Starting /dee2/code/volunteer_pipeline.sh SRR6031179 current disk space = 1523691646976 free memory = 1601881604 SRR6031179 SRAfilesize 1579ce799dfc4af7c78d5130643df8ec SRR6031179.sra SRR6031179.sra file validated SRR6031179 is paired end SRR6031179 is conventional basespace SRR6031179 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031179_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.64725 18.0 18.0 18.0 18.0 32.0 2 27.23125 27.0 27.0 29.0 25.0 31.0 3 28.2635 29.0 27.0 31.0 25.0 33.0 4 31.23425 31.0 31.0 33.0 29.0 33.0 5 32.459 33.0 33.0 33.0 32.0 33.0 6 36.518 38.0 36.0 38.0 34.0 38.0 7 37.29475 38.0 38.0 38.0 36.0 38.0 8 37.565 38.0 38.0 38.0 37.0 38.0 9 37.707 38.0 38.0 38.0 38.0 38.0 10-14 37.65525 38.0 38.0 38.0 38.0 38.0 15-19 37.670500000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.73205 38.0 38.0 38.0 38.0 38.0 25-29 37.7596 38.0 38.0 38.0 38.0 38.0 30-34 37.71475 38.0 38.0 38.0 38.0 38.0 35-39 37.7384 38.0 38.0 38.0 38.0 38.0 40-44 37.717600000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.612849999999995 38.0 38.0 38.0 38.0 38.0 50-54 37.59805 38.0 38.0 38.0 38.0 38.0 55-59 37.5406 38.0 38.0 38.0 37.8 38.0 60-64 37.474599999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.41725 38.0 38.0 38.0 37.0 38.0 70-74 37.4218 38.0 38.0 38.0 37.0 38.0 75-79 37.3692 38.0 38.0 38.0 36.8 38.0 80-84 37.2849 38.0 38.0 38.0 36.6 38.0 85-89 37.255849999999995 38.0 38.0 38.0 36.6 38.0 90-94 37.22865 38.0 38.0 38.0 36.2 38.0 95-99 37.10145 38.0 38.0 38.0 36.0 38.0 100-104 37.04595 38.0 38.0 38.0 36.0 38.0 105-109 36.81695 38.0 38.0 38.0 35.0 38.0 110-114 36.861900000000006 38.0 38.0 38.0 35.0 38.0 115-119 36.65655 38.0 38.0 38.0 34.0 38.0 120-124 36.5472 38.0 38.0 38.0 34.0 38.0 125-129 36.284 38.0 37.8 38.0 33.8 38.0 130-134 35.966449999999995 38.0 36.6 38.0 32.6 38.0 135-139 35.9347 38.0 36.2 38.0 32.8 38.0 140-144 35.63505 38.0 36.0 38.0 31.8 38.0 145-149 35.2325 38.0 36.0 38.0 31.0 38.0 150-151 31.467875 36.5 31.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 2.0 19 3.0 20 1.0 21 1.0 22 2.0 23 2.0 24 8.0 25 1.0 26 8.0 27 10.0 28 13.0 29 11.0 30 26.0 31 21.0 32 41.0 33 71.0 34 108.0 35 228.0 36 802.0 37 2640.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.2892730045755 28.139298423995935 5.3126588713777325 23.258769700050838 2 22.3 12.7 34.2 30.8 3 18.5 19.2 27.775 34.525 4 23.5 25.05 23.325000000000003 28.125 5 26.075 28.075 23.075000000000003 22.775000000000002 6 22.95 33.15 23.375 20.525 7 17.325 25.55 38.800000000000004 18.325 8 19.900000000000002 23.775 30.0 26.325 9 20.275000000000002 22.875 31.6 25.25 10-14 21.395 27.755000000000003 26.779999999999998 24.07 15-19 21.65 26.619999999999997 26.72 25.009999999999998 20-24 22.439999999999998 26.455000000000002 27.384999999999998 23.72 25-29 22.259999999999998 26.85 26.174999999999997 24.715 30-34 22.66 26.55 26.275 24.515 35-39 21.72 26.450000000000003 26.205000000000002 25.624999999999996 40-44 21.73 26.44 27.084999999999997 24.745 45-49 22.12 26.619999999999997 26.68 24.58 50-54 22.29 26.400000000000002 26.279999999999998 25.03 55-59 22.259999999999998 26.27 26.1 25.369999999999997 60-64 22.27 26.224999999999998 26.424999999999997 25.080000000000002 65-69 21.64 25.915 26.815 25.629999999999995 70-74 21.790000000000003 27.075 26.090000000000003 25.045 75-79 22.05 26.235000000000003 26.1 25.615 80-84 21.685 26.064999999999998 26.465 25.785000000000004 85-89 22.48 26.685 26.090000000000003 24.745 90-94 21.875 26.540000000000003 26.325 25.259999999999998 95-99 21.975 26.31 26.369999999999997 25.345000000000002 100-104 22.015 26.905 25.979999999999997 25.1 105-109 22.625 26.355 25.974999999999998 25.045 110-114 22.71 25.509999999999998 26.805 24.975 115-119 22.375 26.265 26.224999999999998 25.135 120-124 22.36 26.35 26.179999999999996 25.11 125-129 22.425 26.19 26.3 25.085 130-134 22.84 26.590000000000003 25.979999999999997 24.59 135-139 22.64 26.029999999999998 26.105 25.224999999999998 140-144 23.085 25.515 25.974999999999998 25.424999999999997 145-149 23.080000000000002 26.105 25.845000000000002 24.97 150-151 22.35 26.737499999999997 25.9625 24.95 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.0 25 0.5 26 1.5 27 1.5 28 2.5 29 8.5 30 13.0 31 13.5 32 16.5 33 24.0 34 36.0 35 52.0 36 58.0 37 77.0 38 96.0 39 115.5 40 146.0 41 176.5 42 215.0 43 222.0 44 215.0 45 215.0 46 219.5 47 215.5 48 210.5 49 200.0 50 173.0 51 169.0 52 154.0 53 121.5 54 107.0 55 97.5 56 85.5 57 72.0 58 54.0 59 48.5 60 56.5 61 53.0 62 42.0 63 37.0 64 31.5 65 22.5 66 19.5 67 22.0 68 22.0 69 15.0 70 11.0 71 10.0 72 9.0 73 7.0 74 2.0 75 1.0 76 1.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.0625 0.0 0.0 0.0 0.0 106-107 0.0875 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.21250000000000002 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.2375 0.0 0.0 0.0 0.0 122-123 0.3 0.0 0.0 0.0 0.0 124-125 0.3 0.0 0.0 0.0 0.0 126-127 0.3375 0.0 0.0 0.0 0.0 128-129 0.3625 0.0 0.0 0.0 0.0 130-131 0.4 0.0 0.0 0.0 0.0 132-133 0.5125 0.0 0.0 0.0 0.0 134-135 0.525 0.0 0.0 0.0 0.0 136-137 0.55 0.0 0.0 0.0 0.0 138-139 0.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATGCT 10 0.006577216 146.82278 1 AACAAAT 10 0.006832588 144.9875 7 CTGAACA 10 0.006832588 144.9875 4 TGAACAA 10 0.006832588 144.9875 5 >>END_MODULE SRR6031179 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031179_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.034 33.0 33.0 34.0 32.0 34.0 2 32.225 34.0 33.0 34.0 32.0 34.0 3 32.3185 34.0 33.0 34.0 32.0 34.0 4 32.31075 34.0 33.0 34.0 32.0 34.0 5 32.287 34.0 33.0 34.0 32.0 34.0 6 36.39375 38.0 38.0 38.0 37.0 38.0 7 36.427 38.0 38.0 38.0 37.0 38.0 8 36.42625 38.0 38.0 38.0 37.0 38.0 9 36.46575 38.0 38.0 38.0 37.0 38.0 10-14 36.4045 38.0 38.0 38.0 37.0 38.0 15-19 36.291199999999996 38.0 38.0 38.0 37.0 38.0 20-24 36.283699999999996 38.0 38.0 38.0 37.0 38.0 25-29 36.317449999999994 38.0 38.0 38.0 37.0 38.0 30-34 36.60215 38.0 38.0 38.0 37.0 38.0 35-39 36.68885 38.0 38.0 38.0 37.0 38.0 40-44 36.70335 38.0 38.0 38.0 37.0 38.0 45-49 36.72135 38.0 38.0 38.0 37.0 38.0 50-54 36.63925 38.0 38.0 38.0 37.0 38.0 55-59 36.34315 38.0 38.0 38.0 36.4 38.0 60-64 36.4621 38.0 38.0 38.0 36.4 38.0 65-69 36.3591 38.0 38.0 38.0 36.0 38.0 70-74 36.109 38.0 38.0 38.0 35.4 38.0 75-79 36.23575 38.0 38.0 38.0 35.8 38.0 80-84 36.402249999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.35855 38.0 38.0 38.0 35.8 38.0 90-94 36.135349999999995 38.0 38.0 38.0 34.4 38.0 95-99 36.180099999999996 38.0 38.0 38.0 34.8 38.0 100-104 36.087450000000004 38.0 38.0 38.0 34.8 38.0 105-109 35.7692 38.0 38.0 38.0 33.8 38.0 110-114 35.49355 38.0 38.0 38.0 33.2 38.0 115-119 35.37964999999999 38.0 38.0 38.0 32.6 38.0 120-124 35.346 38.0 38.0 38.0 32.4 38.0 125-129 35.57865 38.0 38.0 38.0 32.8 38.0 130-134 35.355 38.0 38.0 38.0 31.6 38.0 135-139 35.18005000000001 38.0 37.0 38.0 31.0 38.0 140-144 34.9307 38.0 36.6 38.0 30.6 38.0 145-149 34.45 38.0 36.0 38.0 28.4 38.0 150-151 30.640625 35.5 29.5 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 69.0 3 4.0 4 2.0 5 0.0 6 3.0 7 1.0 8 2.0 9 3.0 10 2.0 11 0.0 12 3.0 13 3.0 14 1.0 15 3.0 16 9.0 17 10.0 18 7.0 19 6.0 20 6.0 21 9.0 22 8.0 23 18.0 24 11.0 25 13.0 26 11.0 27 8.0 28 16.0 29 23.0 30 24.0 31 40.0 32 42.0 33 56.0 34 63.0 35 157.0 36 413.0 37 2954.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.50751684810783 22.498703991705547 7.82789009849663 20.165889061689995 2 26.846846846846844 27.927927927927925 25.353925353925355 19.871299871299872 3 23.783783783783786 26.28056628056628 29.446589446589442 20.48906048906049 4 26.218097447795824 32.63727764887857 19.979376127868008 21.16524877545759 5 25.74002574002574 34.234234234234236 20.30888030888031 19.716859716859716 6 23.88059701492537 35.07462686567165 21.410190427174474 19.634585692228512 7 21.20822622107969 21.59383033419023 34.70437017994858 22.493573264781492 8 22.159383033419022 24.832904884318765 25.424164524421595 27.583547557840614 9 22.80881599179908 24.24397744746284 28.088159917990772 24.85904664274731 10-14 24.55040591922721 27.283937930325763 24.576097009557085 23.58955914088994 15-19 24.82357183330758 26.482254159583785 25.091433575439137 23.6027404316695 20-24 24.829931972789115 26.07194392908679 25.298907441764584 23.799216656359516 25-29 25.840098653786868 26.004521631898058 24.7559346418662 23.399445072448874 30-34 25.203748981255092 25.86593317033415 25.295436022819885 23.634881825590874 35-39 25.667580465021828 26.403695806680883 24.535485836125495 23.393237892171793 40-44 25.548000811853054 26.22792774507814 25.106555713415872 23.117515729652933 45-49 25.28968274047462 26.180235794160804 24.900065779486923 23.630015685877652 50-54 24.488656549763995 26.26503578135309 25.630614627214133 23.61569304166878 55-59 24.848919389531908 26.32899723445662 25.166444740346204 23.655638635665266 60-64 25.021658258166436 26.321153748152675 25.62808948682668 23.0290985068542 65-69 24.7194450112222 26.04060395837584 25.8416649663334 23.398286064068557 70-74 25.785064501207795 26.355553271316236 24.937040653749293 22.92234157372668 75-79 25.743888123309343 25.845965395804626 25.315163578829175 23.094982902056856 80-84 25.14424536896447 25.91355400344164 25.55926713230084 23.382933495293045 85-89 25.333468067906225 26.040824575586097 25.035367825383993 23.590339531123686 90-94 25.27422534499318 26.76540464034777 24.99115402112925 22.969215993529797 95-99 25.173268578944707 25.92705013406182 25.517276268528356 23.382405018465118 100-104 25.38367720296778 26.079886167293427 26.013822542941355 22.52261408679744 105-109 25.674289816429084 25.55635319454415 25.802481796738796 22.96687519228797 110-114 25.45042726243179 26.47482755070524 25.249665396890762 22.825079789972204 115-119 25.75578101663491 26.40469691507442 25.106865118195397 22.73265695009528 120-124 25.599055877674587 26.004412745651393 25.53748268253887 22.859048694135154 125-129 24.982228089773535 26.337970955621003 25.368132426119633 23.311668528485832 130-134 25.933788223401567 25.817538539297445 25.372757139246904 22.87591609805408 135-139 25.65008836152487 25.89245140116132 25.281494572077754 23.17596566523605 140-144 24.88917993149305 26.818456578682248 25.211565585331453 23.08079790449325 145-149 25.3176636030335 26.196574757671637 25.61398222088293 22.871779418411933 150-151 25.573728921009252 25.675161658425257 26.258399898567262 22.492709521998226 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 39.0 1 20.0 2 0.5 3 1.0 4 1.0 5 0.0 6 0.5 7 1.0 8 1.0 9 1.0 10 1.5 11 2.5 12 2.5 13 1.0 14 1.5 15 1.5 16 2.0 17 3.5 18 2.5 19 3.0 20 2.0 21 1.0 22 3.5 23 3.0 24 4.0 25 8.5 26 6.0 27 2.0 28 4.5 29 7.5 30 7.5 31 10.5 32 13.5 33 15.0 34 17.5 35 39.5 36 61.5 37 70.5 38 90.0 39 118.0 40 141.5 41 162.0 42 177.0 43 192.5 44 201.0 45 190.5 46 200.0 47 213.5 48 197.0 49 179.5 50 163.0 51 140.5 52 122.5 53 113.0 54 98.0 55 91.0 56 87.5 57 77.0 58 82.0 59 70.0 60 58.5 61 61.5 62 57.0 63 53.5 64 50.0 65 47.0 66 40.5 67 39.0 68 39.0 69 28.5 70 21.5 71 14.0 72 9.0 73 10.5 74 6.5 75 2.0 76 2.5 77 3.0 78 2.5 79 0.5 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.55 2 2.875 3 2.875 4 3.025 5 2.875 6 2.85 7 2.75 8 2.75 9 2.45 10-14 2.69 15-19 2.935 20-24 2.98 25-29 2.69 30-34 1.8399999999999999 35-39 1.51 40-44 1.46 45-49 1.185 50-54 1.485 55-59 2.37 60-64 1.8849999999999998 65-69 1.9800000000000002 70-74 2.715 75-79 2.035 80-84 1.21 85-89 1.04 90-94 1.085 95-99 1.165 100-104 1.6099999999999999 105-109 2.4899999999999998 110-114 2.87 115-119 2.915 120-124 2.555 125-129 1.53 130-134 1.075 135-139 0.975 140-144 0.74 145-149 0.445 150-151 1.4125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.41565040650406 97.82499999999999 2 0.48272357723577236 0.95 3 0.07621951219512195 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025406504065040653 1.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 40 1.0 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.0625 0.0 0.0 0.0 0.0 106-107 0.0875 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.21250000000000002 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.225 0.0 0.0 0.0 0.0 122-123 0.275 0.0 0.0 0.0 0.0 124-125 0.2875 0.0 0.0 0.0 0.0 126-127 0.3125 0.0 0.0 0.0 0.0 128-129 0.3375 0.0 0.0 0.0 0.0 130-131 0.375 0.0 0.0 0.0 0.0 132-133 0.4875 0.0 0.0 0.0 0.0 134-135 0.5 0.0 0.0 0.0 0.0 136-137 0.5 0.0 0.0 0.0 0.0 138-139 0.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGATT 10 0.0065811533 146.76923 2 TTAGGTT 10 0.0065811533 146.76923 3 >>END_MODULE Read 703631 spots for SRR6031179.sra Written 703631 spots for SRR6031179.sra Read 703631 spots for SRR6031179.sra Written 703631 spots for SRR6031179.sra Read 703631 spots for SRR6031179.sra Written 703631 spots for SRR6031179.sra Read 703631 spots for SRR6031179.sra Written 703631 spots for SRR6031179.sra Read 703631 spots for SRR6031179.sra Written 703631 spots for SRR6031179.sra Read 703648 spots for SRR6031179.sra Written 703648 spots for SRR6031179.sra Read 703631 spots for SRR6031179.sra Written 703631 spots for SRR6031179.sra Read 703631 spots for SRR6031179.sra Written 703631 spots for SRR6031179.sra Read 703631 spots for SRR6031179.sra Written 703631 spots for SRR6031179.sra Read 703631 spots for SRR6031179.sra Written 703631 spots for SRR6031179.sra Read 703631 spots for SRR6031179.sra Written 703631 spots for SRR6031179.sra Read 703631 spots for SRR6031179.sra Written 703631 spots for SRR6031179.sra Read 703631 spots for SRR6031179.sra Written 703631 spots for SRR6031179.sra Read 703631 spots for SRR6031179.sra Written 703631 spots for SRR6031179.sra Read 703631 spots for SRR6031179.sra Written 703631 spots for SRR6031179.sra Read 703631 spots for SRR6031179.sra Written 703631 spots for SRR6031179.sra Read 703631 spots for SRR6031179.sra Written 703631 spots for SRR6031179.sra Read 703631 spots for SRR6031179.sra Written 703631 spots for SRR6031179.sra Read 703631 spots for SRR6031179.sra Written 703631 spots for SRR6031179.sra Read 703631 spots for SRR6031179.sra Written 703631 spots for SRR6031179.sra SRR ids: ['SRR6031179.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_83hugjed SRR6031179.sra spots: 14072637 blocks: [[1, 703631], [703632, 1407262], [1407263, 2110893], [2110894, 2814524], [2814525, 3518155], [3518156, 4221786], [4221787, 4925417], [4925418, 5629048], [5629049, 6332679], [6332680, 7036310], [7036311, 7739941], [7739942, 8443572], [8443573, 9147203], [9147204, 9850834], [9850835, 10554465], [10554466, 11258096], [11258097, 11961727], [11961728, 12665358], [12665359, 13368989], [13368990, 14072637]] SRR6031179 file size 4747054 SRR6031179 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031179 SRR6031179_1.fastq SRR6031179_2.fastq Input file: SRR6031179_1.fastq Paired file: SRR6031179_2.fastq trimmed: SRR6031179-trimmed-pair1.fastq, SRR6031179-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:37:53 2024 >> started Tue Dec 10 00:38:08 2024 >> done (15.323s) 14072637 read pairs processed; of these: 22989 ( 0.16%) short read pairs filtered out after trimming by size control 35312 ( 0.25%) empty read pairs filtered out after trimming by size control 14014336 (99.59%) read pairs available; of these: 4594646 (32.79%) trimmed read pairs available after processing 9419690 (67.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 1 0.00% 21 3 0.00% 22 8 0.00% 23 5 0.00% 24 5 0.00% 25 1 0.00% 26 7 0.00% 27 5 0.00% 28 5 0.00% 29 2 0.00% 30 5 0.00% 31 2 0.00% 32 10 0.00% 33 6 0.00% 34 4 0.00% 35 10 0.00% 36 4 0.00% 37 10 0.00% 38 8 0.00% 39 5 0.00% 40 8 0.00% 41 10 0.00% 42 6 0.00% 43 10 0.00% 44 12 0.00% 45 8 0.00% 46 13 0.00% 47 10 0.00% 48 12 0.00% 49 24 0.00% 50 8 0.00% 51 24 0.00% 52 34 0.00% 53 24 0.00% 54 21 0.00% 55 18 0.00% 56 36 0.00% 57 31 0.00% 58 48 0.00% 59 59 0.00% 60 46 0.00% 61 53 0.00% 62 70 0.00% 63 78 0.00% 64 56 0.00% 65 79 0.00% 66 83 0.00% 67 70 0.00% 68 105 0.00% 69 111 0.00% 70 136 0.00% 71 147 0.00% 72 149 0.00% 73 186 0.00% 74 205 0.00% 75 221 0.00% 76 283 0.00% 77 375 0.00% 78 326 0.00% 79 322 0.00% 80 371 0.00% 81 411 0.00% 82 463 0.00% 83 546 0.00% 84 1485 0.01% 85 1960 0.01% 86 1928 0.01% 87 2021 0.01% 88 2114 0.02% 89 1865 0.01% 90 1783 0.01% 91 1900 0.01% 92 1934 0.01% 93 2021 0.01% 94 2003 0.01% 95 2091 0.01% 96 2143 0.02% 97 2214 0.02% 98 2388 0.02% 99 2471 0.02% 100 2474 0.02% 101 2740 0.02% 102 2780 0.02% 103 2965 0.02% 104 3052 0.02% 105 3411 0.02% 106 3316 0.02% 107 3492 0.02% 108 3632 0.03% 109 3724 0.03% 110 3944 0.03% 111 4050 0.03% 112 4549 0.03% 113 4668 0.03% 114 5106 0.04% 115 5167 0.04% 116 5385 0.04% 117 5445 0.04% 118 5873 0.04% 119 6135 0.04% 120 6390 0.05% 121 6503 0.05% 122 6879 0.05% 123 7312 0.05% 124 7862 0.06% 125 8268 0.06% 126 8817 0.06% 127 9441 0.07% 128 9818 0.07% 129 10320 0.07% 130 11059 0.08% 131 11782 0.08% 132 12583 0.09% 133 13422 0.10% 134 14418 0.10% 135 15781 0.11% 136 16991 0.12% 137 18632 0.13% 138 20368 0.15% 139 22771 0.16% 140 25514 0.18% 141 28000 0.20% 142 32141 0.23% 143 38469 0.27% 144 45910 0.33% 145 58003 0.41% 146 77004 0.55% 147 110485 0.79% 148 189165 1.35% 149 460802 3.29% 150 3170080 22.62% 151 9419690 67.21% 14014336 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.08 fanout-score-rank=23 prefix-density=0.19 prefix-fanout=3.6 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=147.70 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=14.0 sequence=CAGCATCCTTGCAGATGCGCGAACCTCGGTCCCCGCGAGGGCATTACGCCCCGGGCTATAACACTCCCGGAGGAGCTACGTTCCCAGGACCTTTATCCCCCCGCGAGAACCGATGCTGGCCTGAGCCGGGCGGAGTGCACCGGTGAGAACACCGGATGATCCGCCCGGCGCAAGTCTGGTCACAAGCGCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=5.01 fanout-score-rank=21 prefix-density=0.29 prefix-fanout=4.0 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=287.25 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=18.4 sequence=CCGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR6031179 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:39:04 Started mapping on | Dec 10 00:39:04 Finished on | Dec 10 00:42:29 Mapping speed, Million of reads per hour | 246.11 Number of input reads | 14014336 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 12454822 Uniquely mapped reads % | 88.87% Average mapped length | 299.22 Number of splices: Total | 14278525 Number of splices: Annotated (sjdb) | 13582514 Number of splices: GT/AG | 14095525 Number of splices: GC/AG | 164010 Number of splices: AT/AC | 10124 Number of splices: Non-canonical | 8866 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 128121 % of reads mapped to multiple loci | 0.91% Number of reads mapped to too many loci | 47219 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.54% % of reads unmapped: other | 3.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1444690 1444690 1444690 N_multimapping 128121 128121 128121 N_noFeature 465700 12117412 554761 N_ambiguous 295636 2520 47164 UnstrandedReadsAssigned:11693486 PositiveStrandReadsAssigned:334890 NegativeStrandReadsAssigned:11852897 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6031179 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6031179-trimmed-pair1.fastq SRR6031179-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,014,336 reads, 11,950,230 reads pseudoaligned [quant] estimated average fragment length: 414.917 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52973 SRR6031179.ke.tsv 35125 SRR6031179.se.tsv 88098 total ==> SRR6031179.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 523.057 0 0 PNS24247 1044 630.083 86.7775 16.3285 PNS24249 1928 1514.08 35.7977 2.80312 PNS24246 1044 630.083 86.7775 16.3285 PNS24248 1044 630.083 86.7775 16.3285 PNS24244 1471 1057.08 73.8697 8.28504 PNS24243 293 63.3007 0 0 KQK14069 1603 1189.08 3323.28 331.354 KQK14071 474 134.711 12.4149 10.9263 ==> SRR6031179.se.tsv <== BRADI_1g14170v3 3455 BRADI_1g53295v3 56 BRADI_1g59795v3 391 BRADI_1g07683v3 0 BRADI_1g00485v3 22 BRADI_1g20270v3 607 BRADI_1g74790v3 151 BRADI_1g09890v3 0 BRADI_1g77505v3 152 BRADI_1g48960v3 0 SRR6031179 completed mapping pipeline successfully