Starting /dee2/code/volunteer_pipeline.sh SRR6031184 current disk space = 1523634069504 free memory = 1566270576 SRR6031184 SRAfilesize ce170c833bcbcaa809820842172c2d0e SRR6031184.sra SRR6031184.sra file validated SRR6031184 is paired end SRR6031184 is conventional basespace SRR6031184 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031184_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.66025 32.0 25.0 33.0 18.0 34.0 2 31.98 33.0 32.0 33.0 30.0 34.0 3 32.8025 33.0 33.0 33.0 31.0 34.0 4 33.31275 33.0 33.0 34.0 33.0 34.0 5 33.505 34.0 33.0 34.0 33.0 34.0 6 37.6245 38.0 38.0 38.0 37.0 38.0 7 37.802 38.0 38.0 38.0 38.0 38.0 8 37.834 38.0 38.0 38.0 38.0 38.0 9 37.77425 38.0 38.0 38.0 38.0 38.0 10-14 37.86935 38.0 38.0 38.0 38.0 38.0 15-19 37.85725000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.86015 38.0 38.0 38.0 38.0 38.0 25-29 37.814099999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.7829 38.0 38.0 38.0 38.0 38.0 35-39 37.7928 38.0 38.0 38.0 38.0 38.0 40-44 37.77515 38.0 38.0 38.0 38.0 38.0 45-49 37.736749999999994 38.0 38.0 38.0 38.0 38.0 50-54 37.68385 38.0 38.0 38.0 38.0 38.0 55-59 37.65945 38.0 38.0 38.0 38.0 38.0 60-64 37.6495 38.0 38.0 38.0 38.0 38.0 65-69 37.63325 38.0 38.0 38.0 38.0 38.0 70-74 37.6049 38.0 38.0 38.0 38.0 38.0 75-79 37.55215 38.0 38.0 38.0 38.0 38.0 80-84 37.47365 38.0 38.0 38.0 38.0 38.0 85-89 37.436150000000005 38.0 38.0 38.0 37.4 38.0 90-94 37.423899999999996 38.0 38.0 38.0 37.6 38.0 95-99 37.34804999999999 38.0 38.0 38.0 37.0 38.0 100-104 37.284099999999995 38.0 38.0 38.0 37.0 38.0 105-109 37.1984 38.0 38.0 38.0 36.8 38.0 110-114 37.17710000000001 38.0 38.0 38.0 36.2 38.0 115-119 37.098699999999994 38.0 38.0 38.0 36.0 38.0 120-124 36.93695 38.0 38.0 38.0 35.6 38.0 125-129 36.8976 38.0 38.0 38.0 35.2 38.0 130-134 36.84125 38.0 38.0 38.0 35.0 38.0 135-139 36.7025 38.0 38.0 38.0 35.0 38.0 140-144 36.49935 38.0 38.0 38.0 34.2 38.0 145-149 36.286950000000004 38.0 38.0 38.0 33.8 38.0 150-151 33.849000000000004 37.0 35.5 38.0 18.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 2.0 16 3.0 17 4.0 18 2.0 19 2.0 20 2.0 21 0.0 22 0.0 23 0.0 24 1.0 25 3.0 26 3.0 27 5.0 28 5.0 29 6.0 30 14.0 31 17.0 32 18.0 33 36.0 34 44.0 35 98.0 36 325.0 37 3406.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.92382861438236 13.355048859934854 9.897268854923578 32.823853670759206 2 23.075000000000003 12.975 34.8 29.15 3 19.525000000000002 17.7 25.124999999999996 37.65 4 22.5 22.425 24.25 30.825000000000003 5 23.9 26.85 24.975 24.275 6 24.95 31.674999999999997 23.25 20.125 7 16.625 27.1 37.425000000000004 18.85 8 19.125 27.425 28.4 25.05 9 19.125 23.65 32.324999999999996 24.9 10-14 20.96 28.42 27.51 23.11 15-19 20.945 26.779999999999998 28.12 24.154999999999998 20-24 21.36 27.365000000000002 27.12 24.154999999999998 25-29 21.41 27.089999999999996 26.810000000000002 24.69 30-34 21.385 27.165 27.37 24.08 35-39 21.005 28.1 26.655 24.240000000000002 40-44 21.04 27.13 26.97 24.86 45-49 21.51 27.405 27.22 23.865 50-54 21.740000000000002 26.950000000000003 26.924999999999997 24.385 55-59 21.404999999999998 26.529999999999998 27.51 24.555 60-64 21.145 27.42 26.86 24.575 65-69 21.29 27.395000000000003 26.72 24.595 70-74 21.72 27.634999999999998 26.555 24.09 75-79 21.765 27.389999999999997 26.729999999999997 24.115000000000002 80-84 21.055 27.084999999999997 27.644999999999996 24.215 85-89 21.790000000000003 26.775 27.05 24.385 90-94 21.375 26.96 27.16 24.505 95-99 21.18 27.35 26.995 24.474999999999998 100-104 21.535 27.255000000000003 26.76 24.45 105-109 22.18 26.605 26.740000000000002 24.474999999999998 110-114 20.96 27.334999999999997 27.215 24.490000000000002 115-119 21.725 27.305 26.645000000000003 24.325 120-124 21.78 26.035000000000004 27.534999999999997 24.65 125-129 21.325 27.315 26.619999999999997 24.740000000000002 130-134 21.375 27.045 27.200000000000003 24.38 135-139 21.790000000000003 27.279999999999998 26.705000000000002 24.224999999999998 140-144 21.805 26.974999999999998 26.700000000000003 24.52 145-149 22.235 26.340000000000003 27.025 24.4 150-151 22.3875 26.0625 27.35 24.2 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 1.0 6 2.0 7 1.0 8 0.5 9 1.0 10 1.5 11 1.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 0.5 26 0.5 27 3.5 28 5.5 29 7.5 30 9.0 31 12.0 32 19.5 33 34.0 34 46.5 35 60.0 36 76.5 37 82.5 38 118.0 39 158.5 40 178.5 41 191.5 42 201.5 43 228.0 44 243.0 45 253.0 46 233.5 47 209.5 48 193.0 49 179.0 50 175.5 51 148.5 52 132.0 53 112.5 54 96.5 55 87.5 56 74.0 57 65.5 58 53.5 59 40.5 60 34.5 61 31.5 62 26.0 63 27.0 64 28.0 65 22.0 66 16.0 67 14.0 68 14.5 69 11.0 70 8.5 71 6.5 72 4.0 73 5.0 74 4.0 75 2.0 76 1.0 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0911386013633 98.125 2 0.8331229487503155 1.6500000000000001 3 0.07573844988639232 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1125 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.21250000000000002 0.0 0.0 0.0 0.0 116-117 0.225 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.225 0.0 0.0 0.0 0.0 122-123 0.25 0.0 0.0 0.0 0.0 124-125 0.2625 0.0 0.0 0.0 0.0 126-127 0.3 0.0 0.0 0.0 0.0 128-129 0.3 0.0 0.0 0.0 0.0 130-131 0.3125 0.0 0.0 0.0 0.0 132-133 0.325 0.0 0.0 0.0 0.0 134-135 0.375 0.0 0.0 0.0 0.0 136-137 0.4375 0.0 0.0 0.0 0.0 138-139 0.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6031184 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031184_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.63575 34.0 33.0 34.0 33.0 34.0 2 32.775 34.0 33.0 34.0 33.0 34.0 3 32.8645 34.0 33.0 34.0 33.0 34.0 4 32.7995 34.0 33.0 34.0 33.0 34.0 5 32.8945 34.0 33.0 34.0 33.0 34.0 6 36.833 38.0 38.0 38.0 38.0 38.0 7 36.80175 38.0 38.0 38.0 38.0 38.0 8 36.83175 38.0 38.0 38.0 38.0 38.0 9 36.838 38.0 38.0 38.0 38.0 38.0 10-14 36.77015000000001 38.0 38.0 38.0 38.0 38.0 15-19 36.709399999999995 38.0 38.0 38.0 38.0 38.0 20-24 36.641400000000004 38.0 38.0 38.0 38.0 38.0 25-29 36.71035 38.0 38.0 38.0 38.0 38.0 30-34 36.971900000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.057100000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.081149999999994 38.0 38.0 38.0 38.0 38.0 45-49 37.108 38.0 38.0 38.0 38.0 38.0 50-54 37.0221 38.0 38.0 38.0 38.0 38.0 55-59 36.76129999999999 38.0 38.0 38.0 38.0 38.0 60-64 36.84395 38.0 38.0 38.0 38.0 38.0 65-69 36.7387 38.0 38.0 38.0 37.8 38.0 70-74 36.5741 38.0 38.0 38.0 37.2 38.0 75-79 36.70775 38.0 38.0 38.0 37.0 38.0 80-84 36.9519 38.0 38.0 38.0 37.2 38.0 85-89 36.94245 38.0 38.0 38.0 37.2 38.0 90-94 36.8799 38.0 38.0 38.0 37.2 38.0 95-99 36.832 38.0 38.0 38.0 37.0 38.0 100-104 36.62499999999999 38.0 38.0 38.0 36.6 38.0 105-109 36.373749999999994 38.0 38.0 38.0 36.0 38.0 110-114 36.320550000000004 38.0 38.0 38.0 36.0 38.0 115-119 36.2581 38.0 38.0 38.0 35.8 38.0 120-124 36.16255 38.0 38.0 38.0 35.0 38.0 125-129 36.385349999999995 38.0 38.0 38.0 35.0 38.0 130-134 36.3758 38.0 38.0 38.0 35.0 38.0 135-139 36.268299999999996 38.0 38.0 38.0 34.8 38.0 140-144 36.112 38.0 38.0 38.0 34.2 38.0 145-149 35.770450000000004 38.0 38.0 38.0 33.8 38.0 150-151 32.906625 37.0 34.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 52.0 3 4.0 4 3.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 6.0 17 6.0 18 9.0 19 7.0 20 2.0 21 13.0 22 4.0 23 5.0 24 12.0 25 7.0 26 8.0 27 6.0 28 10.0 29 19.0 30 17.0 31 16.0 32 22.0 33 37.0 34 56.0 35 86.0 36 225.0 37 3365.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.51662404092072 20.485933503836318 13.503836317135551 27.493606138107417 2 26.785714285714285 27.474489795918366 26.27551020408163 19.464285714285715 3 21.617497456765005 29.348931841302132 28.001017293997965 21.03255340793489 4 25.73398008680112 31.47817207046209 21.72581056931325 21.062037273423538 5 25.889227642276424 34.171747967479675 21.036585365853657 18.902439024390244 6 22.142674507798517 35.719764766044484 22.44950140628995 19.68805931986704 7 22.046035805626598 23.017902813299234 34.75703324808184 20.17902813299233 8 23.721881390593047 24.46319018404908 24.667689161554193 27.14723926380368 9 22.1144024514811 25.510725229826352 28.88151174668029 23.493360572012257 10-14 24.92331288343558 27.321063394683026 24.437627811860942 23.31799591002045 15-19 24.98207518180887 27.01526170234559 25.61712588343747 22.38553723240807 20-24 25.11649342004199 26.908699882226433 25.884581903835326 22.090224793896258 25-29 24.745589363334187 27.333162873945284 25.466632574789056 22.454615187931477 30-34 24.997463731358422 27.036623719184337 25.504717459673326 22.46119508978391 35-39 24.757035837214012 26.655193358979552 26.235067827495445 22.352702976310994 40-44 24.873660804527997 26.46048109965636 25.899535071760667 22.766323024054984 45-49 24.93940618056958 26.23712381337104 26.171480508988083 22.6519894970713 50-54 24.539753186324095 26.385798098320855 26.72466113696136 22.349787578393688 55-59 24.402939375382733 26.45948152684221 26.01041028781384 23.127168809961216 60-64 24.007330482590103 26.56281816330686 26.74608022805946 22.683771126043574 65-69 24.33052792654935 26.702371843917366 26.136189747513388 22.830910482019892 70-74 24.605936540429887 26.519959058341865 26.386898669396107 22.487205731832137 75-79 25.0127356087621 26.138563423331636 26.362710137544575 22.48599083036169 80-84 24.931866357121226 27.430099929342887 25.704047643080653 21.933986070455234 85-89 24.74278797659875 26.694573330643536 26.215452894896107 22.34718579786161 90-94 25.143605764385768 26.20175350196513 26.589741005744234 22.06489972790487 95-99 24.965914255415846 27.31909306670706 25.77892238549715 21.93607029237994 100-104 25.221103995120465 26.99501880654671 25.770051845074715 22.013825353258106 105-109 24.91692653749808 26.972036194468586 26.16941874137314 21.941618526660193 110-114 24.715996315627876 27.22853341520827 26.3125575683144 21.742912700849455 115-119 24.811721911983195 27.465546390696243 25.65192888979968 22.070802807520877 120-124 24.707564999744598 27.215610154773458 25.85176482607141 22.225060019410535 125-129 24.92912110166059 26.89347914135277 26.103685702713648 22.073714054272987 130-134 25.181744749596124 27.231421647819065 25.83299676898223 21.753836833602584 135-139 24.84637856351365 26.992041905913165 26.33726201269266 21.82431751788053 140-144 24.88421264599275 27.24526782118405 26.03705195328232 21.833467579540876 145-149 24.97364060852538 26.961891851182408 26.153537179294073 21.910930360998144 150-151 25.42929292929293 26.843434343434343 25.808080808080806 21.91919191919192 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 28.0 1 15.0 2 2.0 3 1.5 4 1.0 5 0.5 6 0.0 7 0.0 8 1.5 9 2.5 10 1.5 11 2.0 12 2.0 13 1.5 14 1.5 15 1.0 16 1.0 17 2.0 18 3.0 19 2.5 20 2.0 21 3.5 22 3.0 23 2.0 24 1.5 25 0.5 26 2.0 27 2.5 28 4.0 29 9.5 30 11.0 31 12.0 32 17.0 33 23.5 34 39.0 35 51.5 36 69.5 37 96.5 38 110.0 39 142.5 40 185.0 41 187.5 42 187.0 43 195.0 44 201.5 45 209.0 46 212.5 47 217.5 48 208.5 49 192.5 50 168.5 51 127.0 52 100.5 53 100.0 54 86.0 55 80.5 56 83.5 57 65.0 58 63.0 59 58.5 60 49.5 61 44.0 62 32.5 63 35.5 64 41.0 65 35.0 66 29.0 67 30.0 68 27.5 69 18.5 70 17.5 71 18.0 72 11.0 73 7.5 74 5.5 75 3.5 76 2.0 77 2.0 78 2.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.25 2 2.0 3 1.7000000000000002 4 2.075 5 1.6 6 2.225 7 2.25 8 2.1999999999999997 9 2.1 10-14 2.1999999999999997 15-19 2.37 20-24 2.355 25-29 2.225 30-34 1.43 35-39 1.22 40-44 1.06 45-49 0.98 50-54 1.1400000000000001 55-59 2.02 60-64 1.78 65-69 1.975 70-74 2.3 75-79 1.8499999999999999 80-84 0.9299999999999999 85-89 0.86 90-94 0.77 95-99 0.985 100-104 1.63 105-109 2.1950000000000003 110-114 2.29 115-119 2.405 120-124 2.1149999999999998 125-129 1.24 130-134 0.96 135-139 0.73 140-144 0.6799999999999999 145-149 0.415 150-151 1.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.66871479774706 96.35000000000001 2 1.0752688172043012 2.1 3 0.15360983102918588 0.44999999999999996 4 0.07680491551459294 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025601638504864313 0.8 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 32 0.8 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1125 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.21250000000000002 0.0 0.0 0.0 0.0 116-117 0.225 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.225 0.0 0.0 0.0 0.0 122-123 0.25 0.0 0.0 0.0 0.0 124-125 0.2625 0.0 0.0 0.0 0.0 126-127 0.3 0.0 0.0 0.0 0.0 128-129 0.3 0.0 0.0 0.0 0.0 130-131 0.3125 0.0 0.0 0.0 0.0 132-133 0.325 0.0 0.0 0.0 0.0 134-135 0.375 0.0 0.0 0.0 0.0 136-137 0.4375 0.0 0.0 0.0 0.0 138-139 0.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 615678 spots for SRR6031184.sra Written 615678 spots for SRR6031184.sra Read 615678 spots for SRR6031184.sra Written 615678 spots for SRR6031184.sra Read 615678 spots for SRR6031184.sra Written 615678 spots for SRR6031184.sra Read 615678 spots for SRR6031184.sra Written 615678 spots for SRR6031184.sra Read 615678 spots for SRR6031184.sra Written 615678 spots for SRR6031184.sra Read 615678 spots for SRR6031184.sra Written 615678 spots for SRR6031184.sra Read 615678 spots for SRR6031184.sra Written 615678 spots for SRR6031184.sra Read 615678 spots for SRR6031184.sra Written 615678 spots for SRR6031184.sra Read 615678 spots for SRR6031184.sra Written 615678 spots for SRR6031184.sra Read 615678 spots for SRR6031184.sra Written 615678 spots for SRR6031184.sra Read 615678 spots for SRR6031184.sra Written 615678 spots for SRR6031184.sra Read 615678 spots for SRR6031184.sra Written 615678 spots for SRR6031184.sra Read 615678 spots for SRR6031184.sra Written 615678 spots for SRR6031184.sra Read 615681 spots for SRR6031184.sra Written 615681 spots for SRR6031184.sra Read 615678 spots for SRR6031184.sra Written 615678 spots for SRR6031184.sra Read 615678 spots for SRR6031184.sra Written 615678 spots for SRR6031184.sra Read 615678 spots for SRR6031184.sra Written 615678 spots for SRR6031184.sra Read 615678 spots for SRR6031184.sra Written 615678 spots for SRR6031184.sra Read 615678 spots for SRR6031184.sra Written 615678 spots for SRR6031184.sra Read 615678 spots for SRR6031184.sra Written 615678 spots for SRR6031184.sra SRR ids: ['SRR6031184.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0pwet3kh SRR6031184.sra spots: 12313563 blocks: [[1, 615678], [615679, 1231356], [1231357, 1847034], [1847035, 2462712], [2462713, 3078390], [3078391, 3694068], [3694069, 4309746], [4309747, 4925424], [4925425, 5541102], [5541103, 6156780], [6156781, 6772458], [6772459, 7388136], [7388137, 8003814], [8003815, 8619492], [8619493, 9235170], [9235171, 9850848], [9850849, 10466526], [10466527, 11082204], [11082205, 11697882], [11697883, 12313563]] SRR6031184 file size 4150962 SRR6031184 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031184 SRR6031184_1.fastq SRR6031184_2.fastq Input file: SRR6031184_1.fastq Paired file: SRR6031184_2.fastq trimmed: SRR6031184-trimmed-pair1.fastq, SRR6031184-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:41:46 2024 >> started Tue Dec 10 00:41:59 2024 >> done (13.152s) 12313563 read pairs processed; of these: 7881 ( 0.06%) short read pairs filtered out after trimming by size control 17790 ( 0.14%) empty read pairs filtered out after trimming by size control 12287892 (99.79%) read pairs available; of these: 3258524 (26.52%) trimmed read pairs available after processing 9029368 (73.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 7 0.00% 21 3 0.00% 22 1 0.00% 23 9 0.00% 24 5 0.00% 25 9 0.00% 26 3 0.00% 27 4 0.00% 28 4 0.00% 29 3 0.00% 30 4 0.00% 31 5 0.00% 32 6 0.00% 33 3 0.00% 34 2 0.00% 35 4 0.00% 36 10 0.00% 37 5 0.00% 38 7 0.00% 39 6 0.00% 40 5 0.00% 41 5 0.00% 42 8 0.00% 43 8 0.00% 44 5 0.00% 45 8 0.00% 46 11 0.00% 47 6 0.00% 48 6 0.00% 49 17 0.00% 50 24 0.00% 51 27 0.00% 52 25 0.00% 53 19 0.00% 54 27 0.00% 55 17 0.00% 56 35 0.00% 57 38 0.00% 58 35 0.00% 59 57 0.00% 60 52 0.00% 61 43 0.00% 62 59 0.00% 63 46 0.00% 64 52 0.00% 65 73 0.00% 66 78 0.00% 67 69 0.00% 68 94 0.00% 69 109 0.00% 70 114 0.00% 71 143 0.00% 72 156 0.00% 73 160 0.00% 74 168 0.00% 75 174 0.00% 76 244 0.00% 77 301 0.00% 78 272 0.00% 79 316 0.00% 80 346 0.00% 81 374 0.00% 82 465 0.00% 83 479 0.00% 84 807 0.01% 85 1093 0.01% 86 1190 0.01% 87 1507 0.01% 88 1779 0.01% 89 2013 0.02% 90 1909 0.02% 91 1659 0.01% 92 1670 0.01% 93 1765 0.01% 94 1676 0.01% 95 1687 0.01% 96 1558 0.01% 97 1642 0.01% 98 1648 0.01% 99 1716 0.01% 100 1786 0.01% 101 1996 0.02% 102 1899 0.02% 103 1944 0.02% 104 2184 0.02% 105 2414 0.02% 106 2421 0.02% 107 2538 0.02% 108 2743 0.02% 109 3094 0.03% 110 3454 0.03% 111 3672 0.03% 112 3890 0.03% 113 4812 0.04% 114 6485 0.05% 115 7949 0.06% 116 8085 0.07% 117 6564 0.05% 118 5055 0.04% 119 4634 0.04% 120 4771 0.04% 121 4589 0.04% 122 4892 0.04% 123 5080 0.04% 124 5430 0.04% 125 5674 0.05% 126 5900 0.05% 127 6085 0.05% 128 6458 0.05% 129 6770 0.06% 130 7122 0.06% 131 7408 0.06% 132 7982 0.06% 133 8606 0.07% 134 9486 0.08% 135 9632 0.08% 136 10249 0.08% 137 11365 0.09% 138 12495 0.10% 139 13368 0.11% 140 14840 0.12% 141 16899 0.14% 142 18669 0.15% 143 21674 0.18% 144 27510 0.22% 145 38200 0.31% 146 64383 0.52% 147 65273 0.53% 148 121609 0.99% 149 300284 2.44% 150 2308006 18.78% 151 9029368 73.48% 12287892 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=31 prefix-density=0.23 prefix-fanout=2.4 sequence=CCCAGCTCACGTTCCCTATTGGTGGGTGAACAATCCAACACTTGGTGAATTCTGCTTCACAATGATAGGAAGAGCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTAGCTTCAAACTCCGAAGATCTAAAGGATCGATAGGCCACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTTTTACCCTTTTGTTCCACACGAGATTTCTGTTCTCGTTGAGCTCATCTTAGGACACCTGCGTTATCTTTTAACAGATGTGCCGCCCCAGCCAAACTCCCCACCTGACAATGTCTTCCGCCCGGATCGGCCCGGTCAGACCGGGCCTTGGAGCCAAAAGGAGGGGACTTGCCCCGCTTCCGACCCACGGAATAAGTAAAATAACGTTAAAAGTAGTGGTATTTCACTTGCGCCCGTAAAGGCTCCCACTTATCCTACACCTCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=152.04 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=9.8 sequence=TTTCCAGAATTCAAGACGTTAACAGTTCTTGGCGCAAATAGCGCTGAATCGCTTCTTTAAAGGCTGCAGCGTCGTCCTCAAATTTCGCACTGACCATAATGTGATCCCTTCCGGCGGTCGGTATAAAATCAGGCAGTTTTTGATCACGTTTATTGTAAGCCGTCAGCATCGGGATATCATCTGCTTCAAGCTCCTCAAGCAGCCGAAGCACTGTTTTTTCATGTCCCGCATAATCCTCATTTGAAGAATCAATTAAATGCAGAATTAAATCCGCTTCTTTTACTTCCTCAAGCGTTGAGCGGAATGCAGCAATCAATGTCGTCGGAAGATCCTGAATAAATCCTACTGTATCTGAAAGAAGAACACTGTAGCCGCTTGGCAGGACCATTTTTCTGGTCATCGGGTCCAGCGTGGCAAACAGGAGGTCTTCTTCATAGCTGTCAGCACTCGTCAGGCGGTTGAACCATGTTGATTTCCCTGCGTTTGTATAGCCGACAAGCGCAATTTGAAG criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=18.22 fanout-score-rank=11 prefix-density=0.55 prefix-fanout=9.0 sequence=AGGAAGAAGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=133.81 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.6 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTT SRR6031184 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:43:49 Started mapping on | Dec 10 00:43:49 Finished on | Dec 10 00:46:40 Mapping speed, Million of reads per hour | 258.69 Number of input reads | 12287892 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 11030370 Uniquely mapped reads % | 89.77% Average mapped length | 299.61 Number of splices: Total | 12720356 Number of splices: Annotated (sjdb) | 12126226 Number of splices: GT/AG | 12554710 Number of splices: GC/AG | 147695 Number of splices: AT/AC | 9250 Number of splices: Non-canonical | 8701 Mismatch rate per base, % | 0.16% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 118684 % of reads mapped to multiple loci | 0.97% Number of reads mapped to too many loci | 41874 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.74% % of reads unmapped: other | 3.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1144339 1144339 1144339 N_multimapping 118684 118684 118684 N_noFeature 407667 10697775 487013 N_ambiguous 293352 2309 40408 UnstrandedReadsAssigned:10329351 PositiveStrandReadsAssigned:330286 NegativeStrandReadsAssigned:10502949 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6031184 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6031184-trimmed-pair1.fastq SRR6031184-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,287,892 reads, 10,594,763 reads pseudoaligned [quant] estimated average fragment length: 421.397 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52973 SRR6031184.ke.tsv 35125 SRR6031184.se.tsv 88098 total ==> SRR6031184.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 516.652 0 0 PNS24247 1044 623.603 65.9604 13.8531 PNS24249 1928 1507.6 15.9396 1.38472 PNS24246 1044 623.603 65.9604 13.8531 PNS24248 1044 623.603 65.9604 13.8531 PNS24244 1471 1050.6 60.1791 7.50202 PNS24243 293 65.0567 0 0 KQK14069 1603 1182.6 2557.39 283.223 KQK14071 474 135.01 6.49391 6.29957 ==> SRR6031184.se.tsv <== BRADI_1g14170v3 2704 BRADI_1g53295v3 72 BRADI_1g59795v3 429 BRADI_1g07683v3 0 BRADI_1g00485v3 53 BRADI_1g20270v3 453 BRADI_1g74790v3 140 BRADI_1g09890v3 0 BRADI_1g77505v3 128 BRADI_1g48960v3 0 SRR6031184 completed mapping pipeline successfully