Starting /dee2/code/volunteer_pipeline.sh SRR6031177 current disk space = 1515130761216 free memory = 1605021580 SRR6031177 SRAfilesize a8bc2f333eb1b9cee452153f2db99fd2 SRR6031177.sra SRR6031177.sra file validated SRR6031177 is paired end SRR6031177 is conventional basespace SRR6031177 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031177_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.3475 28.0 18.0 33.0 18.0 33.0 2 29.45825 32.0 27.0 33.0 18.0 33.0 3 31.43925 33.0 31.0 33.0 29.0 33.0 4 32.0135 33.0 32.0 33.0 31.0 33.0 5 32.60475 33.0 33.0 33.0 32.0 33.0 6 37.36125 38.0 38.0 38.0 36.0 38.0 7 37.6615 38.0 38.0 38.0 37.0 38.0 8 37.7875 38.0 38.0 38.0 38.0 38.0 9 37.752 38.0 38.0 38.0 38.0 38.0 10-14 37.81230000000001 38.0 38.0 38.0 38.0 38.0 15-19 37.82995 38.0 38.0 38.0 38.0 38.0 20-24 37.83454999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.81375 38.0 38.0 38.0 38.0 38.0 30-34 37.791700000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.80615 38.0 38.0 38.0 38.0 38.0 40-44 37.76485 38.0 38.0 38.0 38.0 38.0 45-49 37.72165 38.0 38.0 38.0 38.0 38.0 50-54 37.69584999999999 38.0 38.0 38.0 38.0 38.0 55-59 37.64215 38.0 38.0 38.0 38.0 38.0 60-64 37.67145 38.0 38.0 38.0 38.0 38.0 65-69 37.6443 38.0 38.0 38.0 38.0 38.0 70-74 37.58885 38.0 38.0 38.0 38.0 38.0 75-79 37.5375 38.0 38.0 38.0 38.0 38.0 80-84 37.51415 38.0 38.0 38.0 38.0 38.0 85-89 37.47285000000001 38.0 38.0 38.0 37.8 38.0 90-94 37.47265 38.0 38.0 38.0 37.6 38.0 95-99 37.38415 38.0 38.0 38.0 37.0 38.0 100-104 37.3351 38.0 38.0 38.0 37.0 38.0 105-109 37.2383 38.0 38.0 38.0 36.6 38.0 110-114 37.17479999999999 38.0 38.0 38.0 36.4 38.0 115-119 37.06075 38.0 38.0 38.0 36.0 38.0 120-124 36.966449999999995 38.0 38.0 38.0 35.6 38.0 125-129 36.8394 38.0 38.0 38.0 35.0 38.0 130-134 36.81375 38.0 38.0 38.0 35.0 38.0 135-139 36.572649999999996 38.0 38.0 38.0 34.4 38.0 140-144 36.394949999999994 38.0 38.0 38.0 34.0 38.0 145-149 36.05715 38.0 38.0 38.0 33.2 38.0 150-151 33.435 37.0 34.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 2.0 16 0.0 17 1.0 18 0.0 19 1.0 20 2.0 21 1.0 22 1.0 23 2.0 24 1.0 25 4.0 26 4.0 27 7.0 28 5.0 29 9.0 30 12.0 31 22.0 32 24.0 33 37.0 34 69.0 35 120.0 36 440.0 37 3234.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.81909547738693 12.864321608040202 10.075376884422111 33.24120603015076 2 21.85 15.375 33.35 29.425 3 19.650000000000002 19.900000000000002 27.750000000000004 32.7 4 23.35 23.974999999999998 24.175 28.499999999999996 5 23.75 28.675 24.25 23.325000000000003 6 22.2 32.25 24.9 20.65 7 16.775000000000002 24.875 39.75 18.6 8 19.2 25.924999999999997 28.075 26.8 9 17.299999999999997 24.025 33.5 25.174999999999997 10-14 20.925 27.935 27.49 23.65 15-19 20.385 26.779999999999998 28.194999999999997 24.64 20-24 21.02 26.915 27.32 24.745 25-29 20.34 27.389999999999997 27.900000000000002 24.37 30-34 20.805 27.18 27.71 24.305 35-39 21.88 26.72 27.165 24.235 40-44 21.09 27.345000000000002 27.3 24.265 45-49 21.105 26.66 27.71 24.525 50-54 20.599999999999998 27.029999999999998 27.355 25.014999999999997 55-59 21.14 26.924999999999997 27.73 24.205 60-64 21.315 26.840000000000003 27.555000000000003 24.29 65-69 20.580000000000002 26.924999999999997 27.76 24.735 70-74 21.45 27.284999999999997 27.07 24.195 75-79 20.815 27.365000000000002 27.22 24.6 80-84 21.465 27.495000000000005 26.784999999999997 24.255 85-89 21.8 26.495 27.43 24.275 90-94 20.685000000000002 27.839999999999996 27.185 24.29 95-99 21.625 26.595000000000002 27.29 24.490000000000002 100-104 21.47 27.12 27.065 24.345 105-109 21.625 26.465 27.41 24.5 110-114 20.995 27.095000000000002 27.650000000000002 24.26 115-119 21.055 26.919999999999998 27.435 24.59 120-124 20.9 27.245 26.99 24.865000000000002 125-129 21.55 26.795 27.134999999999998 24.52 130-134 21.615000000000002 26.5 27.544999999999998 24.34 135-139 21.51 26.584999999999997 27.515 24.39 140-144 21.77 27.265 26.935 24.03 145-149 21.465 26.805 27.08 24.65 150-151 21.425 27.462500000000002 26.2125 24.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 1.0 25 1.5 26 1.5 27 2.5 28 5.5 29 9.0 30 15.0 31 23.5 32 30.5 33 38.0 34 50.5 35 64.0 36 65.0 37 85.5 38 121.5 39 147.5 40 176.0 41 207.5 42 209.0 43 213.5 44 234.0 45 238.5 46 240.0 47 219.0 48 192.5 49 175.5 50 174.0 51 153.5 52 125.0 53 118.5 54 101.5 55 90.5 56 86.5 57 72.0 58 56.0 59 48.0 60 39.0 61 27.5 62 25.5 63 20.0 64 12.0 65 15.5 66 15.5 67 11.0 68 8.0 69 7.5 70 6.5 71 4.0 72 3.5 73 3.0 74 2.0 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01490275322051 98.0 2 0.9345794392523363 1.8499999999999999 3 0.050517807527153326 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.2 0.0 0.0 0.0 0.0 120-121 0.225 0.0 0.0 0.0 0.0 122-123 0.2875 0.0 0.0 0.0 0.0 124-125 0.3375 0.0 0.0 0.0 0.0 126-127 0.4 0.0 0.0 0.0 0.0 128-129 0.4 0.0 0.0 0.0 0.0 130-131 0.4 0.0 0.0 0.0 0.0 132-133 0.45 0.0 0.0 0.0 0.0 134-135 0.525 0.0 0.0 0.0 0.0 136-137 0.55 0.0 0.0 0.0 0.0 138-139 0.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6031177 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031177_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.457 34.0 33.0 34.0 33.0 34.0 2 32.621 34.0 33.0 34.0 33.0 34.0 3 32.721 34.0 33.0 34.0 33.0 34.0 4 32.669 34.0 33.0 34.0 33.0 34.0 5 32.739 34.0 33.0 34.0 33.0 34.0 6 36.5855 38.0 38.0 38.0 38.0 38.0 7 36.64575 38.0 38.0 38.0 38.0 38.0 8 36.61775 38.0 38.0 38.0 38.0 38.0 9 36.6915 38.0 38.0 38.0 38.0 38.0 10-14 36.6125 38.0 38.0 38.0 37.6 38.0 15-19 36.486599999999996 38.0 38.0 38.0 37.2 38.0 20-24 36.4872 38.0 38.0 38.0 37.0 38.0 25-29 36.521 38.0 38.0 38.0 37.4 38.0 30-34 36.79 38.0 38.0 38.0 37.8 38.0 35-39 36.84335 38.0 38.0 38.0 38.0 38.0 40-44 36.867599999999996 38.0 38.0 38.0 38.0 38.0 45-49 36.888600000000004 38.0 38.0 38.0 38.0 38.0 50-54 36.76415 38.0 38.0 38.0 37.6 38.0 55-59 36.60025 38.0 38.0 38.0 37.2 38.0 60-64 36.6188 38.0 38.0 38.0 37.0 38.0 65-69 36.5546 38.0 38.0 38.0 37.0 38.0 70-74 36.35485 38.0 38.0 38.0 36.6 38.0 75-79 36.47925 38.0 38.0 38.0 36.8 38.0 80-84 36.70115 38.0 38.0 38.0 37.0 38.0 85-89 36.6577 38.0 38.0 38.0 36.6 38.0 90-94 36.6315 38.0 38.0 38.0 36.8 38.0 95-99 36.546749999999996 38.0 38.0 38.0 36.0 38.0 100-104 36.40675 38.0 38.0 38.0 36.0 38.0 105-109 36.17155 38.0 38.0 38.0 35.0 38.0 110-114 36.10305 38.0 38.0 38.0 35.0 38.0 115-119 35.932100000000005 38.0 38.0 38.0 34.6 38.0 120-124 35.868249999999996 38.0 38.0 38.0 34.0 38.0 125-129 36.06625 38.0 38.0 38.0 34.2 38.0 130-134 36.048750000000005 38.0 38.0 38.0 34.2 38.0 135-139 35.9117 38.0 38.0 38.0 34.0 38.0 140-144 35.7676 38.0 38.0 38.0 33.4 38.0 145-149 35.44415 38.0 38.0 38.0 32.6 38.0 150-151 32.545625 37.0 34.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 74.0 3 1.0 4 0.0 5 2.0 6 1.0 7 0.0 8 1.0 9 3.0 10 0.0 11 1.0 12 1.0 13 0.0 14 2.0 15 3.0 16 4.0 17 2.0 18 8.0 19 4.0 20 1.0 21 6.0 22 8.0 23 7.0 24 13.0 25 6.0 26 11.0 27 8.0 28 12.0 29 8.0 30 24.0 31 23.0 32 34.0 33 40.0 34 75.0 35 112.0 36 286.0 37 3219.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.24640657084189 21.79158110882957 13.783367556468173 24.17864476386037 2 28.56047046791102 28.151367936589107 26.029148555356684 17.259013040143188 3 21.092951991828397 30.515832482124615 28.804902962206334 19.586312563840654 4 24.641760491299898 32.62538382804504 22.28761514841351 20.445240532241556 5 26.42328312484044 33.52055144243043 22.415113607352566 17.641051825376564 6 23.627501282709083 36.50590046177527 20.60030785017958 19.26629040533607 7 21.709006928406467 22.042596869386706 35.026943802925324 21.2214523992815 8 23.6983842010772 24.980764298538087 24.775583482944345 26.54526801744037 9 24.20675537359263 23.56704196519959 28.556806550665303 23.669396110542475 10-14 25.25900092317161 27.13098779361986 25.335931890450304 22.27407939275823 15-19 25.079691516709513 26.58611825192802 26.128534704370182 22.205655526992288 20-24 24.72372140837831 27.05217167823182 25.803135440760727 22.420971472629144 25-29 24.47889927097238 26.691652120340898 26.132046411335867 22.697402197350858 30-34 24.706961573743758 26.88818672918153 26.08806441749057 22.31678727958414 35-39 25.072471138686875 27.13217718557697 25.718354269440063 22.07699740629609 40-44 24.711797267787315 26.859986795998168 25.4888019907572 22.939413945457314 45-49 24.917600527356626 27.001673343136755 26.327265351655594 21.75346077785102 50-54 24.546516945277173 27.000660535541893 26.512880443066916 21.93994207611402 55-59 24.81437861641661 27.09816170822879 25.879461313943363 22.207998361411235 60-64 24.780298385448603 26.680972818311876 26.430615164520745 22.10811363171878 65-69 24.384627194104702 26.800061409344455 27.22992682053119 21.58538457601965 70-74 24.73543614507346 27.185862529538685 26.0145895407377 22.06411178465016 75-79 24.818451467730387 27.20159558146671 26.49074358187583 21.489209368927074 80-84 24.309532255612424 27.193026909238334 26.12881974357675 22.368621091572493 85-89 25.242865816636307 27.534911961141468 25.556567496458204 21.665654725764018 90-94 24.51104260372972 27.320968312528425 26.476979835245363 21.69100924849649 95-99 25.268762677484784 27.150101419878297 25.54766734279919 22.03346855983773 100-104 24.97448458869157 27.41886099203919 26.57685241886099 21.029802000408246 105-109 25.043585273305304 26.797251563942158 26.217823812942264 21.941339349810278 110-114 24.383603862749126 27.804602424491478 26.06328333675776 21.748510376001644 115-119 24.74916387959866 27.620272703884748 26.05608438384358 21.574479032673015 120-124 24.536040192761202 26.966061724597562 26.545678252845278 21.95221982979596 125-129 23.977203338082635 28.08365560757175 26.368817423163037 21.57032363118258 130-134 24.934103811841037 27.671330089213303 25.881995133819952 21.51257096512571 135-139 24.690734662963898 27.528401918707395 26.06412522090381 21.716738197424892 140-144 24.654424376954896 27.383715064070223 26.077086065987288 21.884774492987592 145-149 25.07672955974843 26.96352201257862 25.99245283018868 21.967295597484277 150-151 26.046157747907685 26.211006847577988 26.515343646969313 21.227491757545017 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 37.0 1 19.0 2 2.0 3 2.5 4 2.5 5 2.5 6 2.5 7 2.0 8 2.0 9 3.0 10 3.0 11 2.5 12 2.0 13 2.0 14 1.0 15 0.5 16 1.5 17 2.0 18 1.0 19 3.0 20 5.0 21 4.0 22 3.5 23 3.0 24 2.0 25 4.5 26 6.0 27 3.0 28 2.5 29 7.5 30 13.5 31 19.5 32 20.5 33 25.5 34 43.0 35 54.0 36 58.0 37 87.5 38 128.0 39 138.0 40 153.5 41 190.5 42 209.5 43 207.0 44 216.5 45 237.5 46 219.0 47 193.5 48 177.5 49 149.5 50 139.0 51 144.0 52 126.0 53 109.5 54 109.5 55 98.0 56 75.0 57 53.0 58 59.5 59 54.5 60 40.5 61 40.0 62 38.5 63 40.5 64 36.0 65 26.5 66 27.5 67 29.5 68 25.5 69 18.5 70 11.0 71 9.5 72 8.5 73 8.5 74 7.5 75 4.0 76 2.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.6 2 2.225 3 2.1 4 2.3 5 2.075 6 2.55 7 2.5749999999999997 8 2.5250000000000004 9 2.3 10-14 2.5100000000000002 15-19 2.75 20-24 2.725 25-29 2.6100000000000003 30-34 1.8900000000000001 35-39 1.685 40-44 1.545 45-49 1.395 50-54 1.595 55-59 2.355 60-64 2.1399999999999997 65-69 2.2950000000000004 70-74 2.67 75-79 2.23 80-84 1.335 85-89 1.18 90-94 1.065 95-99 1.4000000000000001 100-104 2.02 105-109 2.4899999999999998 110-114 2.6599999999999997 115-119 2.825 120-124 2.4699999999999998 125-129 1.7399999999999998 130-134 1.3599999999999999 135-139 0.975 140-144 0.89 145-149 0.625 150-151 1.425 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.55 #Duplication Level Percentage of deduplicated Percentage of total 1 98.66735007688365 96.25 2 1.2301383905689391 2.4 3 0.05125576627370579 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025627883136852894 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025627883136852894 1.05 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 42 1.05 No Hit GGCTTGCGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGCAAG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.2 0.0 0.0 0.0 0.0 120-121 0.225 0.0 0.0 0.0 0.0 122-123 0.2875 0.0 0.0 0.0 0.0 124-125 0.3375 0.0 0.0 0.0 0.0 126-127 0.4 0.0 0.0 0.0 0.0 128-129 0.4 0.0 0.0 0.0 0.0 130-131 0.4 0.0 0.0 0.0 0.0 132-133 0.45 0.0 0.0 0.0 0.0 134-135 0.525 0.0 0.0 0.0 0.0 136-137 0.55 0.0 0.0 0.0 0.0 138-139 0.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGAGG 10 0.0067462213 145.58228 5 >>END_MODULE Read 748811 spots for SRR6031177.sra Written 748811 spots for SRR6031177.sra Read 748811 spots for SRR6031177.sra Written 748811 spots for SRR6031177.sra Read 748811 spots for SRR6031177.sra Written 748811 spots for SRR6031177.sra Read 748811 spots for SRR6031177.sra Written 748811 spots for SRR6031177.sra Read 748811 spots for SRR6031177.sra Written 748811 spots for SRR6031177.sra Read 748811 spots for SRR6031177.sra Written 748811 spots for SRR6031177.sra Read 748811 spots for SRR6031177.sra Written 748811 spots for SRR6031177.sra Read 748811 spots for SRR6031177.sra Written 748811 spots for SRR6031177.sra Read 748811 spots for SRR6031177.sra Written 748811 spots for SRR6031177.sra Read 748811 spots for SRR6031177.sra Written 748811 spots for SRR6031177.sra Read 748811 spots for SRR6031177.sra Written 748811 spots for SRR6031177.sra Read 748811 spots for SRR6031177.sra Written 748811 spots for SRR6031177.sra Read 748811 spots for SRR6031177.sra Written 748811 spots for SRR6031177.sra Read 748811 spots for SRR6031177.sra Written 748811 spots for SRR6031177.sra Read 748811 spots for SRR6031177.sra Written 748811 spots for SRR6031177.sra Read 748811 spots for SRR6031177.sra Written 748811 spots for SRR6031177.sra Read 748811 spots for SRR6031177.sra Written 748811 spots for SRR6031177.sra Read 748813 spots for SRR6031177.sra Written 748813 spots for SRR6031177.sra Read 748811 spots for SRR6031177.sra Written 748811 spots for SRR6031177.sra Read 748811 spots for SRR6031177.sra Written 748811 spots for SRR6031177.sra SRR ids: ['SRR6031177.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qk4l1sxp SRR6031177.sra spots: 14976222 blocks: [[1, 748811], [748812, 1497622], [1497623, 2246433], [2246434, 2995244], [2995245, 3744055], [3744056, 4492866], [4492867, 5241677], [5241678, 5990488], [5990489, 6739299], [6739300, 7488110], [7488111, 8236921], [8236922, 8985732], [8985733, 9734543], [9734544, 10483354], [10483355, 11232165], [11232166, 11980976], [11980977, 12729787], [12729788, 13478598], [13478599, 14227409], [14227410, 14976222]] SRR6031177 file size 5053249 SRR6031177 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031177 SRR6031177_1.fastq SRR6031177_2.fastq Input file: SRR6031177_1.fastq Paired file: SRR6031177_2.fastq trimmed: SRR6031177-trimmed-pair1.fastq, SRR6031177-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 03:20:54 2024 >> started Thu Dec 12 03:21:11 2024 >> done (17.176s) 14976222 read pairs processed; of these: 10387 ( 0.07%) short read pairs filtered out after trimming by size control 21007 ( 0.14%) empty read pairs filtered out after trimming by size control 14944828 (99.79%) read pairs available; of these: 4148175 (27.76%) trimmed read pairs available after processing 10796653 (72.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 3 0.00% 21 5 0.00% 22 7 0.00% 23 6 0.00% 24 7 0.00% 25 8 0.00% 26 8 0.00% 27 6 0.00% 28 7 0.00% 29 7 0.00% 30 7 0.00% 31 11 0.00% 32 7 0.00% 33 8 0.00% 34 9 0.00% 35 5 0.00% 36 3 0.00% 37 6 0.00% 38 6 0.00% 39 7 0.00% 40 10 0.00% 41 6 0.00% 42 8 0.00% 43 6 0.00% 44 10 0.00% 45 5 0.00% 46 9 0.00% 47 7 0.00% 48 10 0.00% 49 10 0.00% 50 25 0.00% 51 24 0.00% 52 19 0.00% 53 21 0.00% 54 23 0.00% 55 22 0.00% 56 25 0.00% 57 22 0.00% 58 29 0.00% 59 29 0.00% 60 33 0.00% 61 36 0.00% 62 43 0.00% 63 41 0.00% 64 46 0.00% 65 59 0.00% 66 62 0.00% 67 63 0.00% 68 61 0.00% 69 76 0.00% 70 98 0.00% 71 80 0.00% 72 109 0.00% 73 138 0.00% 74 132 0.00% 75 145 0.00% 76 170 0.00% 77 204 0.00% 78 214 0.00% 79 238 0.00% 80 249 0.00% 81 247 0.00% 82 306 0.00% 83 394 0.00% 84 784 0.01% 85 1155 0.01% 86 1191 0.01% 87 1347 0.01% 88 1456 0.01% 89 1569 0.01% 90 1628 0.01% 91 1472 0.01% 92 1391 0.01% 93 1415 0.01% 94 1521 0.01% 95 1447 0.01% 96 1469 0.01% 97 1538 0.01% 98 1563 0.01% 99 1658 0.01% 100 1557 0.01% 101 1801 0.01% 102 1812 0.01% 103 1969 0.01% 104 2094 0.01% 105 2240 0.01% 106 2383 0.02% 107 2373 0.02% 108 2581 0.02% 109 2776 0.02% 110 3013 0.02% 111 3199 0.02% 112 3505 0.02% 113 3922 0.03% 114 4703 0.03% 115 5268 0.04% 116 5456 0.04% 117 5184 0.03% 118 4685 0.03% 119 4409 0.03% 120 4744 0.03% 121 4937 0.03% 122 5190 0.03% 123 5443 0.04% 124 5880 0.04% 125 6285 0.04% 126 6475 0.04% 127 6864 0.05% 128 7416 0.05% 129 7673 0.05% 130 8262 0.06% 131 8938 0.06% 132 9613 0.06% 133 10537 0.07% 134 11614 0.08% 135 12014 0.08% 136 13336 0.09% 137 14388 0.10% 138 15997 0.11% 139 17760 0.12% 140 19959 0.13% 141 22752 0.15% 142 25422 0.17% 143 29812 0.20% 144 38642 0.26% 145 53618 0.36% 146 87949 0.59% 147 95497 0.64% 148 172390 1.15% 149 411329 2.75% 150 2916199 19.51% 151 10796653 72.24% 14944828 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=0.26 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=191.57 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=12.4 sequence=CTTCCTTGACCTTCCGGCACTGGGCAGGCGTCAGCCCCCATACATGGTCTTACGACTTTGCGGAGACCTGTGTTTTTGGTAAACAGTCGCCCGGGCCTGGTCACTGCGACCCCCTTTTGTGAGGGGGCACCCCTTCTCCCGAAGTTACGGGGCTATTTTGCCGAGTTCCTTAGAGAGAGTTGTCTCGCGCCCCTAGGTATTCTCTACCTACCCACCTGTGTCGGTTTCGGGTACAGGTACCCTTTTGTTGAAGGTCGTTCGAGCTTTTCCTGGGAGTATGGCATCGGTTACATACTTCAGTGCCGTAGCGCCTGGTATGAGCCTCGTGGAGAAGCAATCGCTAGTCCACGGGGCTCATACTTCAGCGCTGCAGCGCTTGGTACTCGGACCTCGGCTCGAGGCATTTTCTCTACCCCTTCTTACCCTGAAAAAGCAGGGTCACCTTGTGTCCTTAAACCTATAACCATCTTTCGGCTAACCTAGCCTCCTCCGTCCCTCCGTACCAACAAGG criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=31 prefix-density=0.41 prefix-fanout=2.2 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=164.28 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=14.6 sequence=CCGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR6031177 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 03:21:52 Started mapping on | Dec 12 03:21:53 Finished on | Dec 12 03:23:57 Mapping speed, Million of reads per hour | 433.88 Number of input reads | 14944828 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 13515240 Uniquely mapped reads % | 90.43% Average mapped length | 299.68 Number of splices: Total | 14896815 Number of splices: Annotated (sjdb) | 14190752 Number of splices: GT/AG | 14707650 Number of splices: GC/AG | 167671 Number of splices: AT/AC | 9040 Number of splices: Non-canonical | 12454 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 495257 % of reads mapped to multiple loci | 3.31% Number of reads mapped to too many loci | 37419 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.72% % of reads unmapped: other | 2.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 941809 941809 941809 N_multimapping 495257 495257 495257 N_noFeature 957861 13142265 1060492 N_ambiguous 369071 4002 106266 UnstrandedReadsAssigned:12188308 PositiveStrandReadsAssigned:368973 NegativeStrandReadsAssigned:12348482 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6031177 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6031177-trimmed-pair1.fastq SRR6031177-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,944,828 reads, 12,750,448 reads pseudoaligned [quant] estimated average fragment length: 456.103 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52973 SRR6031177.ke.tsv 35125 SRR6031177.se.tsv 88098 total ==> SRR6031177.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 482.353 0 0 PNS24247 1044 588.897 65.0417 12.4426 PNS24249 1928 1472.9 18.6565 1.42697 PNS24246 1044 588.897 65.0417 12.4426 PNS24248 1044 588.897 65.0417 12.4426 PNS24244 1471 1015.9 35.2183 3.9055 PNS24243 293 59.3123 0 0 KQK14069 1603 1147.9 3759.57 368.972 KQK14071 474 119.84 12.3518 11.6114 ==> SRR6031177.se.tsv <== BRADI_1g14170v3 4078 BRADI_1g53295v3 58 BRADI_1g59795v3 572 BRADI_1g07683v3 0 BRADI_1g00485v3 27 BRADI_1g20270v3 734 BRADI_1g74790v3 60 BRADI_1g09890v3 0 BRADI_1g77505v3 180 BRADI_1g48960v3 0 SRR6031177 completed mapping pipeline successfully