Starting /dee2/code/volunteer_pipeline.sh SRR6031181 current disk space = 1523634950144 free memory = 1563138616 SRR6031181 SRAfilesize 8e10dd1bbec6a7363fd3b37eb348c3f2 SRR6031181.sra SRR6031181.sra file validated SRR6031181 is paired end SRR6031181 is conventional basespace SRR6031181 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031181_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.6045 18.0 18.0 28.0 18.0 32.0 2 27.154 27.0 25.0 30.0 18.0 31.0 3 26.8745 28.0 25.0 31.0 18.0 33.0 4 30.64175 32.0 31.0 33.0 27.0 33.0 5 32.0005 33.0 32.0 33.0 31.0 33.0 6 36.75075 38.0 37.0 38.0 35.0 38.0 7 37.5165 38.0 38.0 38.0 37.0 38.0 8 37.51175 38.0 38.0 38.0 37.0 38.0 9 37.65625 38.0 38.0 38.0 38.0 38.0 10-14 37.712 38.0 38.0 38.0 38.0 38.0 15-19 37.761 38.0 38.0 38.0 38.0 38.0 20-24 37.8119 38.0 38.0 38.0 38.0 38.0 25-29 37.762100000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.7911 38.0 38.0 38.0 38.0 38.0 35-39 37.74595 38.0 38.0 38.0 38.0 38.0 40-44 37.73865 38.0 38.0 38.0 38.0 38.0 45-49 37.719950000000004 38.0 38.0 38.0 38.0 38.0 50-54 37.6702 38.0 38.0 38.0 38.0 38.0 55-59 37.65615 38.0 38.0 38.0 38.0 38.0 60-64 37.634350000000005 38.0 38.0 38.0 38.0 38.0 65-69 37.63145 38.0 38.0 38.0 38.0 38.0 70-74 37.57685 38.0 38.0 38.0 38.0 38.0 75-79 37.59335 38.0 38.0 38.0 38.0 38.0 80-84 37.58365 38.0 38.0 38.0 38.0 38.0 85-89 37.517599999999995 38.0 38.0 38.0 38.0 38.0 90-94 37.453649999999996 38.0 38.0 38.0 37.4 38.0 95-99 37.4287 38.0 38.0 38.0 37.4 38.0 100-104 37.3583 38.0 38.0 38.0 37.0 38.0 105-109 37.32665 38.0 38.0 38.0 37.0 38.0 110-114 37.3013 38.0 38.0 38.0 36.6 38.0 115-119 37.19805 38.0 38.0 38.0 36.2 38.0 120-124 37.04205 38.0 38.0 38.0 36.0 38.0 125-129 37.0182 38.0 38.0 38.0 35.8 38.0 130-134 36.899350000000005 38.0 38.0 38.0 35.0 38.0 135-139 36.838 38.0 38.0 38.0 35.0 38.0 140-144 36.499550000000006 38.0 38.0 38.0 34.4 38.0 145-149 36.189949999999996 38.0 37.6 38.0 33.8 38.0 150-151 33.788875000000004 37.0 34.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 1.0 19 2.0 20 1.0 21 2.0 22 1.0 23 0.0 24 3.0 25 4.0 26 0.0 27 6.0 28 7.0 29 8.0 30 11.0 31 20.0 32 23.0 33 36.0 34 63.0 35 138.0 36 483.0 37 3187.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.20822880080281 15.504264927245359 9.734069242348218 29.553437029603614 2 24.425 16.3 32.675 26.6 3 18.675 24.65 27.800000000000004 28.875 4 23.0 28.4 23.25 25.35 5 24.05 29.95 23.724999999999998 22.275 6 22.359154929577464 32.57042253521127 22.686116700201207 22.38430583501006 7 17.349999999999998 23.025000000000002 39.275 20.349999999999998 8 20.175 24.7 26.974999999999998 28.15 9 19.25 22.675 31.25 26.825 10-14 21.584999999999997 27.450000000000003 26.229999999999997 24.735 15-19 21.04 27.35 27.279999999999998 24.33 20-24 21.705 26.63 27.189999999999998 24.474999999999998 25-29 21.715 26.740000000000002 26.915 24.63 30-34 21.709999999999997 27.125 26.415 24.75 35-39 21.385 26.955000000000002 26.295 25.365 40-44 21.65 26.68 26.38 25.290000000000003 45-49 21.91219121912191 26.587658765876586 26.542654265426542 24.957495749574957 50-54 21.557155715571557 26.837683768376834 26.84768476847685 24.75747574757476 55-59 21.315 26.93 26.674999999999997 25.080000000000002 60-64 22.134999999999998 26.040000000000003 26.575 25.25 65-69 21.895 26.8 26.61 24.695 70-74 22.355 26.169999999999998 26.369999999999997 25.105 75-79 21.78 26.5 26.455000000000002 25.264999999999997 80-84 21.57 26.85 26.784999999999997 24.795 85-89 22.02 26.52 26.400000000000002 25.06 90-94 21.47 26.52 26.26 25.75 95-99 21.959999999999997 25.990000000000002 27.089999999999996 24.959999999999997 100-104 21.665 26.915 26.640000000000004 24.779999999999998 105-109 21.895 26.44 26.31 25.355 110-114 22.205 26.6 26.255 24.94 115-119 21.85 25.91 26.939999999999998 25.3 120-124 21.485000000000003 26.465 27.105 24.945 125-129 21.310000000000002 26.240000000000002 26.91 25.540000000000003 130-134 22.545 26.450000000000003 26.400000000000002 24.605 135-139 22.220000000000002 26.08 26.195 25.505 140-144 22.047204720472045 25.902590259025903 26.832683268326836 25.217521752175216 145-149 22.202220222022202 26.33763376337634 26.192619261926193 25.267526752675266 150-151 21.633112417156433 27.53532574715518 26.02225834688008 24.809303488808304 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 1.0 25 2.5 26 2.5 27 3.5 28 3.0 29 2.5 30 7.0 31 10.0 32 17.5 33 30.5 34 45.0 35 52.0 36 63.0 37 75.5 38 87.5 39 116.0 40 147.0 41 167.0 42 187.0 43 214.0 44 242.0 45 247.0 46 239.0 47 229.0 48 209.0 49 194.5 50 182.5 51 163.5 52 138.5 53 122.5 54 112.5 55 100.5 56 89.0 57 67.5 58 58.0 59 71.5 60 61.0 61 42.0 62 34.5 63 30.0 64 29.5 65 25.0 66 17.5 67 11.0 68 9.5 69 9.5 70 6.5 71 4.5 72 5.5 73 5.0 74 2.0 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.6 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.01 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.01 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8747808665164 99.7 2 0.07513148009015778 0.15 3 0.050087653393438514 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.0875 0.0 0.0 0.0 0.0 112-113 0.1 0.0 0.0 0.0 0.0 114-115 0.1 0.0 0.0 0.0 0.0 116-117 0.1 0.0 0.0 0.0 0.0 118-119 0.125 0.0 0.0 0.0 0.0 120-121 0.16249999999999998 0.0 0.0 0.0 0.0 122-123 0.25 0.0 0.0 0.0 0.0 124-125 0.275 0.0 0.0 0.0 0.0 126-127 0.275 0.0 0.0 0.0 0.0 128-129 0.275 0.0 0.0 0.0 0.0 130-131 0.275 0.0 0.0 0.0 0.0 132-133 0.275 0.0 0.0 0.0 0.0 134-135 0.275 0.0 0.0 0.0 0.0 136-137 0.275 0.0 0.0 0.0 0.0 138-139 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTAGATC 10 0.006830828 145.0 8 >>END_MODULE SRR6031181 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031181_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3155 34.0 33.0 34.0 33.0 34.0 2 33.37 34.0 33.0 34.0 33.0 34.0 3 33.358 34.0 33.0 34.0 33.0 34.0 4 33.293 34.0 33.0 34.0 33.0 34.0 5 33.31925 34.0 33.0 34.0 33.0 34.0 6 37.485 38.0 38.0 38.0 38.0 38.0 7 37.50025 38.0 38.0 38.0 38.0 38.0 8 37.5145 38.0 38.0 38.0 38.0 38.0 9 37.5335 38.0 38.0 38.0 38.0 38.0 10-14 37.445800000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.34045 38.0 38.0 38.0 38.0 38.0 20-24 37.2706 38.0 38.0 38.0 38.0 38.0 25-29 37.3823 38.0 38.0 38.0 38.0 38.0 30-34 37.55225 38.0 38.0 38.0 38.0 38.0 35-39 37.5668 38.0 38.0 38.0 38.0 38.0 40-44 37.5008 38.0 38.0 38.0 38.0 38.0 45-49 37.502300000000005 38.0 38.0 38.0 38.0 38.0 50-54 37.49765 38.0 38.0 38.0 38.0 38.0 55-59 37.3832 38.0 38.0 38.0 38.0 38.0 60-64 37.432550000000006 38.0 38.0 38.0 38.0 38.0 65-69 37.4468 38.0 38.0 38.0 38.0 38.0 70-74 37.2923 38.0 38.0 38.0 38.0 38.0 75-79 37.3748 38.0 38.0 38.0 38.0 38.0 80-84 37.347500000000004 38.0 38.0 38.0 37.8 38.0 85-89 37.2509 38.0 38.0 38.0 37.2 38.0 90-94 37.2257 38.0 38.0 38.0 37.0 38.0 95-99 37.18575 38.0 38.0 38.0 37.0 38.0 100-104 37.151250000000005 38.0 38.0 38.0 37.0 38.0 105-109 37.026599999999995 38.0 38.0 38.0 36.6 38.0 110-114 36.84675 38.0 38.0 38.0 36.0 38.0 115-119 36.71320000000001 38.0 38.0 38.0 35.8 38.0 120-124 36.63225 38.0 38.0 38.0 35.2 38.0 125-129 36.75555 38.0 38.0 38.0 35.2 38.0 130-134 36.6916 38.0 38.0 38.0 35.2 38.0 135-139 36.6049 38.0 38.0 38.0 35.0 38.0 140-144 36.452299999999994 38.0 38.0 38.0 34.8 38.0 145-149 36.1902 38.0 38.0 38.0 34.2 38.0 150-151 33.744375 37.0 35.5 38.0 18.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 0.0 5 0.0 6 0.0 7 0.0 8 2.0 9 0.0 10 2.0 11 1.0 12 4.0 13 0.0 14 1.0 15 0.0 16 2.0 17 0.0 18 4.0 19 1.0 20 2.0 21 2.0 22 1.0 23 6.0 24 7.0 25 13.0 26 8.0 27 18.0 28 12.0 29 18.0 30 20.0 31 26.0 32 31.0 33 40.0 34 59.0 35 121.0 36 265.0 37 3330.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.596298149074535 22.461230615307652 11.030515257628814 23.911955977988995 2 28.42131598699024 27.695771828871653 25.143857893420062 18.739054290718038 3 21.709701679618952 28.07721233391828 29.43093507144648 20.782150915016295 4 26.141495233316608 31.234320120421476 20.898143502257902 21.726041144004014 5 26.56641604010025 33.583959899749374 19.824561403508774 20.025062656641605 6 24.993739043325817 34.68569997495617 19.90984222389181 20.410718757826196 7 22.839969947407965 21.61282243926872 33.30828950663661 22.238918106686704 8 23.34669338677355 25.475951903807616 22.16933867735471 29.008016032064127 9 23.56178089044522 24.462231115557778 26.513256628314156 25.46273136568284 10-14 25.15183456306781 26.552226070370928 24.328665361642322 23.967274004918938 15-19 24.964809973858838 25.73899054896441 25.4675246330183 23.828674844158456 20-24 25.26941283110082 26.639137878940478 25.088125692416153 23.00332359754255 25-29 25.220883534136547 26.109437751004016 25.060240963855424 23.609437751004016 30-34 25.005 26.275 25.19 23.53 35-39 24.265 26.115 25.474999999999998 24.145 40-44 25.522552255225524 25.997599759975998 25.18251825182518 23.2973297329733 45-49 25.41 25.94 25.285000000000004 23.365 50-54 24.825 26.095000000000002 25.679999999999996 23.400000000000002 55-59 25.475951903807616 25.255511022044086 25.91182364729459 23.356713426853705 60-64 24.709999999999997 26.340000000000003 25.55 23.400000000000002 65-69 25.00500200080032 25.725290116046416 25.645258103241297 23.624449779911966 70-74 25.30833249774391 26.596811390755036 25.198034693672916 22.896821417828136 75-79 24.775 26.21 25.395 23.62 80-84 25.014999999999997 26.419999999999998 25.34 23.225 85-89 25.01500600240096 26.405562224889955 25.48519407763105 23.094237695078032 90-94 25.13751375137514 26.162616261626166 25.50755075507551 23.192319231923193 95-99 25.2250450090018 26.415283056611322 25.48009601920384 22.879575915183036 100-104 25.12376856528479 26.53898084712707 25.80387058058709 22.53338000700105 105-109 25.412508149857064 26.741561763378304 24.499724158683986 23.346205928080646 110-114 25.310223561919116 26.64154734991208 24.99874403416227 23.04948505400653 115-119 25.446495950093073 26.860190169542687 24.6214217437239 23.071892136640336 120-124 25.273237741903138 26.576757244560312 25.333400180487313 22.816604833049233 125-129 25.3 26.27 25.46 22.97 130-134 25.180000000000003 26.305 25.509999999999998 23.005 135-139 25.615 26.575 25.615 22.195 140-144 25.587558755875587 26.292629262926294 25.36253625362536 22.757275727572758 145-149 25.480192076830733 26.98079231692677 24.939975990396157 22.59903961584634 150-151 25.203252032520325 25.95372107567229 26.55409631019387 22.28893058161351 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 2.0 26 3.5 27 3.5 28 4.5 29 5.0 30 8.0 31 9.5 32 14.5 33 23.0 34 24.0 35 32.0 36 47.5 37 56.5 38 82.0 39 110.5 40 143.5 41 173.0 42 180.0 43 194.5 44 221.5 45 225.5 46 213.0 47 204.5 48 191.0 49 193.0 50 175.0 51 159.5 52 140.0 53 109.0 54 100.5 55 90.5 56 87.5 57 83.5 58 83.0 59 78.0 60 59.0 61 52.5 62 49.5 63 51.5 64 51.5 65 40.5 66 34.0 67 37.5 68 39.5 69 31.0 70 22.5 71 16.5 72 16.5 73 12.5 74 4.0 75 3.5 76 3.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.075 3 0.27499999999999997 4 0.35000000000000003 5 0.25 6 0.17500000000000002 7 0.17500000000000002 8 0.2 9 0.05 10-14 0.385 15-19 0.54 20-24 0.7100000000000001 25-29 0.4 30-34 0.0 35-39 0.0 40-44 0.01 45-49 0.0 50-54 0.0 55-59 0.2 60-64 0.0 65-69 0.04 70-74 0.27 75-79 0.0 80-84 0.0 85-89 0.04 90-94 0.01 95-99 0.02 100-104 0.015 105-109 0.305 110-114 0.475 115-119 0.615 120-124 0.27 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.04 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62311557788944 99.125 2 0.2763819095477387 0.5499999999999999 3 0.07537688442211055 0.22499999999999998 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.0875 0.0 0.0 0.0 0.0 112-113 0.1 0.0 0.0 0.0 0.0 114-115 0.1 0.0 0.0 0.0 0.0 116-117 0.1 0.0 0.0 0.0 0.0 118-119 0.125 0.0 0.0 0.0 0.0 120-121 0.16249999999999998 0.0 0.0 0.0 0.0 122-123 0.25 0.0 0.0 0.0 0.0 124-125 0.275 0.0 0.0 0.0 0.0 126-127 0.275 0.0 0.0 0.0 0.0 128-129 0.275 0.0 0.0 0.0 0.0 130-131 0.275 0.0 0.0 0.0 0.0 132-133 0.275 0.0 0.0 0.0 0.0 134-135 0.275 0.0 0.0 0.0 0.0 136-137 0.275 0.0 0.0 0.0 0.0 138-139 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 628041 spots for SRR6031181.sra Written 628041 spots for SRR6031181.sra Read 628041 spots for SRR6031181.sra Written 628041 spots for SRR6031181.sra Read 628041 spots for SRR6031181.sra Written 628041 spots for SRR6031181.sra Read 628041 spots for SRR6031181.sra Written 628041 spots for SRR6031181.sra Read 628041 spots for SRR6031181.sra Written 628041 spots for SRR6031181.sra Read 628041 spots for SRR6031181.sra Written 628041 spots for SRR6031181.sra Read 628046 spots for SRR6031181.sra Written 628046 spots for SRR6031181.sra Read 628041 spots for SRR6031181.sra Written 628041 spots for SRR6031181.sra Read 628041 spots for SRR6031181.sra Written 628041 spots for SRR6031181.sra Read 628041 spots for SRR6031181.sra Written 628041 spots for SRR6031181.sra Read 628041 spots for SRR6031181.sra Written 628041 spots for SRR6031181.sra Read 628041 spots for SRR6031181.sra Written 628041 spots for SRR6031181.sra Read 628041 spots for SRR6031181.sra Written 628041 spots for SRR6031181.sra Read 628041 spots for SRR6031181.sra Written 628041 spots for SRR6031181.sra Read 628041 spots for SRR6031181.sra Written 628041 spots for SRR6031181.sra Read 628041 spots for SRR6031181.sra Written 628041 spots for SRR6031181.sra Read 628041 spots for SRR6031181.sra Written 628041 spots for SRR6031181.sra Read 628041 spots for SRR6031181.sra Written 628041 spots for SRR6031181.sra Read 628041 spots for SRR6031181.sra Written 628041 spots for SRR6031181.sra Read 628041 spots for SRR6031181.sra Written 628041 spots for SRR6031181.sra SRR ids: ['SRR6031181.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xnmc5jdb SRR6031181.sra spots: 12560825 blocks: [[1, 628041], [628042, 1256082], [1256083, 1884123], [1884124, 2512164], [2512165, 3140205], [3140206, 3768246], [3768247, 4396287], [4396288, 5024328], [5024329, 5652369], [5652370, 6280410], [6280411, 6908451], [6908452, 7536492], [7536493, 8164533], [8164534, 8792574], [8792575, 9420615], [9420616, 10048656], [10048657, 10676697], [10676698, 11304738], [11304739, 11932779], [11932780, 12560825]] SRR6031181 file size 4234751 SRR6031181 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031181 SRR6031181_1.fastq SRR6031181_2.fastq Input file: SRR6031181_1.fastq Paired file: SRR6031181_2.fastq trimmed: SRR6031181-trimmed-pair1.fastq, SRR6031181-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:40:31 2024 >> started Tue Dec 10 00:40:47 2024 >> done (15.706s) 12560825 read pairs processed; of these: 8099 ( 0.06%) short read pairs filtered out after trimming by size control 6919 ( 0.06%) empty read pairs filtered out after trimming by size control 12545807 (99.88%) read pairs available; of these: 3592559 (28.64%) trimmed read pairs available after processing 8953248 (71.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 8 0.00% 20 8 0.00% 21 1 0.00% 22 6 0.00% 23 5 0.00% 24 0 0.00% 25 7 0.00% 26 10 0.00% 27 11 0.00% 28 6 0.00% 29 9 0.00% 30 6 0.00% 31 8 0.00% 32 6 0.00% 33 6 0.00% 34 2 0.00% 35 11 0.00% 36 8 0.00% 37 7 0.00% 38 6 0.00% 39 9 0.00% 40 9 0.00% 41 6 0.00% 42 13 0.00% 43 12 0.00% 44 7 0.00% 45 11 0.00% 46 7 0.00% 47 7 0.00% 48 12 0.00% 49 21 0.00% 50 16 0.00% 51 22 0.00% 52 17 0.00% 53 18 0.00% 54 20 0.00% 55 30 0.00% 56 32 0.00% 57 37 0.00% 58 43 0.00% 59 47 0.00% 60 43 0.00% 61 53 0.00% 62 64 0.00% 63 50 0.00% 64 67 0.00% 65 73 0.00% 66 53 0.00% 67 68 0.00% 68 95 0.00% 69 89 0.00% 70 105 0.00% 71 116 0.00% 72 139 0.00% 73 137 0.00% 74 144 0.00% 75 178 0.00% 76 195 0.00% 77 249 0.00% 78 229 0.00% 79 239 0.00% 80 279 0.00% 81 315 0.00% 82 347 0.00% 83 375 0.00% 84 763 0.01% 85 1049 0.01% 86 1055 0.01% 87 1227 0.01% 88 1329 0.01% 89 1331 0.01% 90 1394 0.01% 91 1312 0.01% 92 1303 0.01% 93 1378 0.01% 94 1307 0.01% 95 1326 0.01% 96 1291 0.01% 97 1319 0.01% 98 1405 0.01% 99 1471 0.01% 100 1604 0.01% 101 1601 0.01% 102 1708 0.01% 103 1769 0.01% 104 1807 0.01% 105 1881 0.01% 106 2088 0.02% 107 2104 0.02% 108 2241 0.02% 109 2444 0.02% 110 2690 0.02% 111 2732 0.02% 112 3055 0.02% 113 3301 0.03% 114 3626 0.03% 115 4191 0.03% 116 4483 0.04% 117 4364 0.03% 118 4280 0.03% 119 4223 0.03% 120 4653 0.04% 121 4851 0.04% 122 5136 0.04% 123 5283 0.04% 124 5571 0.04% 125 5745 0.05% 126 6102 0.05% 127 6658 0.05% 128 6778 0.05% 129 7309 0.06% 130 7924 0.06% 131 8506 0.07% 132 9398 0.07% 133 10240 0.08% 134 10922 0.09% 135 11911 0.09% 136 12882 0.10% 137 14306 0.11% 138 16050 0.13% 139 17662 0.14% 140 19852 0.16% 141 22608 0.18% 142 26150 0.21% 143 30420 0.24% 144 37059 0.30% 145 48253 0.38% 146 64728 0.52% 147 95079 0.76% 148 164429 1.31% 149 385067 3.07% 150 2440345 19.45% 151 8953248 71.36% 12545807 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=8.44 fanout-score-rank=12 prefix-density=0.59 prefix-fanout=4.6 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=42.16 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.7 sequence=GCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGGTGTAGCTGGCGACTTGCTCAGGGGTGGCCCGCTCCTTGCACTCGGCGCCGGGTGTCACCATGCTGGGCTTGAGGAGGATGCCCTCGAACAAGACGTTGTTCTGGGCCATGTAGTAGAAAGTCTCCGCCCACACCTTCTGCGCCACCTCGAAGGTCCTGTCGATGCCGTGCTCGCCGTCCAGCAGGATCTCCGGCTCCACAATCGGCACCAGACCGTTGTCCTGAGAGATGGCAGCGTAACGGGCAAGACCCCATGCAGCTTCCTTGACAGCAAGCTCAGATGGGCCGTTGGGGATGCTGACGA criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=4.28 fanout-score-rank=22 prefix-density=0.31 prefix-fanout=3.6 sequence=GGCAAGACCATCACCCTTGAGGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=29 fanout-score=202.54 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=17.1 sequence=CCGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR6031181 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:41:38 Started mapping on | Dec 10 00:41:38 Finished on | Dec 10 00:43:29 Mapping speed, Million of reads per hour | 406.89 Number of input reads | 12545807 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 11745205 Uniquely mapped reads % | 93.62% Average mapped length | 299.81 Number of splices: Total | 13581683 Number of splices: Annotated (sjdb) | 12898015 Number of splices: GT/AG | 13412814 Number of splices: GC/AG | 154287 Number of splices: AT/AC | 7361 Number of splices: Non-canonical | 7221 Mismatch rate per base, % | 0.08% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 159185 % of reads mapped to multiple loci | 1.27% Number of reads mapped to too many loci | 9901 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.37% % of reads unmapped: other | 0.66% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 648165 648165 648165 N_multimapping 159185 159185 159185 N_noFeature 381595 11429951 455377 N_ambiguous 291830 2722 51457 UnstrandedReadsAssigned:11071780 PositiveStrandReadsAssigned:312532 NegativeStrandReadsAssigned:11238371 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6031181 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6031181-trimmed-pair1.fastq SRR6031181-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,545,807 reads, 11,332,023 reads pseudoaligned [quant] estimated average fragment length: 474.36 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,121 rounds 52973 SRR6031181.ke.tsv 35125 SRR6031181.se.tsv 88098 total ==> SRR6031181.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 464.938 0 0 PNS24247 1044 570.64 63.302 13.2299 PNS24249 1928 1454.64 12.6362 1.036 PNS24246 1044 570.64 63.302 13.2299 PNS24248 1044 570.64 63.302 13.2299 PNS24244 1471 997.64 34.4577 4.11919 PNS24243 293 62.5723 0 0 KQK14069 1603 1129.64 4322.21 456.316 KQK14071 474 116.947 15.2239 15.5252 ==> SRR6031181.se.tsv <== BRADI_1g14170v3 4558 BRADI_1g53295v3 39 BRADI_1g59795v3 289 BRADI_1g07683v3 0 BRADI_1g00485v3 20 BRADI_1g20270v3 943 BRADI_1g74790v3 45 BRADI_1g09890v3 0 BRADI_1g77505v3 167 BRADI_1g48960v3 0 SRR6031181 completed mapping pipeline successfully