Starting /dee2/code/volunteer_pipeline.sh SRR6031185 current disk space = 1523642507264 free memory = 1599212040 SRR6031185 SRAfilesize 715f5d53c09b13924b90a316fa962386 SRR6031185.sra SRR6031185.sra file validated SRR6031185 is paired end SRR6031185 is conventional basespace SRR6031185 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031185_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.46975 25.0 18.0 30.0 18.0 33.0 2 30.181 31.0 29.0 33.0 27.0 33.0 3 31.8185 33.0 31.0 33.0 29.0 33.0 4 32.878 33.0 33.0 33.0 32.0 34.0 5 33.12925 33.0 33.0 34.0 33.0 34.0 6 37.1885 38.0 38.0 38.0 36.0 38.0 7 37.66275 38.0 38.0 38.0 38.0 38.0 8 37.7285 38.0 38.0 38.0 38.0 38.0 9 37.8025 38.0 38.0 38.0 38.0 38.0 10-14 37.8048 38.0 38.0 38.0 38.0 38.0 15-19 37.82275 38.0 38.0 38.0 38.0 38.0 20-24 37.85015 38.0 38.0 38.0 38.0 38.0 25-29 37.80544999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.7883 38.0 38.0 38.0 38.0 38.0 35-39 37.8101 38.0 38.0 38.0 38.0 38.0 40-44 37.788700000000006 38.0 38.0 38.0 38.0 38.0 45-49 37.769850000000005 38.0 38.0 38.0 38.0 38.0 50-54 37.70385 38.0 38.0 38.0 38.0 38.0 55-59 37.707100000000004 38.0 38.0 38.0 38.0 38.0 60-64 37.700900000000004 38.0 38.0 38.0 38.0 38.0 65-69 37.709950000000006 38.0 38.0 38.0 38.0 38.0 70-74 37.6627 38.0 38.0 38.0 38.0 38.0 75-79 37.64205 38.0 38.0 38.0 38.0 38.0 80-84 37.63375 38.0 38.0 38.0 38.0 38.0 85-89 37.57639999999999 38.0 38.0 38.0 38.0 38.0 90-94 37.53025 38.0 38.0 38.0 38.0 38.0 95-99 37.496449999999996 38.0 38.0 38.0 38.0 38.0 100-104 37.43625 38.0 38.0 38.0 37.6 38.0 105-109 37.35525 38.0 38.0 38.0 37.0 38.0 110-114 37.34125 38.0 38.0 38.0 37.2 38.0 115-119 37.269850000000005 38.0 38.0 38.0 36.4 38.0 120-124 37.182050000000004 38.0 38.0 38.0 36.0 38.0 125-129 37.15135 38.0 38.0 38.0 36.0 38.0 130-134 36.99425 38.0 38.0 38.0 35.6 38.0 135-139 37.0008 38.0 38.0 38.0 35.8 38.0 140-144 36.69349999999999 38.0 38.0 38.0 35.0 38.0 145-149 36.51129999999999 38.0 38.0 38.0 34.8 38.0 150-151 34.418375 38.0 35.5 38.0 27.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 1.0 19 2.0 20 1.0 21 1.0 22 1.0 23 3.0 24 1.0 25 3.0 26 2.0 27 4.0 28 6.0 29 10.0 30 8.0 31 13.0 32 24.0 33 26.0 34 50.0 35 87.0 36 316.0 37 3437.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.61839138060637 11.976948133299924 6.163868704585317 29.240791781508396 2 21.175 10.875 35.5 32.45 3 19.75 14.825 25.025 40.400000000000006 4 23.25 21.05 23.799999999999997 31.900000000000002 5 25.374999999999996 25.624999999999996 23.599999999999998 25.4 6 24.2393764143827 31.631883329142568 22.25295448830777 21.87578576816696 7 17.275 26.775 37.25 18.7 8 18.725 25.2 30.8 25.275 9 19.275000000000002 23.025000000000002 33.225 24.474999999999998 10-14 21.6 27.500000000000004 26.765 24.135 15-19 21.82 26.064999999999998 27.3 24.815 20-24 21.790000000000003 27.115000000000002 27.055 24.04 25-29 21.75 26.69 26.36 25.2 30-34 21.51 26.784999999999997 26.935 24.77 35-39 22.015 26.834999999999997 26.119999999999997 25.03 40-44 22.32 27.200000000000003 25.895000000000003 24.585 45-49 21.705 26.724999999999998 26.27 25.3 50-54 21.83 26.179999999999996 26.85 25.14 55-59 21.715 27.034999999999997 26.015 25.235000000000003 60-64 21.61 26.21 26.634999999999998 25.545 65-69 22.009999999999998 26.27 27.310000000000002 24.41 70-74 21.775 26.855 26.405 24.965 75-79 21.925 26.565 25.869999999999997 25.64 80-84 21.39 26.075 26.655 25.88 85-89 22.27 26.07 26.615 25.045 90-94 21.959999999999997 27.05 26.275 24.715 95-99 21.695 26.840000000000003 26.525 24.94 100-104 22.025 26.05 27.05 24.875 105-109 22.155 26.229999999999997 26.490000000000002 25.124999999999996 110-114 21.945 26.545 26.26 25.25 115-119 22.185 26.765 26.179999999999996 24.87 120-124 22.439999999999998 26.045 26.369999999999997 25.145 125-129 22.46 25.979999999999997 27.055 24.505 130-134 22.715 25.979999999999997 26.3 25.005 135-139 22.59 26.340000000000003 26.279999999999998 24.79 140-144 22.685 25.979999999999997 26.279999999999998 25.055 145-149 22.13 25.825 26.995 25.05 150-151 21.625 26.337500000000002 27.1625 24.875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 2.0 27 2.0 28 2.0 29 3.5 30 5.5 31 9.5 32 14.0 33 23.5 34 30.5 35 40.0 36 57.5 37 74.0 38 90.0 39 100.5 40 134.5 41 187.5 42 211.5 43 222.0 44 220.5 45 221.5 46 219.5 47 231.0 48 242.0 49 216.5 50 181.0 51 158.0 52 152.0 53 131.5 54 107.5 55 98.5 56 86.0 57 68.5 58 66.0 59 63.5 60 52.5 61 43.0 62 38.5 63 31.0 64 24.0 65 21.5 66 18.5 67 16.0 68 17.5 69 17.0 70 13.0 71 10.0 72 6.5 73 4.0 74 3.5 75 2.0 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.575 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47156517362859 98.825 2 0.4781077000503271 0.95 3 0.0 0.0 4 0.025163563160543533 0.1 5 0.025163563160543533 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGTGTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.1125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.125 0.0 0.0 0.0 0.0 116-117 0.1375 0.0 0.0 0.0 0.0 118-119 0.1875 0.0 0.0 0.0 0.0 120-121 0.2 0.0 0.0 0.0 0.0 122-123 0.2 0.0 0.0 0.0 0.0 124-125 0.2 0.0 0.0 0.0 0.0 126-127 0.225 0.0 0.0 0.0 0.0 128-129 0.2625 0.0 0.0 0.0 0.0 130-131 0.275 0.0 0.0 0.0 0.0 132-133 0.3125 0.0 0.0 0.0 0.0 134-135 0.3375 0.0 0.0 0.0 0.0 136-137 0.375 0.0 0.0 0.0 0.0 138-139 0.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6031185 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031185_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.35025 34.0 33.0 34.0 33.0 34.0 2 33.3945 34.0 33.0 34.0 33.0 34.0 3 33.328 34.0 33.0 34.0 33.0 34.0 4 33.319 34.0 33.0 34.0 33.0 34.0 5 33.30975 34.0 33.0 34.0 33.0 34.0 6 37.4825 38.0 38.0 38.0 38.0 38.0 7 37.5085 38.0 38.0 38.0 38.0 38.0 8 37.4805 38.0 38.0 38.0 38.0 38.0 9 37.54625 38.0 38.0 38.0 38.0 38.0 10-14 37.46025 38.0 38.0 38.0 38.0 38.0 15-19 37.3574 38.0 38.0 38.0 38.0 38.0 20-24 37.215250000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.374 38.0 38.0 38.0 38.0 38.0 30-34 37.559900000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.5712 38.0 38.0 38.0 38.0 38.0 40-44 37.53315 38.0 38.0 38.0 38.0 38.0 45-49 37.5414 38.0 38.0 38.0 38.0 38.0 50-54 37.54305000000001 38.0 38.0 38.0 38.0 38.0 55-59 37.460300000000004 38.0 38.0 38.0 38.0 38.0 60-64 37.49185000000001 38.0 38.0 38.0 38.0 38.0 65-69 37.44895 38.0 38.0 38.0 38.0 38.0 70-74 37.3341 38.0 38.0 38.0 38.0 38.0 75-79 37.42165 38.0 38.0 38.0 38.0 38.0 80-84 37.388549999999995 38.0 38.0 38.0 37.8 38.0 85-89 37.36409999999999 38.0 38.0 38.0 37.8 38.0 90-94 37.25085 38.0 38.0 38.0 37.0 38.0 95-99 37.267250000000004 38.0 38.0 38.0 37.0 38.0 100-104 37.21795 38.0 38.0 38.0 37.0 38.0 105-109 37.0602 38.0 38.0 38.0 36.6 38.0 110-114 36.9348 38.0 38.0 38.0 36.0 38.0 115-119 36.779149999999994 38.0 38.0 38.0 36.0 38.0 120-124 36.7392 38.0 38.0 38.0 35.2 38.0 125-129 36.827999999999996 38.0 38.0 38.0 35.2 38.0 130-134 36.7527 38.0 38.0 38.0 35.2 38.0 135-139 36.6342 38.0 38.0 38.0 35.0 38.0 140-144 36.490750000000006 38.0 38.0 38.0 35.0 38.0 145-149 36.19420000000001 38.0 38.0 38.0 34.6 38.0 150-151 33.588875 37.0 35.0 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 2.0 17 1.0 18 0.0 19 3.0 20 5.0 21 3.0 22 8.0 23 6.0 24 8.0 25 6.0 26 6.0 27 11.0 28 14.0 29 13.0 30 21.0 31 23.0 32 37.0 33 33.0 34 62.0 35 115.0 36 272.0 37 3342.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.8 21.7 8.774999999999999 25.724999999999998 2 27.206801700425103 29.132283070767688 25.28132033008252 18.37959489872468 3 22.464312546957174 27.0473328324568 28.424743300776356 22.063611319809667 4 26.842105263157894 31.353383458646615 20.852130325814535 20.952380952380953 5 27.536958155850666 32.44800801804059 20.245552493109496 19.76948133299925 6 23.716503881793138 36.714249937390434 20.26045579764588 19.30879038317055 7 22.113698973203107 22.113698973203107 34.41021788129226 21.362384172301528 8 23.74749498997996 25.025050100200403 25.025050100200403 26.20240480961924 9 22.202753441802255 24.30538172715895 28.48560700876095 25.00625782227785 10-14 24.925979826366238 27.78642043458624 24.10297586189592 23.1846238771516 15-19 25.434804463657386 26.249120337790288 25.163365838946415 23.15270935960591 20-24 24.650693568726357 26.09331651954603 25.825977301387137 23.430012610340476 25-29 25.636646742679194 25.938017981817268 25.546235370937765 22.879099904565773 30-34 24.785 26.355 25.39 23.47 35-39 25.055 26.77 25.255 22.919999999999998 40-44 25.575 25.615 25.96 22.85 45-49 25.255 26.045 25.255 23.445 50-54 24.68 26.534999999999997 25.8 22.985 55-59 25.736472945891787 25.53607214428858 25.516032064128257 23.21142284569138 60-64 24.765 26.07 25.89 23.275000000000002 65-69 25.212606303151574 26.568284142071036 25.302651325662833 22.916458229114557 70-74 25.60040110303334 26.061669591376287 25.424918525946357 22.913010779644022 75-79 24.89 26.22 25.77 23.119999999999997 80-84 25.195 25.835 26.27 22.7 85-89 25.169999999999998 26.040000000000003 25.45 23.34 90-94 25.255 26.35 25.5 22.895 95-99 24.985 26.724999999999998 25.6 22.689999999999998 100-104 25.252525252525253 26.307630763076308 25.302530253025303 23.137313731373137 105-109 25.347378981690493 26.25031351893654 25.849009280160523 22.55329821921244 110-114 25.099241244158588 25.953469674890712 26.335360032159187 22.611929048791517 115-119 25.2201922592984 26.020433841662893 25.381247168956666 23.378126730082037 120-124 25.480166491148886 26.8291459806429 25.26954515821674 22.421142369991475 125-129 25.324999999999996 26.919999999999998 25.52 22.235 130-134 25.215 26.51 25.324999999999996 22.95 135-139 25.655 26.135 25.695 22.515 140-144 25.130000000000003 26.75 25.480000000000004 22.64 145-149 25.330000000000002 26.224999999999998 25.665 22.78 150-151 25.05 26.400000000000002 26.2875 22.2625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 1.0 22 1.5 23 2.0 24 1.5 25 0.5 26 1.5 27 1.5 28 5.0 29 7.5 30 12.0 31 17.0 32 16.0 33 21.5 34 25.5 35 30.5 36 46.5 37 78.0 38 104.0 39 118.0 40 145.0 41 181.0 42 201.0 43 207.0 44 205.0 45 212.5 46 207.5 47 205.5 48 194.5 49 174.0 50 165.0 51 145.0 52 121.0 53 106.0 54 106.0 55 93.0 56 79.0 57 80.5 58 79.5 59 66.5 60 56.0 61 50.0 62 49.0 63 44.0 64 46.0 65 48.5 66 41.0 67 32.0 68 26.5 69 29.5 70 31.5 71 27.0 72 18.5 73 12.0 74 9.5 75 5.0 76 3.5 77 2.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.17500000000000002 4 0.25 5 0.22499999999999998 6 0.17500000000000002 7 0.17500000000000002 8 0.2 9 0.125 10-14 0.365 15-19 0.53 20-24 0.8750000000000001 25-29 0.455 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.2 60-64 0.0 65-69 0.05 70-74 0.27499999999999997 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.01 105-109 0.325 110-114 0.49500000000000005 115-119 0.655 120-124 0.295 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21736935117394 98.25 2 0.6059075990911386 1.2 3 0.15147689977278464 0.44999999999999996 4 0.025246149962130777 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.1125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.125 0.0 0.0 0.0 0.0 116-117 0.1375 0.0 0.0 0.0 0.0 118-119 0.1875 0.0 0.0 0.0 0.0 120-121 0.2 0.0 0.0 0.0 0.0 122-123 0.2 0.0 0.0 0.0 0.0 124-125 0.2 0.0 0.0 0.0 0.0 126-127 0.225 0.0 0.0 0.0 0.0 128-129 0.2625 0.0 0.0 0.0 0.0 130-131 0.275 0.0 0.0 0.0 0.0 132-133 0.3125 0.0 0.0 0.0 0.0 134-135 0.3375 0.0 0.0 0.0 0.0 136-137 0.375 0.0 0.0 0.0 0.0 138-139 0.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 776410 spots for SRR6031185.sra Written 776410 spots for SRR6031185.sra Read 776410 spots for SRR6031185.sra Written 776410 spots for SRR6031185.sra Read 776410 spots for SRR6031185.sra Written 776410 spots for SRR6031185.sra Read 776410 spots for SRR6031185.sra Written 776410 spots for SRR6031185.sra Read 776410 spots for SRR6031185.sra Written 776410 spots for SRR6031185.sra Read 776410 spots for SRR6031185.sra Written 776410 spots for SRR6031185.sra Read 776410 spots for SRR6031185.sra Written 776410 spots for SRR6031185.sra Read 776410 spots for SRR6031185.sra Written 776410 spots for SRR6031185.sra Read 776410 spots for SRR6031185.sra Written 776410 spots for SRR6031185.sra Read 776410 spots for SRR6031185.sra Written 776410 spots for SRR6031185.sra Read 776410 spots for SRR6031185.sra Written 776410 spots for SRR6031185.sra Read 776410 spots for SRR6031185.sra Written 776410 spots for SRR6031185.sra Read 776410 spots for SRR6031185.sra Written 776410 spots for SRR6031185.sra Read 776425 spots for SRR6031185.sra Written 776425 spots for SRR6031185.sra Read 776410 spots for SRR6031185.sra Written 776410 spots for SRR6031185.sra Read 776410 spots for SRR6031185.sra Written 776410 spots for SRR6031185.sra Read 776410 spots for SRR6031185.sra Written 776410 spots for SRR6031185.sra Read 776410 spots for SRR6031185.sra Written 776410 spots for SRR6031185.sra Read 776410 spots for SRR6031185.sra Written 776410 spots for SRR6031185.sra Read 776410 spots for SRR6031185.sra Written 776410 spots for SRR6031185.sra SRR ids: ['SRR6031185.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wuqxp7xm SRR6031185.sra spots: 15528215 blocks: [[1, 776410], [776411, 1552820], [1552821, 2329230], [2329231, 3105640], [3105641, 3882050], [3882051, 4658460], [4658461, 5434870], [5434871, 6211280], [6211281, 6987690], [6987691, 7764100], [7764101, 8540510], [8540511, 9316920], [9316921, 10093330], [10093331, 10869740], [10869741, 11646150], [11646151, 12422560], [12422561, 13198970], [13198971, 13975380], [13975381, 14751790], [14751791, 15528215]] SRR6031185 file size 5240302 SRR6031185 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031185 SRR6031185_1.fastq SRR6031185_2.fastq Input file: SRR6031185_1.fastq Paired file: SRR6031185_2.fastq trimmed: SRR6031185-trimmed-pair1.fastq, SRR6031185-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:43:09 2024 >> started Tue Dec 10 00:43:27 2024 >> done (18.329s) 15528215 read pairs processed; of these: 10342 ( 0.07%) short read pairs filtered out after trimming by size control 8677 ( 0.06%) empty read pairs filtered out after trimming by size control 15509196 (99.88%) read pairs available; of these: 3731745 (24.06%) trimmed read pairs available after processing 11777451 (75.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 9 0.00% 20 9 0.00% 21 12 0.00% 22 8 0.00% 23 13 0.00% 24 10 0.00% 25 7 0.00% 26 7 0.00% 27 6 0.00% 28 9 0.00% 29 6 0.00% 30 9 0.00% 31 8 0.00% 32 8 0.00% 33 8 0.00% 34 13 0.00% 35 13 0.00% 36 9 0.00% 37 11 0.00% 38 12 0.00% 39 8 0.00% 40 9 0.00% 41 9 0.00% 42 9 0.00% 43 12 0.00% 44 19 0.00% 45 13 0.00% 46 12 0.00% 47 18 0.00% 48 16 0.00% 49 16 0.00% 50 23 0.00% 51 14 0.00% 52 27 0.00% 53 31 0.00% 54 18 0.00% 55 31 0.00% 56 32 0.00% 57 36 0.00% 58 31 0.00% 59 46 0.00% 60 41 0.00% 61 51 0.00% 62 70 0.00% 63 83 0.00% 64 82 0.00% 65 81 0.00% 66 101 0.00% 67 96 0.00% 68 102 0.00% 69 106 0.00% 70 100 0.00% 71 157 0.00% 72 169 0.00% 73 192 0.00% 74 201 0.00% 75 213 0.00% 76 280 0.00% 77 316 0.00% 78 280 0.00% 79 343 0.00% 80 346 0.00% 81 465 0.00% 82 456 0.00% 83 519 0.00% 84 1006 0.01% 85 1299 0.01% 86 1400 0.01% 87 1551 0.01% 88 1650 0.01% 89 1726 0.01% 90 1692 0.01% 91 1653 0.01% 92 1717 0.01% 93 1778 0.01% 94 1718 0.01% 95 1731 0.01% 96 1709 0.01% 97 1909 0.01% 98 1883 0.01% 99 1974 0.01% 100 2054 0.01% 101 2192 0.01% 102 2237 0.01% 103 2316 0.01% 104 2489 0.02% 105 2746 0.02% 106 2688 0.02% 107 2673 0.02% 108 3014 0.02% 109 3059 0.02% 110 3393 0.02% 111 3444 0.02% 112 3885 0.03% 113 4079 0.03% 114 4709 0.03% 115 5348 0.03% 116 5668 0.04% 117 5448 0.04% 118 5191 0.03% 119 5355 0.03% 120 5848 0.04% 121 5889 0.04% 122 6267 0.04% 123 6386 0.04% 124 6560 0.04% 125 7033 0.05% 126 7338 0.05% 127 7714 0.05% 128 8192 0.05% 129 8795 0.06% 130 9366 0.06% 131 9987 0.06% 132 10630 0.07% 133 11512 0.07% 134 12260 0.08% 135 13193 0.09% 136 14315 0.09% 137 15704 0.10% 138 17410 0.11% 139 18798 0.12% 140 21233 0.14% 141 23498 0.15% 142 26810 0.17% 143 30748 0.20% 144 36442 0.23% 145 46455 0.30% 146 61249 0.39% 147 86574 0.56% 148 144265 0.93% 149 341610 2.20% 150 2605806 16.80% 151 11777451 75.94% 15509196 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=35 prefix-density=0.30 prefix-fanout=2.0 sequence=TACCCTTTTGTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=124.79 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=12.3 sequence=CTCCTCATCCCGGTGCATGAAGTTCATGGCGCCGTCGAAGTGCGCGTTGCGGTGGCCGCACTTGGGGGCGTTCACGGGGAGCATCAGGTAGTTTGGGCCGAGGCGGTAGCGCTGGGTGTCGGCGTAGGCGAAGACCCGGCATTGGAGCATCTTGTCGTCCGAGTAGTAGATCCCGGGCACGATCAGGCCTGGGCCGAAGGCGAGCTGCTCGTTCTCGTTGAAGAAGTTGTCCACGTTTCGGTCCAGGACCAGGCGGCCCACGGGCCGGAGTGGGAGGAGGTCTTCGGGCCAGGTCTTGGTATCGTCTAATGGGTCGAAGTCGT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=4.56 fanout-score-rank=25 prefix-density=0.24 prefix-fanout=3.7 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=719.07 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=20.9 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR6031185 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:44:15 Started mapping on | Dec 10 00:44:16 Finished on | Dec 10 00:45:45 Mapping speed, Million of reads per hour | 627.34 Number of input reads | 15509196 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 14024029 Uniquely mapped reads % | 90.42% Average mapped length | 299.83 Number of splices: Total | 16056286 Number of splices: Annotated (sjdb) | 15243006 Number of splices: GT/AG | 15844448 Number of splices: GC/AG | 190500 Number of splices: AT/AC | 9927 Number of splices: Non-canonical | 11411 Mismatch rate per base, % | 0.08% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 258828 % of reads mapped to multiple loci | 1.67% Number of reads mapped to too many loci | 77014 % of reads mapped to too many loci | 0.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.72% % of reads unmapped: other | 3.69% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1234674 1234674 1234674 N_multimapping 258828 258828 258828 N_noFeature 720718 13655329 823893 N_ambiguous 334861 3280 70787 UnstrandedReadsAssigned:12968450 PositiveStrandReadsAssigned:365420 NegativeStrandReadsAssigned:13129349 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6031185 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6031185-trimmed-pair1.fastq SRR6031185-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,509,196 reads, 13,298,288 reads pseudoaligned [quant] estimated average fragment length: 450.862 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52973 SRR6031185.ke.tsv 35125 SRR6031185.se.tsv 88098 total ==> SRR6031185.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 488.015 0 0 PNS24247 1044 594.138 73.8199 13.1782 PNS24249 1928 1478.14 41.6793 2.99072 PNS24246 1044 594.138 73.8199 13.1782 PNS24248 1044 594.138 73.8199 13.1782 PNS24244 1471 1021.14 22.861 2.37455 PNS24243 293 61.5836 0 0 KQK14069 1603 1153.14 6447.45 593.031 KQK14071 474 125.764 25.4574 21.4698 ==> SRR6031185.se.tsv <== BRADI_1g14170v3 7050 BRADI_1g53295v3 123 BRADI_1g59795v3 502 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 893 BRADI_1g74790v3 172 BRADI_1g09890v3 0 BRADI_1g77505v3 171 BRADI_1g48960v3 0 SRR6031185 completed mapping pipeline successfully