Starting /dee2/code/volunteer_pipeline.sh SRR6031178 current disk space = 1515120160768 free memory = 1588651812 SRR6031178 SRAfilesize d254d06ca0ba4e9251c8cab0d6bea2e4 SRR6031178.sra SRR6031178.sra file validated SRR6031178 is paired end SRR6031178 is conventional basespace SRR6031178 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031178_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.026 32.0 25.0 33.0 18.0 34.0 2 32.03725 33.0 32.0 33.0 30.0 34.0 3 32.82225 33.0 33.0 33.0 31.0 34.0 4 33.26925 33.0 33.0 34.0 33.0 34.0 5 33.517 34.0 33.0 34.0 33.0 34.0 6 37.60975 38.0 38.0 38.0 37.0 38.0 7 37.8135 38.0 38.0 38.0 38.0 38.0 8 37.821 38.0 38.0 38.0 38.0 38.0 9 37.8125 38.0 38.0 38.0 38.0 38.0 10-14 37.8686 38.0 38.0 38.0 38.0 38.0 15-19 37.84335 38.0 38.0 38.0 38.0 38.0 20-24 37.8337 38.0 38.0 38.0 38.0 38.0 25-29 37.81495 38.0 38.0 38.0 38.0 38.0 30-34 37.818599999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.81755 38.0 38.0 38.0 38.0 38.0 40-44 37.780499999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.75320000000001 38.0 38.0 38.0 38.0 38.0 50-54 37.69840000000001 38.0 38.0 38.0 38.0 38.0 55-59 37.67355 38.0 38.0 38.0 38.0 38.0 60-64 37.6654 38.0 38.0 38.0 38.0 38.0 65-69 37.65145 38.0 38.0 38.0 38.0 38.0 70-74 37.62665 38.0 38.0 38.0 38.0 38.0 75-79 37.5543 38.0 38.0 38.0 38.0 38.0 80-84 37.5642 38.0 38.0 38.0 38.0 38.0 85-89 37.5263 38.0 38.0 38.0 37.8 38.0 90-94 37.49305 38.0 38.0 38.0 37.6 38.0 95-99 37.4229 38.0 38.0 38.0 37.0 38.0 100-104 37.4166 38.0 38.0 38.0 37.0 38.0 105-109 37.3196 38.0 38.0 38.0 37.0 38.0 110-114 37.26535 38.0 38.0 38.0 36.4 38.0 115-119 37.21125000000001 38.0 38.0 38.0 36.0 38.0 120-124 37.02375000000001 38.0 38.0 38.0 35.8 38.0 125-129 36.952549999999995 38.0 38.0 38.0 35.4 38.0 130-134 36.8788 38.0 38.0 38.0 35.0 38.0 135-139 36.735850000000006 38.0 38.0 38.0 35.0 38.0 140-144 36.54559999999999 38.0 38.0 38.0 34.8 38.0 145-149 36.20725 38.0 38.0 38.0 34.0 38.0 150-151 33.550875000000005 37.0 34.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 1.0 20 2.0 21 0.0 22 3.0 23 0.0 24 5.0 25 2.0 26 3.0 27 3.0 28 9.0 29 10.0 30 12.0 31 22.0 32 21.0 33 32.0 34 54.0 35 99.0 36 350.0 37 3370.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.021319287684975 15.249561073488838 9.907198394783045 29.821921244043143 2 22.55 16.075 35.55 25.825 3 17.95 23.400000000000002 27.725 30.925000000000004 4 22.6 27.0 24.25 26.150000000000002 5 22.525000000000002 31.75 24.224999999999998 21.5 6 23.425 32.2 24.4 19.975 7 16.05 24.625 39.975 19.35 8 19.05 24.2 27.975 28.775000000000002 9 20.325 23.200000000000003 31.175000000000004 25.3 10-14 21.17 27.76 26.77 24.3 15-19 21.154999999999998 26.85 27.355 24.64 20-24 21.545 27.435 26.655 24.365000000000002 25-29 21.535 27.189999999999998 27.155 24.12 30-34 21.795 26.400000000000002 27.275 24.529999999999998 35-39 21.245 27.595 26.575 24.585 40-44 21.095 27.195000000000004 27.51 24.2 45-49 21.61 27.725 26.875 23.79 50-54 20.955 27.1 27.339999999999996 24.605 55-59 21.78 27.16 26.965 24.095 60-64 21.675 27.029999999999998 26.6 24.695 65-69 21.45 27.26 27.169999999999998 24.12 70-74 22.025 27.565 26.834999999999997 23.575 75-79 21.445 27.105 26.705000000000002 24.745 80-84 20.96 26.889999999999997 27.965 24.185000000000002 85-89 21.465 26.97 26.93 24.635 90-94 21.055 27.58 26.71 24.654999999999998 95-99 21.825 27.37 26.85 23.955000000000002 100-104 21.59 27.275 26.85 24.285 105-109 21.665 26.784999999999997 27.685 23.865 110-114 21.495 27.015 27.705000000000002 23.785 115-119 21.565 26.655 27.565 24.215 120-124 21.105 26.83 27.425 24.64 125-129 21.475 26.735 27.18 24.610000000000003 130-134 21.545 27.279999999999998 27.055 24.12 135-139 21.335 26.77 27.66 24.235 140-144 21.884999999999998 25.974999999999998 27.389999999999997 24.75 145-149 21.97 26.865 26.76 24.404999999999998 150-151 22.15 27.375 26.4125 24.0625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 1.5 23 2.5 24 2.0 25 4.0 26 4.0 27 3.5 28 2.5 29 6.0 30 13.0 31 19.0 32 23.0 33 35.0 34 46.0 35 56.0 36 76.0 37 103.5 38 122.5 39 139.0 40 175.5 41 198.0 42 213.0 43 232.0 44 237.0 45 227.5 46 210.5 47 202.5 48 200.5 49 181.0 50 153.5 51 147.5 52 144.0 53 124.0 54 110.0 55 98.0 56 83.5 57 67.0 58 53.0 59 51.5 60 44.0 61 31.0 62 25.0 63 27.5 64 24.0 65 17.5 66 16.0 67 10.0 68 7.0 69 7.5 70 6.5 71 4.0 72 3.0 73 3.0 74 1.5 75 0.0 76 0.0 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.78511769172361 97.575 2 1.1895722601872942 2.35 3 0.02531004808909137 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.16249999999999998 0.0 0.0 0.0 0.0 114-115 0.21250000000000002 0.0 0.0 0.0 0.0 116-117 0.2625 0.0 0.0 0.0 0.0 118-119 0.2875 0.0 0.0 0.0 0.0 120-121 0.3 0.0 0.0 0.0 0.0 122-123 0.325 0.0 0.0 0.0 0.0 124-125 0.325 0.0 0.0 0.0 0.0 126-127 0.35 0.0 0.0 0.0 0.0 128-129 0.35 0.0 0.0 0.0 0.0 130-131 0.375 0.0 0.0 0.0 0.0 132-133 0.375 0.0 0.0 0.0 0.0 134-135 0.3875 0.0 0.0 0.0 0.0 136-137 0.44999999999999996 0.0 0.0 0.0 0.0 138-139 0.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6031178 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031178_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.68375 34.0 33.0 34.0 33.0 34.0 2 32.8515 34.0 33.0 34.0 33.0 34.0 3 32.98275 34.0 33.0 34.0 33.0 34.0 4 32.90475 34.0 33.0 34.0 33.0 34.0 5 32.98825 34.0 33.0 34.0 33.0 34.0 6 36.918 38.0 38.0 38.0 38.0 38.0 7 36.94 38.0 38.0 38.0 38.0 38.0 8 36.945 38.0 38.0 38.0 38.0 38.0 9 36.981 38.0 38.0 38.0 38.0 38.0 10-14 36.921749999999996 38.0 38.0 38.0 38.0 38.0 15-19 36.8604 38.0 38.0 38.0 38.0 38.0 20-24 36.854949999999995 38.0 38.0 38.0 38.0 38.0 25-29 36.825300000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.0796 38.0 38.0 38.0 38.0 38.0 35-39 37.10065 38.0 38.0 38.0 38.0 38.0 40-44 37.133300000000006 38.0 38.0 38.0 38.0 38.0 45-49 37.0992 38.0 38.0 38.0 38.0 38.0 50-54 37.06855 38.0 38.0 38.0 38.0 38.0 55-59 36.8889 38.0 38.0 38.0 37.6 38.0 60-64 36.931599999999996 38.0 38.0 38.0 38.0 38.0 65-69 36.84605 38.0 38.0 38.0 37.2 38.0 70-74 36.669050000000006 38.0 38.0 38.0 37.0 38.0 75-79 36.792899999999996 38.0 38.0 38.0 37.0 38.0 80-84 36.9768 38.0 38.0 38.0 37.0 38.0 85-89 36.90555 38.0 38.0 38.0 37.0 38.0 90-94 36.8281 38.0 38.0 38.0 37.0 38.0 95-99 36.78965000000001 38.0 38.0 38.0 36.4 38.0 100-104 36.67765 38.0 38.0 38.0 36.2 38.0 105-109 36.506550000000004 38.0 38.0 38.0 36.0 38.0 110-114 36.4086 38.0 38.0 38.0 35.4 38.0 115-119 36.236149999999995 38.0 38.0 38.0 35.0 38.0 120-124 36.09465 38.0 38.0 38.0 34.4 38.0 125-129 36.2216 38.0 38.0 38.0 34.4 38.0 130-134 36.13695 38.0 38.0 38.0 34.0 38.0 135-139 36.0997 38.0 38.0 38.0 34.0 38.0 140-144 35.953649999999996 38.0 38.0 38.0 34.0 38.0 145-149 35.529849999999996 38.0 38.0 38.0 33.0 38.0 150-151 32.698375 37.0 34.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 49.0 3 1.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 1.0 12 1.0 13 1.0 14 2.0 15 4.0 16 2.0 17 2.0 18 4.0 19 7.0 20 5.0 21 8.0 22 7.0 23 4.0 24 8.0 25 5.0 26 11.0 27 12.0 28 14.0 29 15.0 30 19.0 31 28.0 32 29.0 33 34.0 34 68.0 35 107.0 36 278.0 37 3271.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.422822210901685 22.542027508914927 12.124299541518084 24.910850738665307 2 27.87801778907243 27.064803049555273 28.132147395171536 16.925031766200764 3 20.99265636870094 28.71613066599139 30.615345657128383 19.675867308179285 4 25.108005082592122 33.16391359593393 21.448538754764932 20.279542566709022 5 25.461908377625917 33.7382941027588 21.4123006833713 19.38749683624399 6 24.338085539714868 36.22708757637474 21.817718940936864 17.617107942973522 7 22.275967413441954 21.5122199592668 34.85234215885947 21.35947046843177 8 24.85372678707708 23.98880691935894 23.352836428389722 27.804629865174256 9 23.10038119440915 24.167725540025415 28.157560355781445 24.574332909783987 10-14 24.619534789026314 27.831221051560036 25.525525525525527 22.023718633888127 15-19 24.994901080970834 26.62145625127473 26.137058943503977 22.24658372425046 20-24 25.03058103975535 26.829765545361877 26.269113149847094 21.87054026503568 25-29 24.74914684459838 27.076860388122036 25.86461569805939 22.30937706922019 30-34 24.774774774774773 26.920740965684786 26.277963356615043 22.026520902925398 35-39 24.866066916001213 26.544021024967147 26.18518144142323 22.404730617608408 40-44 24.620122166691907 26.987732848705132 26.442526124488868 21.94961886011409 45-49 24.848729326341267 26.75978217022993 26.05385235982251 22.337636143606293 50-54 24.89905108015344 26.45871189178276 26.468806783767413 22.173430244296384 55-59 24.625158831003812 26.891994917407878 26.41423125794155 22.068614993646758 60-64 24.590413390819172 26.77149378645701 26.2490489475019 22.389043875221912 65-69 25.335297703718755 26.686649055070106 26.117659012395855 21.86039422881528 70-74 25.101936799184504 26.73802242609582 26.21814475025484 21.941896024464832 75-79 24.40968872188087 26.86233687096938 26.933428121667596 21.79454628548215 80-84 24.276786614252597 27.094042939219836 26.569902227598025 22.059268218929542 85-89 25.001258875069237 27.035600986958052 25.917719925474596 22.04542021249811 90-94 24.4918494666935 26.685449788689873 26.781042463272286 22.041658281344333 95-99 24.778046811945117 27.10855528652139 26.331719128329294 21.781678773204195 100-104 24.8910509780075 26.55822438431134 26.994020472281342 21.556704165399818 105-109 24.643802157541217 26.643598615916954 26.87258294321189 21.84001628332994 110-114 24.76049735018345 26.824296779453732 26.31471667346107 22.100489196901755 115-119 24.63642394244017 26.784711945705975 27.187834872684597 21.39102923916926 120-124 24.458125572402565 27.30233031443981 26.05576472982599 22.183779383331636 125-129 24.89381067961165 27.447411003236244 26.041666666666668 21.617111650485437 130-134 25.12352525965514 27.33689623878189 26.06130886356761 21.47826963799536 135-139 24.35626634479984 27.08207604103802 26.543954938644138 22.017702675518006 140-144 25.199819031820237 27.099984919318352 26.486703865681392 21.213492183180012 145-149 25.035147620004018 26.918055834504923 26.360715003012654 21.68608154247841 150-151 24.653215636822196 26.986128625472887 26.847414880201764 21.513240857503153 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 23.0 1 12.0 2 0.5 3 1.0 4 1.5 5 1.0 6 1.0 7 2.0 8 3.0 9 2.0 10 2.0 11 1.5 12 0.0 13 0.0 14 1.0 15 2.0 16 1.0 17 0.5 18 1.5 19 1.5 20 1.0 21 2.0 22 4.0 23 4.5 24 3.5 25 4.5 26 6.5 27 7.0 28 7.5 29 13.0 30 19.0 31 21.5 32 21.0 33 26.5 34 45.5 35 57.0 36 71.0 37 92.5 38 120.0 39 148.0 40 164.0 41 190.5 42 219.5 43 223.0 44 214.0 45 198.5 46 190.5 47 196.5 48 175.0 49 145.5 50 129.5 51 124.0 52 119.5 53 114.0 54 107.0 55 94.0 56 82.0 57 67.5 58 57.0 59 53.0 60 50.0 61 43.0 62 41.5 63 42.0 64 41.0 65 35.5 66 29.0 67 28.5 68 27.0 69 21.5 70 14.0 71 7.5 72 7.0 73 10.0 74 6.5 75 2.5 76 1.5 77 2.5 78 2.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.8499999999999999 2 1.625 3 1.275 4 1.625 5 1.225 6 1.7999999999999998 7 1.7999999999999998 8 1.725 9 1.625 10-14 1.765 15-19 1.94 20-24 1.9 25-29 1.8350000000000002 30-34 1.21 35-39 1.0699999999999998 40-44 0.955 45-49 0.84 50-54 0.9400000000000001 55-59 1.625 60-64 1.425 65-69 1.58 70-74 1.9 75-79 1.5350000000000001 80-84 0.79 85-89 0.705 90-94 0.62 95-99 0.88 100-104 1.3299999999999998 105-109 1.7399999999999998 110-114 1.8800000000000001 115-119 2.015 120-124 1.73 125-129 1.1199999999999999 130-134 0.83 135-139 0.58 140-144 0.5349999999999999 145-149 0.42 150-151 0.8750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.225 #Duplication Level Percentage of deduplicated Percentage of total 1 98.77831509289896 97.02499999999999 2 1.1453296004072282 2.25 3 0.050903537795876815 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025451768897938407 0.575 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 23 0.575 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.16249999999999998 0.0 0.0 0.0 0.0 114-115 0.21250000000000002 0.0 0.0 0.0 0.0 116-117 0.2375 0.0 0.0 0.0 0.0 118-119 0.2625 0.0 0.0 0.0 0.0 120-121 0.275 0.0 0.0 0.0 0.0 122-123 0.3 0.0 0.0 0.0 0.0 124-125 0.3 0.0 0.0 0.0 0.0 126-127 0.325 0.0 0.0 0.0 0.0 128-129 0.325 0.0 0.0 0.0 0.0 130-131 0.35 0.0 0.0 0.0 0.0 132-133 0.375 0.0 0.0 0.0 0.0 134-135 0.3875 0.0 0.0 0.0 0.0 136-137 0.4375 0.0 0.0 0.0 0.0 138-139 0.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGAACC 10 0.006706487 145.84616 2 AATGCTG 10 0.006706487 145.84616 8 >>END_MODULE Read 648676 spots for SRR6031178.sra Written 648676 spots for SRR6031178.sra Read 648676 spots for SRR6031178.sra Written 648676 spots for SRR6031178.sra Read 648676 spots for SRR6031178.sra Written 648676 spots for SRR6031178.sra Read 648676 spots for SRR6031178.sra Written 648676 spots for SRR6031178.sra Read 648676 spots for SRR6031178.sra Written 648676 spots for SRR6031178.sra Read 648676 spots for SRR6031178.sra Written 648676 spots for SRR6031178.sra Read 648676 spots for SRR6031178.sra Written 648676 spots for SRR6031178.sra Read 648676 spots for SRR6031178.sra Written 648676 spots for SRR6031178.sra Read 648676 spots for SRR6031178.sra Written 648676 spots for SRR6031178.sra Read 648676 spots for SRR6031178.sra Written 648676 spots for SRR6031178.sra Read 648676 spots for SRR6031178.sra Written 648676 spots for SRR6031178.sra Read 648676 spots for SRR6031178.sra Written 648676 spots for SRR6031178.sra Read 648676 spots for SRR6031178.sra Written 648676 spots for SRR6031178.sra Read 648692 spots for SRR6031178.sra Written 648692 spots for SRR6031178.sra Read 648676 spots for SRR6031178.sra Written 648676 spots for SRR6031178.sra Read 648676 spots for SRR6031178.sra Written 648676 spots for SRR6031178.sra Read 648676 spots for SRR6031178.sra Written 648676 spots for SRR6031178.sra Read 648676 spots for SRR6031178.sra Written 648676 spots for SRR6031178.sra Read 648676 spots for SRR6031178.sra Written 648676 spots for SRR6031178.sra Read 648676 spots for SRR6031178.sra Written 648676 spots for SRR6031178.sra SRR ids: ['SRR6031178.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hfff4d28 SRR6031178.sra spots: 12973536 blocks: [[1, 648676], [648677, 1297352], [1297353, 1946028], [1946029, 2594704], [2594705, 3243380], [3243381, 3892056], [3892057, 4540732], [4540733, 5189408], [5189409, 5838084], [5838085, 6486760], [6486761, 7135436], [7135437, 7784112], [7784113, 8432788], [8432789, 9081464], [9081465, 9730140], [9730141, 10378816], [10378817, 11027492], [11027493, 11676168], [11676169, 12324844], [12324845, 12973536]] SRR6031178 file size 4374605 SRR6031178 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031178 SRR6031178_1.fastq SRR6031178_2.fastq Input file: SRR6031178_1.fastq Paired file: SRR6031178_2.fastq trimmed: SRR6031178-trimmed-pair1.fastq, SRR6031178-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 03:20:57 2024 >> started Thu Dec 12 03:21:10 2024 >> done (13.400s) 12973536 read pairs processed; of these: 10240 ( 0.08%) short read pairs filtered out after trimming by size control 19028 ( 0.15%) empty read pairs filtered out after trimming by size control 12944268 (99.77%) read pairs available; of these: 3535209 (27.31%) trimmed read pairs available after processing 9409059 (72.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 9 0.00% 21 5 0.00% 22 4 0.00% 23 8 0.00% 24 6 0.00% 25 6 0.00% 26 1 0.00% 27 4 0.00% 28 4 0.00% 29 5 0.00% 30 8 0.00% 31 4 0.00% 32 4 0.00% 33 6 0.00% 34 4 0.00% 35 9 0.00% 36 9 0.00% 37 2 0.00% 38 13 0.00% 39 10 0.00% 40 8 0.00% 41 10 0.00% 42 12 0.00% 43 9 0.00% 44 12 0.00% 45 10 0.00% 46 10 0.00% 47 10 0.00% 48 12 0.00% 49 16 0.00% 50 11 0.00% 51 14 0.00% 52 18 0.00% 53 28 0.00% 54 24 0.00% 55 24 0.00% 56 21 0.00% 57 25 0.00% 58 32 0.00% 59 27 0.00% 60 40 0.00% 61 41 0.00% 62 51 0.00% 63 69 0.00% 64 62 0.00% 65 76 0.00% 66 70 0.00% 67 70 0.00% 68 97 0.00% 69 85 0.00% 70 110 0.00% 71 122 0.00% 72 148 0.00% 73 169 0.00% 74 164 0.00% 75 199 0.00% 76 235 0.00% 77 245 0.00% 78 261 0.00% 79 286 0.00% 80 304 0.00% 81 340 0.00% 82 373 0.00% 83 413 0.00% 84 865 0.01% 85 1172 0.01% 86 1147 0.01% 87 1153 0.01% 88 1174 0.01% 89 1146 0.01% 90 1246 0.01% 91 1260 0.01% 92 1279 0.01% 93 1286 0.01% 94 1415 0.01% 95 1451 0.01% 96 1459 0.01% 97 1555 0.01% 98 1535 0.01% 99 1575 0.01% 100 1735 0.01% 101 1872 0.01% 102 1920 0.01% 103 2034 0.02% 104 2026 0.02% 105 2390 0.02% 106 2271 0.02% 107 2348 0.02% 108 2460 0.02% 109 2532 0.02% 110 2686 0.02% 111 2877 0.02% 112 3104 0.02% 113 3295 0.03% 114 3522 0.03% 115 3663 0.03% 116 3625 0.03% 117 3842 0.03% 118 3958 0.03% 119 4129 0.03% 120 4414 0.03% 121 4508 0.03% 122 4810 0.04% 123 5164 0.04% 124 5523 0.04% 125 5801 0.04% 126 6072 0.05% 127 6399 0.05% 128 6791 0.05% 129 7133 0.06% 130 7434 0.06% 131 8076 0.06% 132 8662 0.07% 133 9500 0.07% 134 10263 0.08% 135 10703 0.08% 136 11754 0.09% 137 12455 0.10% 138 13836 0.11% 139 14880 0.11% 140 17037 0.13% 141 19430 0.15% 142 21169 0.16% 143 25141 0.19% 144 31606 0.24% 145 44102 0.34% 146 73058 0.56% 147 76908 0.59% 148 140472 1.09% 149 339008 2.62% 150 2501600 19.33% 151 9409059 72.69% 12944268 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=30 prefix-density=0.34 prefix-fanout=2.1 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=23 fanout-score=115.66 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=25.1 sequence=ATCTTCTTCTTG criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=31 prefix-density=0.36 prefix-fanout=2.3 sequence=GTGCCAGCAGCCGCGGTAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=170.48 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=14.0 sequence=CCGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR6031178 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 03:22:07 Started mapping on | Dec 12 03:22:07 Finished on | Dec 12 03:23:20 Mapping speed, Million of reads per hour | 638.35 Number of input reads | 12944268 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 11708967 Uniquely mapped reads % | 90.46% Average mapped length | 299.55 Number of splices: Total | 12823439 Number of splices: Annotated (sjdb) | 12182801 Number of splices: GT/AG | 12654745 Number of splices: GC/AG | 149008 Number of splices: AT/AC | 8588 Number of splices: Non-canonical | 11098 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.00% Deletion average length | 1.43 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 437580 % of reads mapped to multiple loci | 3.38% Number of reads mapped to too many loci | 39606 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.92% % of reads unmapped: other | 2.94% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 804745 804745 804745 N_multimapping 437580 437580 437580 N_noFeature 894936 11374777 992251 N_ambiguous 321551 3277 91020 UnstrandedReadsAssigned:10492480 PositiveStrandReadsAssigned:330913 NegativeStrandReadsAssigned:10625696 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6031178 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6031178-trimmed-pair1.fastq SRR6031178-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,944,268 reads, 10,959,737 reads pseudoaligned [quant] estimated average fragment length: 438.533 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52973 SRR6031178.ke.tsv 35125 SRR6031178.se.tsv 88098 total ==> SRR6031178.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 499.91 0 0 PNS24247 1044 606.467 67.9199 14.7143 PNS24249 1928 1490.47 12.6908 1.11871 PNS24246 1044 606.467 67.9199 14.7143 PNS24248 1044 606.467 67.9199 14.7143 PNS24244 1471 1033.47 38.5494 4.90085 PNS24243 293 63.3681 0 0 KQK14069 1603 1165.47 3280.31 369.799 KQK14071 474 128.137 7.71739 7.91308 ==> SRR6031178.se.tsv <== BRADI_1g14170v3 3459 BRADI_1g53295v3 49 BRADI_1g59795v3 490 BRADI_1g07683v3 0 BRADI_1g00485v3 52 BRADI_1g20270v3 776 BRADI_1g74790v3 57 BRADI_1g09890v3 1 BRADI_1g77505v3 174 BRADI_1g48960v3 0 SRR6031178 completed mapping pipeline successfully