Starting /dee2/code/volunteer_pipeline.sh SRR6031182 current disk space = 1523646898176 free memory = 1560597384 SRR6031182 SRAfilesize f71ddcfde62fc35e8dd19dc2f4963815 SRR6031182.sra SRR6031182.sra file validated SRR6031182 is paired end SRR6031182 is conventional basespace SRR6031182 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031182_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.80775 18.0 18.0 18.0 18.0 32.0 2 27.21875 27.0 27.0 29.0 25.0 30.0 3 27.91425 29.0 27.0 31.0 25.0 33.0 4 31.07175 31.0 30.0 33.0 29.0 33.0 5 32.4125 33.0 32.0 33.0 32.0 33.0 6 36.421 38.0 36.0 38.0 34.0 38.0 7 37.1665 38.0 38.0 38.0 36.0 38.0 8 37.45125 38.0 38.0 38.0 37.0 38.0 9 37.5895 38.0 38.0 38.0 38.0 38.0 10-14 37.620400000000004 38.0 38.0 38.0 37.8 38.0 15-19 37.602999999999994 38.0 38.0 38.0 37.8 38.0 20-24 37.704 38.0 38.0 38.0 38.0 38.0 25-29 37.6796 38.0 38.0 38.0 38.0 38.0 30-34 37.662150000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.65035 38.0 38.0 38.0 38.0 38.0 40-44 37.61355 38.0 38.0 38.0 38.0 38.0 45-49 37.54015 38.0 38.0 38.0 38.0 38.0 50-54 37.48865 38.0 38.0 38.0 37.6 38.0 55-59 37.4391 38.0 38.0 38.0 37.0 38.0 60-64 37.375 38.0 38.0 38.0 37.0 38.0 65-69 37.35 38.0 38.0 38.0 37.0 38.0 70-74 37.303 38.0 38.0 38.0 36.6 38.0 75-79 37.24380000000001 38.0 38.0 38.0 36.4 38.0 80-84 37.1687 38.0 38.0 38.0 36.0 38.0 85-89 37.12050000000001 38.0 38.0 38.0 36.0 38.0 90-94 37.0462 38.0 38.0 38.0 35.8 38.0 95-99 36.901149999999994 38.0 38.0 38.0 35.4 38.0 100-104 36.836149999999996 38.0 38.0 38.0 35.0 38.0 105-109 36.629149999999996 38.0 38.0 38.0 34.4 38.0 110-114 36.67425 38.0 38.0 38.0 34.6 38.0 115-119 36.3999 38.0 38.0 38.0 34.0 38.0 120-124 36.2195 38.0 37.2 38.0 33.8 38.0 125-129 35.998999999999995 38.0 36.8 38.0 33.0 38.0 130-134 35.66675 38.0 36.0 38.0 31.8 38.0 135-139 35.667950000000005 38.0 36.0 38.0 31.6 38.0 140-144 35.39435 38.0 36.0 38.0 31.0 38.0 145-149 34.82215 38.0 35.2 38.0 29.0 38.0 150-151 31.021500000000003 36.5 29.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 1.0 8 2.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 1.0 16 3.0 17 3.0 18 2.0 19 2.0 20 1.0 21 0.0 22 2.0 23 4.0 24 2.0 25 2.0 26 9.0 27 6.0 28 9.0 29 16.0 30 21.0 31 28.0 32 39.0 33 75.0 34 140.0 35 304.0 36 947.0 37 2378.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.02568622513221 31.12566104255855 5.716444220599345 25.132208511709898 2 22.075 13.55 36.525 27.85 3 18.65 18.625 28.799999999999997 33.925 4 26.075 22.775000000000002 22.900000000000002 28.249999999999996 5 23.325000000000003 30.2 24.275 22.2 6 23.549999999999997 31.15 23.825 21.475 7 16.45 26.450000000000003 38.775 18.325 8 20.325 25.75 28.15 25.775 9 18.75 23.849999999999998 32.975 24.425 10-14 21.310000000000002 27.605 27.439999999999998 23.645 15-19 22.02 26.43 27.185 24.365000000000002 20-24 21.490000000000002 26.665 27.175 24.67 25-29 21.495 27.134999999999998 27.02 24.349999999999998 30-34 21.455 26.384999999999998 27.445000000000004 24.715 35-39 21.285 26.775 27.47 24.47 40-44 21.105 27.384999999999998 26.875 24.635 45-49 21.84 26.590000000000003 26.905 24.665 50-54 21.37 26.924999999999997 27.150000000000002 24.555 55-59 21.72 26.375 27.18 24.725 60-64 21.23 27.105 27.185 24.48 65-69 21.485000000000003 26.584999999999997 26.939999999999998 24.990000000000002 70-74 21.195 27.43 26.840000000000003 24.535 75-79 22.1 26.355 26.640000000000004 24.905 80-84 21.64 27.145000000000003 26.875 24.34 85-89 22.235 27.24 26.400000000000002 24.125 90-94 22.375 26.465 26.915 24.245 95-99 21.715 27.025 26.974999999999998 24.285 100-104 21.985 26.490000000000002 26.740000000000002 24.785 105-109 22.29 25.919999999999998 26.615 25.174999999999997 110-114 21.685 26.52 26.985 24.81 115-119 22.035 26.715 27.05 24.2 120-124 21.615000000000002 26.665 27.224999999999998 24.495 125-129 21.815 26.095000000000002 27.145000000000003 24.945 130-134 21.88 26.31 27.47 24.34 135-139 22.285 26.505000000000003 26.950000000000003 24.26 140-144 22.255 26.665 26.479999999999997 24.6 145-149 22.095000000000002 26.040000000000003 27.315 24.55 150-151 21.625 24.7 27.775 25.900000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.5 6 2.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 1.0 25 1.0 26 1.5 27 4.5 28 6.5 29 7.0 30 8.5 31 13.5 32 21.5 33 29.5 34 47.0 35 63.0 36 71.5 37 94.5 38 117.0 39 137.0 40 160.0 41 186.0 42 216.0 43 227.0 44 235.0 45 248.0 46 236.5 47 214.0 48 190.5 49 182.0 50 177.0 51 151.5 52 126.5 53 106.0 54 94.5 55 82.5 56 72.0 57 65.0 58 57.0 59 58.0 60 47.5 61 36.5 62 32.5 63 27.0 64 26.0 65 20.5 66 16.0 67 15.5 68 13.5 69 13.0 70 10.0 71 6.5 72 9.0 73 5.5 74 0.5 75 0.5 76 1.0 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.0625 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1125 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.2625 0.0 0.0 0.0 0.0 118-119 0.3125 0.0 0.0 0.0 0.0 120-121 0.35 0.0 0.0 0.0 0.0 122-123 0.3875 0.0 0.0 0.0 0.0 124-125 0.4 0.0 0.0 0.0 0.0 126-127 0.4 0.0 0.0 0.0 0.0 128-129 0.425 0.0 0.0 0.0 0.0 130-131 0.425 0.0 0.0 0.0 0.0 132-133 0.45 0.0 0.0 0.0 0.0 134-135 0.5 0.0 0.0 0.0 0.0 136-137 0.5625 0.0 0.0 0.0 0.0 138-139 0.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTTGA 10 0.006830828 145.0 4 >>END_MODULE SRR6031182 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031182_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72775 33.0 33.0 34.0 32.0 34.0 2 32.8605 34.0 33.0 34.0 32.0 34.0 3 32.95275 34.0 33.0 34.0 33.0 34.0 4 32.8935 34.0 33.0 34.0 33.0 34.0 5 32.879 34.0 33.0 34.0 33.0 34.0 6 37.008 38.0 38.0 38.0 37.0 38.0 7 37.0435 38.0 38.0 38.0 37.0 38.0 8 37.07425 38.0 38.0 38.0 37.0 38.0 9 37.07625 38.0 38.0 38.0 38.0 38.0 10-14 37.05225 38.0 38.0 38.0 38.0 38.0 15-19 36.97085 38.0 38.0 38.0 37.8 38.0 20-24 36.99145 38.0 38.0 38.0 37.8 38.0 25-29 37.0045 38.0 38.0 38.0 37.0 38.0 30-34 37.1572 38.0 38.0 38.0 37.6 38.0 35-39 37.20495 38.0 38.0 38.0 37.8 38.0 40-44 37.151199999999996 38.0 38.0 38.0 37.4 38.0 45-49 37.1447 38.0 38.0 38.0 37.2 38.0 50-54 37.10515 38.0 38.0 38.0 37.0 38.0 55-59 36.998999999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.03465 38.0 38.0 38.0 37.0 38.0 65-69 36.9208 38.0 38.0 38.0 37.0 38.0 70-74 36.814 38.0 38.0 38.0 36.6 38.0 75-79 36.8515 38.0 38.0 38.0 36.4 38.0 80-84 36.881600000000006 38.0 38.0 38.0 36.0 38.0 85-89 36.838649999999994 38.0 38.0 38.0 36.0 38.0 90-94 36.59375 38.0 38.0 38.0 35.4 38.0 95-99 36.6123 38.0 38.0 38.0 35.2 38.0 100-104 36.51505 38.0 38.0 38.0 35.0 38.0 105-109 36.38585 38.0 38.0 38.0 34.8 38.0 110-114 36.183800000000005 38.0 38.0 38.0 34.2 38.0 115-119 36.12055 38.0 38.0 38.0 34.0 38.0 120-124 36.00055 38.0 38.0 38.0 34.0 38.0 125-129 36.0587 38.0 38.0 38.0 33.8 38.0 130-134 35.85875 38.0 38.0 38.0 33.0 38.0 135-139 35.663250000000005 38.0 38.0 38.0 32.4 38.0 140-144 35.322 38.0 36.6 38.0 31.0 38.0 145-149 34.8705 38.0 36.0 38.0 30.6 38.0 150-151 30.78125 35.5 29.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 3.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 2.0 13 6.0 14 2.0 15 2.0 16 4.0 17 4.0 18 5.0 19 7.0 20 6.0 21 2.0 22 2.0 23 3.0 24 11.0 25 9.0 26 11.0 27 11.0 28 15.0 29 24.0 30 17.0 31 35.0 32 40.0 33 58.0 34 96.0 35 185.0 36 483.0 37 2925.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.64738711314054 24.099441907661085 9.335362760020294 21.91780821917808 2 27.914032869785082 27.45891276864728 25.309734513274336 19.317319848293298 3 22.452591656131478 28.015170670037925 29.127686472819214 20.40455120101138 4 25.942799291318654 32.59934193874968 20.931409769678563 20.5264490002531 5 26.801517067003793 33.93173198482933 19.74715549936789 19.519595448798988 6 23.458038422649143 35.71789686552073 21.258847320525785 19.565217391304348 7 22.491786707101337 22.56760171847359 33.939853424311345 21.00075815011372 8 21.68309325246399 26.156178923426836 24.76623704826889 27.394490775840286 9 23.467070401211203 24.198839263184457 28.639919253091094 23.694171082513247 10-14 25.382788417807873 26.833089089898426 24.66521805043206 23.11890444186164 15-19 24.78368668724384 27.430046045640843 25.092344279714617 22.693922987400697 20-24 24.725469358838115 26.81544456252214 25.160670006578616 23.29841607206113 25-29 24.50485044462409 26.41471301535974 25.803354890864995 23.27708164915117 30-34 24.63753523962948 26.736810310108737 25.755134917438582 22.870519532823195 35-39 24.712036617876365 26.90508525728082 25.255268849655447 23.127609275187364 40-44 24.816453786583526 26.32002413758423 25.661269234637434 23.20225284119481 45-49 24.76128254095889 26.5001507689215 25.791536837873153 22.947029852246455 50-54 24.53722334004024 26.92655935613682 25.885311871227362 22.65090543259557 55-59 24.818401937046005 26.76553672316384 25.292574656981436 23.123486682808718 60-64 24.77590895357035 26.61899486353107 25.939168093463593 22.66592808943499 65-69 24.75566750629723 26.347607052896727 25.974811083123427 22.921914357682617 70-74 24.48835211481126 26.64611652938501 25.61018747789176 23.255343877911972 75-79 24.78455878647382 27.012044549715263 25.268356599304543 22.935040064506378 80-84 25.01382117907222 26.978941548977232 25.84811780670453 22.159119465246015 85-89 25.09039775010044 26.381076737645643 25.79851345922057 22.730012053033345 90-94 24.68224064305451 26.98317005777443 25.37050992213012 22.964079377040942 95-99 25.439565960012057 26.84617703205064 25.364211795438564 22.350045212498745 100-104 25.57858724089354 26.443952505534313 25.43771382571946 22.539746427852688 105-109 24.71722884265805 26.827913552817613 25.610987679256713 22.843869925267622 110-114 24.743362831858406 26.826801517067008 25.926675094816687 22.5031605562579 115-119 25.137856022664035 26.959073202812768 25.360449233571103 22.542621540952094 120-124 24.94823493762941 26.660269683349323 25.47851118630372 22.912984192717538 125-129 24.784992204395714 26.831967006990897 26.213348086304883 22.169692702308506 130-134 25.20468129991461 26.38002913255312 26.118840725300114 22.296448842232156 135-139 25.109181266000704 26.695447015712066 25.81697705938457 22.378394658902664 140-144 25.03511235955056 27.297351524879616 25.44642857142857 22.22110754414125 145-149 24.38010319090317 27.04503331162651 25.817762861293392 22.757100636176926 150-151 26.062358561729948 25.722906713603216 26.188081468443553 22.026653256223284 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 14.0 1 8.0 2 1.0 3 1.0 4 1.0 5 1.0 6 1.0 7 1.0 8 1.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.0 17 1.5 18 1.0 19 0.5 20 0.0 21 0.5 22 1.0 23 1.0 24 1.5 25 2.0 26 1.5 27 3.0 28 6.0 29 5.0 30 8.0 31 12.0 32 15.0 33 21.5 34 30.5 35 45.0 36 57.0 37 76.0 38 101.5 39 133.5 40 167.0 41 180.0 42 208.5 43 220.5 44 221.5 45 234.5 46 211.0 47 194.0 48 194.5 49 170.0 50 146.0 51 129.0 52 107.0 53 103.5 54 104.5 55 98.5 56 84.5 57 67.5 58 63.5 59 60.0 60 56.5 61 54.0 62 48.5 63 44.5 64 43.0 65 41.0 66 35.0 67 28.0 68 26.0 69 27.5 70 20.0 71 15.0 72 13.0 73 9.5 74 8.0 75 5.0 76 2.0 77 1.5 78 1.5 79 2.5 80 2.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4500000000000002 2 1.125 3 1.125 4 1.225 5 1.125 6 1.0999999999999999 7 1.075 8 1.075 9 0.9249999999999999 10-14 1.055 15-19 1.185 20-24 1.195 25-29 1.04 30-34 0.6799999999999999 35-39 0.5950000000000001 40-44 0.5700000000000001 45-49 0.51 50-54 0.6 55-59 0.88 60-64 0.7100000000000001 65-69 0.75 70-74 1.055 75-79 0.7849999999999999 80-84 0.515 85-89 0.44 90-94 0.475 95-99 0.47000000000000003 100-104 0.62 105-109 0.98 110-114 1.125 115-119 1.165 120-124 0.9950000000000001 125-129 0.585 130-134 0.455 135-139 0.395 140-144 0.32 145-149 0.185 150-151 0.575 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34277047522751 98.25 2 0.6066734074823054 1.2 3 0.0 0.0 4 0.0 0.0 5 0.02527805864509606 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02527805864509606 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 17 0.42500000000000004 No Hit GGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.1375 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.2875 0.0 0.0 0.0 0.0 118-119 0.3375 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.4125 0.0 0.0 0.0 0.0 124-125 0.425 0.0 0.0 0.0 0.0 126-127 0.425 0.0 0.0 0.0 0.0 128-129 0.45 0.0 0.0 0.0 0.0 130-131 0.45 0.0 0.0 0.0 0.0 132-133 0.475 0.0 0.0 0.0 0.0 134-135 0.5249999999999999 0.0 0.0 0.0 0.0 136-137 0.5874999999999999 0.0 0.0 0.0 0.0 138-139 0.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTAGTGG 10 0.0067532426 145.53165 7 >>END_MODULE Read 369828 spots for SRR6031182.sra Written 369828 spots for SRR6031182.sra Read 369828 spots for SRR6031182.sra Written 369828 spots for SRR6031182.sra Read 369828 spots for SRR6031182.sra Written 369828 spots for SRR6031182.sra Read 369828 spots for SRR6031182.sra Written 369828 spots for SRR6031182.sra Read 369828 spots for SRR6031182.sra Written 369828 spots for SRR6031182.sra Read 369828 spots for SRR6031182.sra Written 369828 spots for SRR6031182.sra Read 369828 spots for SRR6031182.sra Written 369828 spots for SRR6031182.sra Read 369828 spots for SRR6031182.sra Written 369828 spots for SRR6031182.sra Read 369828 spots for SRR6031182.sra Written 369828 spots for SRR6031182.sra Read 369828 spots for SRR6031182.sra Written 369828 spots for SRR6031182.sra Read 369828 spots for SRR6031182.sra Written 369828 spots for SRR6031182.sra Read 369846 spots for SRR6031182.sra Written 369846 spots for SRR6031182.sra Read 369828 spots for SRR6031182.sra Written 369828 spots for SRR6031182.sra Read 369828 spots for SRR6031182.sra Written 369828 spots for SRR6031182.sra Read 369828 spots for SRR6031182.sra Written 369828 spots for SRR6031182.sra Read 369828 spots for SRR6031182.sra Written 369828 spots for SRR6031182.sra Read 369828 spots for SRR6031182.sra Written 369828 spots for SRR6031182.sra Read 369828 spots for SRR6031182.sra Written 369828 spots for SRR6031182.sra Read 369828 spots for SRR6031182.sra Written 369828 spots for SRR6031182.sra Read 369828 spots for SRR6031182.sra Written 369828 spots for SRR6031182.sra SRR ids: ['SRR6031182.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mkap2aek SRR6031182.sra spots: 7396578 blocks: [[1, 369828], [369829, 739656], [739657, 1109484], [1109485, 1479312], [1479313, 1849140], [1849141, 2218968], [2218969, 2588796], [2588797, 2958624], [2958625, 3328452], [3328453, 3698280], [3698281, 4068108], [4068109, 4437936], [4437937, 4807764], [4807765, 5177592], [5177593, 5547420], [5547421, 5917248], [5917249, 6287076], [6287077, 6656904], [6656905, 7026732], [7026733, 7396578]] SRR6031182 file size 2489842 SRR6031182 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031182 SRR6031182_1.fastq SRR6031182_2.fastq Input file: SRR6031182_1.fastq Paired file: SRR6031182_2.fastq trimmed: SRR6031182-trimmed-pair1.fastq, SRR6031182-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:40:12 2024 >> started Tue Dec 10 00:40:19 2024 >> done (7.507s) 7396578 read pairs processed; of these: 8484 ( 0.11%) short read pairs filtered out after trimming by size control 11758 ( 0.16%) empty read pairs filtered out after trimming by size control 7376336 (99.73%) read pairs available; of these: 2483646 (33.67%) trimmed read pairs available after processing 4892690 (66.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 1 0.00% 21 1 0.00% 22 2 0.00% 23 2 0.00% 24 2 0.00% 25 3 0.00% 26 6 0.00% 27 3 0.00% 28 2 0.00% 29 4 0.00% 30 2 0.00% 31 2 0.00% 32 2 0.00% 33 2 0.00% 34 3 0.00% 35 2 0.00% 36 2 0.00% 37 6 0.00% 38 4 0.00% 39 5 0.00% 40 1 0.00% 41 5 0.00% 42 6 0.00% 43 4 0.00% 44 3 0.00% 45 2 0.00% 46 7 0.00% 47 8 0.00% 48 5 0.00% 49 6 0.00% 50 8 0.00% 51 14 0.00% 52 15 0.00% 53 13 0.00% 54 19 0.00% 55 17 0.00% 56 23 0.00% 57 19 0.00% 58 23 0.00% 59 23 0.00% 60 33 0.00% 61 36 0.00% 62 33 0.00% 63 32 0.00% 64 39 0.00% 65 42 0.00% 66 33 0.00% 67 37 0.00% 68 54 0.00% 69 54 0.00% 70 67 0.00% 71 81 0.00% 72 82 0.00% 73 98 0.00% 74 94 0.00% 75 100 0.00% 76 124 0.00% 77 164 0.00% 78 148 0.00% 79 160 0.00% 80 156 0.00% 81 200 0.00% 82 276 0.00% 83 299 0.00% 84 628 0.01% 85 792 0.01% 86 885 0.01% 87 973 0.01% 88 1145 0.02% 89 1139 0.02% 90 1045 0.01% 91 974 0.01% 92 950 0.01% 93 1033 0.01% 94 1035 0.01% 95 1023 0.01% 96 1124 0.02% 97 1096 0.01% 98 1115 0.02% 99 1132 0.02% 100 1197 0.02% 101 1269 0.02% 102 1372 0.02% 103 1402 0.02% 104 1493 0.02% 105 1554 0.02% 106 1583 0.02% 107 1695 0.02% 108 1857 0.03% 109 1959 0.03% 110 2104 0.03% 111 2226 0.03% 112 2362 0.03% 113 2770 0.04% 114 3342 0.05% 115 3739 0.05% 116 3910 0.05% 117 3649 0.05% 118 3291 0.04% 119 3340 0.05% 120 3202 0.04% 121 3477 0.05% 122 3644 0.05% 123 3775 0.05% 124 4021 0.05% 125 4285 0.06% 126 4521 0.06% 127 4828 0.07% 128 5035 0.07% 129 5536 0.08% 130 5932 0.08% 131 6135 0.08% 132 6889 0.09% 133 7127 0.10% 134 7963 0.11% 135 8585 0.12% 136 9324 0.13% 137 10341 0.14% 138 11410 0.15% 139 12556 0.17% 140 14577 0.20% 141 16182 0.22% 142 18456 0.25% 143 21546 0.29% 144 26205 0.36% 145 33238 0.45% 146 44643 0.61% 147 64448 0.87% 148 110202 1.49% 149 262799 3.56% 150 1677839 22.75% 151 4892690 66.33% 7376336 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=10.24 fanout-score-rank=13 prefix-density=0.39 prefix-fanout=5.5 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=20 fanout-score=55.28 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=14.3 sequence=GATCTTCTTCTTGTC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=4.67 fanout-score-rank=27 prefix-density=0.25 prefix-fanout=3.8 sequence=GGCAAGACCATCACCCTTGAGGTGGAGTCATCTGACACCATCGA criterion=fanout-score sequence-density=0.07 sequence-density-rank=24 fanout-score=270.81 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=28.6 sequence=CAAGAAGAAGAT SRR6031182 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:41:14 Started mapping on | Dec 10 00:41:15 Finished on | Dec 10 00:43:11 Mapping speed, Million of reads per hour | 228.92 Number of input reads | 7376336 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 6808106 Uniquely mapped reads % | 92.30% Average mapped length | 299.29 Number of splices: Total | 7870250 Number of splices: Annotated (sjdb) | 7472772 Number of splices: GT/AG | 7769327 Number of splices: GC/AG | 91422 Number of splices: AT/AC | 4973 Number of splices: Non-canonical | 4528 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 61866 % of reads mapped to multiple loci | 0.84% Number of reads mapped to too many loci | 1887 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.61% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 512095 512095 512095 N_multimapping 61866 61866 61866 N_noFeature 271943 6622297 320434 N_ambiguous 166881 1455 29828 UnstrandedReadsAssigned:6369282 PositiveStrandReadsAssigned:184354 NegativeStrandReadsAssigned:6457844 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6031182 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6031182-trimmed-pair1.fastq SRR6031182-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,376,336 reads, 6,486,581 reads pseudoaligned [quant] estimated average fragment length: 450.165 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,105 rounds 52973 SRR6031182.ke.tsv 35125 SRR6031182.se.tsv 88098 total ==> SRR6031182.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 488.348 0 0 PNS24247 1044 594.835 39.8234 15.1209 PNS24249 1928 1478.84 10.6634 1.62859 PNS24246 1044 594.835 39.8234 15.1209 PNS24248 1044 594.835 39.8234 15.1209 PNS24244 1471 1021.84 23.8663 5.27521 PNS24243 293 64.3374 0 0 KQK14069 1603 1153.84 1879.84 367.97 KQK14071 474 129.549 5.07516 8.84809 ==> SRR6031182.se.tsv <== BRADI_1g14170v3 1937 BRADI_1g53295v3 26 BRADI_1g59795v3 260 BRADI_1g07683v3 0 BRADI_1g00485v3 15 BRADI_1g20270v3 583 BRADI_1g74790v3 46 BRADI_1g09890v3 1 BRADI_1g77505v3 101 BRADI_1g48960v3 0 SRR6031182 completed mapping pipeline successfully