.35 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 58637 % of reads mapped to multiple loci | 0.94% Number of reads mapped to too many loci | 1494 % of reads mapped to too many loci | 0.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.71% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 246105 246105 246105 N_multimapping 58637 58637 58637 N_noFeature 174564 5764865 210629 N_ambiguous 150512 1233 24052 UnstrandedReadsAssigned:5602763 PositiveStrandReadsAssigned:161741 NegativeStrandReadsAssigned:5693158 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6031176 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6031176-trimmed-pair1.fastq SRR6031176-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,229,508 reads, 5,712,934 reads pseudoaligned [quant] estimated average fragment length: 439.761 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52973 SRR6031176.ke.tsv 35125 SRR6031176.se.tsv 88098 total ==> SRR6031176.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 498.841 0 0 PNS24247 1044 605.239 38.7953 15.2815 PNS24249 1928 1489.24 11.2441 1.80002 PNS24246 1044 605.239 38.7953 15.2815 PNS24248 1044 605.239 38.7953 15.2815 PNS24244 1471 1032.24 15.3699 3.5498 PNS24243 293 61.3507 0 0 KQK14069 1603 1164.24 1308.13 267.869 KQK14071 474 127.876 4.75786 8.87029 ==> SRR6031176.se.tsv <== BRADI_1g14170v3 1490 BRADI_1g53295v3 36 BRADI_1g59795v3 185 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 357 BRADI_1g74790v3 57 BRADI_1g09890v3 0 BRADI_1g77505v3 92 BRADI_1g48960v3 0 SRR6031176 completed mapping pipeline successfully