Starting /dee2/code/volunteer_pipeline.sh SRR6126812 current disk space = 1526115110912 free memory = 1460421028 SRR6126812 SRAfilesize ef5ddef6301204a10252371e8af07552 SRR6126812.sra SRR6126812.sra file validated SRR6126812 is single end SRR6126812 is conventional basespace SRR6126812 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6126812_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.50675 35.0 35.0 35.0 35.0 35.0 2 34.73825 35.0 35.0 35.0 35.0 35.0 3 34.772 35.0 35.0 35.0 35.0 35.0 4 34.7655 35.0 35.0 35.0 35.0 35.0 5 34.78575 35.0 35.0 35.0 35.0 35.0 6 38.8055 39.0 39.0 40.0 37.0 40.0 7 39.23775 40.0 39.0 40.0 39.0 40.0 8 39.46225 40.0 39.0 40.0 39.0 40.0 9 39.529 40.0 40.0 40.0 39.0 40.0 10-11 39.561375 40.0 40.0 40.0 39.0 40.0 12-13 39.595875 40.0 40.0 40.0 39.0 40.0 14-15 39.57325 40.0 40.0 40.0 39.0 40.0 16-17 39.53975 40.0 40.0 40.0 39.0 40.0 18-19 39.535250000000005 40.0 40.0 40.0 39.0 40.0 20-21 39.56975 40.0 40.0 40.0 39.0 40.0 22-23 39.540125 40.0 40.0 40.0 39.0 40.0 24-25 39.5225 40.0 40.0 40.0 39.0 40.0 26-27 39.497125 40.0 40.0 40.0 39.0 40.0 28-29 39.518125 40.0 40.0 40.0 39.0 40.0 30-31 39.5025 40.0 40.0 40.0 39.0 40.0 32-33 39.514875 40.0 40.0 40.0 39.0 40.0 34-35 39.53075 40.0 40.0 40.0 39.0 40.0 36-37 39.528125 40.0 40.0 40.0 39.0 40.0 38-39 39.506 40.0 40.0 40.0 39.0 40.0 40-41 39.466375 40.0 39.5 40.0 39.0 40.0 42-43 39.457750000000004 40.0 40.0 40.0 39.0 40.0 44-45 39.46025 40.0 39.0 40.0 39.0 40.0 46-47 39.466499999999996 40.0 40.0 40.0 39.0 40.0 48-49 39.370374999999996 40.0 39.0 40.0 39.0 40.0 50-51 39.4105 40.0 39.5 40.0 39.0 40.0 52-53 39.431375 40.0 39.0 40.0 39.0 40.0 54-55 39.414125 40.0 39.0 40.0 39.0 40.0 56-57 39.395250000000004 40.0 39.0 40.0 39.0 40.0 58-59 39.3515 40.0 39.0 40.0 39.0 40.0 60-61 39.373374999999996 40.0 39.0 40.0 39.0 40.0 62-63 39.368875 40.0 39.0 40.0 39.0 40.0 64-65 39.369749999999996 40.0 39.0 40.0 39.0 40.0 66-67 39.405125 40.0 39.0 40.0 39.0 40.0 68-69 39.2685 40.0 39.0 40.0 39.0 40.0 70-71 39.30025 40.0 39.0 40.0 39.0 40.0 72-73 39.31925 40.0 39.0 40.0 39.0 40.0 74-75 39.217 40.0 39.0 40.0 38.0 40.0 76-77 39.183875 40.0 39.0 40.0 38.0 40.0 78-79 39.1755 40.0 39.0 40.0 38.0 40.0 80-81 39.186 40.0 39.0 40.0 38.5 40.0 82-83 39.228125000000006 40.0 39.0 40.0 38.0 40.0 84-85 39.17675 40.0 39.0 40.0 38.0 40.0 86-87 39.15325 40.0 39.0 40.0 38.0 40.0 88-89 39.13375 40.0 39.0 40.0 38.0 40.0 90-91 39.131 40.0 39.0 40.0 38.0 40.0 92-93 39.088375 40.0 39.0 40.0 38.0 40.0 94-95 39.075 40.0 39.0 40.0 38.0 40.0 96-97 39.088125000000005 40.0 39.0 40.0 38.0 40.0 98-99 39.098375 40.0 39.0 40.0 38.0 40.0 100-101 37.745375 39.5 37.5 39.5 34.5 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 0.0 23 0.0 24 0.0 25 2.0 26 2.0 27 1.0 28 5.0 29 13.0 30 4.0 31 14.0 32 7.0 33 11.0 34 23.0 35 25.0 36 46.0 37 84.0 38 448.0 39 3313.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.63727959697733 8.89168765743073 8.53904282115869 50.93198992443325 2 21.525 11.450000000000001 37.3 29.725 3 21.95 14.725 22.85 40.475 4 26.900000000000002 22.15 19.775000000000002 31.175000000000004 5 27.900000000000002 25.724999999999998 22.725 23.65 6 24.224999999999998 30.4 23.525 21.85 7 18.75 22.525000000000002 37.95 20.775 8 19.975 21.975 32.125 25.924999999999997 9 21.325 19.075 33.675 25.924999999999997 10-11 23.962500000000002 28.725 22.525000000000002 24.7875 12-13 23.775 21.1125 26.6625 28.449999999999996 14-15 23.025000000000002 23.1375 27.3 26.5375 16-17 23.6625 24.1875 25.8625 26.2875 18-19 23.7375 23.625 24.425 28.212500000000002 20-21 23.4625 24.099999999999998 25.412499999999998 27.025 22-23 23.8375 25.174999999999997 24.5375 26.450000000000003 24-25 23.849999999999998 22.7125 25.624999999999996 27.8125 26-27 23.8625 22.7125 26.2625 27.1625 28-29 23.2625 23.7125 25.9625 27.0625 30-31 23.7375 23.6625 24.05 28.549999999999997 32-33 24.087500000000002 23.6375 25.2 27.075 34-35 24.0125 23.849999999999998 25.7625 26.375 36-37 23.8125 23.6375 25.025 27.525 38-39 22.8875 23.5125 25.7375 27.8625 40-41 24.25 24.025 25.1 26.625 42-43 24.6875 24.1375 24.6125 26.5625 44-45 24.046517444041516 23.558834562961113 25.534575465799676 26.860072527197698 46-47 24.6125 24.4125 24.637500000000003 26.337500000000002 48-49 23.887705226218824 22.78481012658228 26.28148890838451 27.045995738814387 50-51 22.475 23.974999999999998 26.125 27.425 52-53 24.2875 23.2625 25.75 26.700000000000003 54-55 23.258722020757787 23.121170438914593 25.697136426159812 27.92297111416781 56-57 23.575 22.85 26.025 27.55 58-59 22.821057896711267 24.284106539952482 25.484556708765787 27.410278854570464 60-61 24.462500000000002 22.925 25.637500000000003 26.974999999999998 62-63 24.275 23.3875 25.6125 26.724999999999998 64-65 23.2875 23.8625 25.924999999999997 26.924999999999997 66-67 23.2625 23.375 25.0625 28.299999999999997 68-69 22.870741482965933 24.19839679358717 25.789078156312623 27.14178356713427 70-71 24.125 23.875 24.675 27.325 72-73 23.7625 24.125 25.162499999999998 26.950000000000003 74-75 23.625 23.674999999999997 25.6 27.1 76-77 24.337500000000002 23.4375 25.412499999999998 26.8125 78-79 24.1125 24.6625 24.2 27.025 80-81 24.0375 24.087500000000002 25.137500000000003 26.737499999999997 82-83 25.0 24.4125 23.95 26.637499999999996 84-85 24.2625 24.1125 25.0 26.625 86-87 24.5125 24.587500000000002 24.85 26.05 88-89 24.55 25.6125 23.3375 26.5 90-91 24.2375 24.25 24.875 26.637499999999996 92-93 24.5125 24.837500000000002 25.124999999999996 25.525 94-95 24.875 25.2125 23.3125 26.6 96-97 23.3875 25.900000000000002 23.4625 27.250000000000004 98-99 24.0375 25.35 23.8125 26.8 100-101 24.9 24.8 23.525 26.775 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 0.5 28 1.5 29 3.0 30 3.5 31 2.5 32 3.0 33 4.5 34 9.0 35 16.5 36 27.5 37 32.0 38 39.5 39 61.5 40 81.0 41 96.5 42 116.5 43 147.5 44 162.5 45 162.0 46 170.0 47 180.5 48 187.0 49 182.5 50 176.5 51 167.0 52 161.5 53 167.0 54 167.0 55 170.5 56 171.5 57 169.5 58 138.5 59 116.5 60 130.0 61 109.0 62 82.0 63 78.0 64 69.5 65 53.5 66 43.0 67 37.5 68 31.0 69 23.0 70 20.5 71 13.5 72 4.0 73 2.5 74 2.5 75 2.5 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0375 46-47 0.0 48-49 0.2625 50-51 0.0 52-53 0.0 54-55 0.0375 56-57 0.0 58-59 0.0375 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.2 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.325 #Duplication Level Percentage of deduplicated Percentage of total 1 96.4857067925518 91.975 2 2.5963808025177024 4.95 3 0.6818777865198007 1.95 4 0.15735641227380015 0.6 5 0.026226068712300026 0.125 6 0.026226068712300026 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026226068712300026 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC 10 0.25 TruSeq Adapter, Index 3 (100% over 50bp) CCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCA 6 0.15 No Hit CTTTCTTTTCCTCTGGCTACTAAGATGTTTCAGTTCGCCAGGTTGTCTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.225 0.0 0.0 0.0 0.0 60-61 0.3375 0.0 0.0 0.0 0.0 62-63 0.4125 0.0 0.0 0.0 0.0 64-65 0.44999999999999996 0.0 0.0 0.0 0.0 66-67 0.625 0.0 0.0 0.0 0.0 68-69 0.875 0.0 0.0 0.0 0.0 70-71 1.1625 0.0 0.0 0.0 0.0 72-73 1.5375 0.0 0.0 0.0 0.0 74-75 2.0375 0.0 0.0 0.0 0.0 76-77 2.35 0.0 0.0 0.0 0.0 78-79 2.8125 0.0 0.0 0.0 0.0 80-81 3.425 0.0 0.0 0.0 0.0 82-83 4.1625 0.0 0.0 0.0 0.0 84-85 4.9125 0.0 0.0 0.0 0.0 86-87 5.8875 0.0 0.0 0.0 0.0 88-89 6.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 519209 spots for SRR6126812.sra Written 519209 spots for SRR6126812.sra Read 519209 spots for SRR6126812.sra Written 519209 spots for SRR6126812.sra Read 519209 spots for SRR6126812.sra Written 519209 spots for SRR6126812.sra Read 519209 spots for SRR6126812.sra Written 519209 spots for SRR6126812.sra Read 519209 spots for SRR6126812.sra Written 519209 spots for SRR6126812.sra Read 519209 spots for SRR6126812.sra Written 519209 spots for SRR6126812.sra Read 519209 spots for SRR6126812.sra Written 519209 spots for SRR6126812.sra Read 519209 spots for SRR6126812.sra Written 519209 spots for SRR6126812.sra Read 519209 spots for SRR6126812.sra Written 519209 spots for SRR6126812.sra Read 519209 spots for SRR6126812.sra Written 519209 spots for SRR6126812.sra Read 519209 spots for SRR6126812.sra Written 519209 spots for SRR6126812.sra Read 519209 spots for SRR6126812.sra Written 519209 spots for SRR6126812.sra Read 519209 spots for SRR6126812.sra Written 519209 spots for SRR6126812.sra Read 519209 spots for SRR6126812.sra Written 519209 spots for SRR6126812.sra Read 519209 spots for SRR6126812.sra Written 519209 spots for SRR6126812.sra Read 519209 spots for SRR6126812.sra Written 519209 spots for SRR6126812.sra Read 519220 spots for SRR6126812.sra Written 519220 spots for SRR6126812.sra Read 519209 spots for SRR6126812.sra Written 519209 spots for SRR6126812.sra Read 519209 spots for SRR6126812.sra Written 519209 spots for SRR6126812.sra Read 519209 spots for SRR6126812.sra Written 519209 spots for SRR6126812.sra SRR ids: ['SRR6126812.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9de5z7b8 SRR6126812.sra spots: 10384191 blocks: [[1, 519209], [519210, 1038418], [1038419, 1557627], [1557628, 2076836], [2076837, 2596045], [2596046, 3115254], [3115255, 3634463], [3634464, 4153672], [4153673, 4672881], [4672882, 5192090], [5192091, 5711299], [5711300, 6230508], [6230509, 6749717], [6749718, 7268926], [7268927, 7788135], [7788136, 8307344], [8307345, 8826553], [8826554, 9345762], [9345763, 9864971], [9864972, 10384191]] SRR6126812 file size 2843773 SRR6126812 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6126812 SRR6126812_1.fastq Input file: SRR6126812_1.fastq trimmed: SRR6126812-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 04:58:53 2024 >> started Tue Dec 10 04:59:01 2024 >> done (7.460s) 10384191 reads processed; of these: 1866 ( 0.02%) short reads filtered out after trimming by size control 37912 ( 0.37%) empty reads filtered out after trimming by size control 10344413 (99.62%) reads available; of these: 324641 ( 3.14%) trimmed reads available after processing 10019772 (96.86%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 49 0.00% 19 38 0.00% 20 32 0.00% 21 35 0.00% 22 43 0.00% 23 43 0.00% 24 44 0.00% 25 61 0.00% 26 45 0.00% 27 54 0.00% 28 68 0.00% 29 99 0.00% 30 130 0.00% 31 147 0.00% 32 181 0.00% 33 186 0.00% 34 197 0.00% 35 248 0.00% 36 246 0.00% 37 281 0.00% 38 351 0.00% 39 411 0.00% 40 518 0.01% 41 603 0.01% 42 655 0.01% 43 706 0.01% 44 746 0.01% 45 869 0.01% 46 981 0.01% 47 1143 0.01% 48 1371 0.01% 49 1561 0.02% 50 1760 0.02% 51 1983 0.02% 52 2454 0.02% 53 2489 0.02% 54 2749 0.03% 55 3068 0.03% 56 3364 0.03% 57 3929 0.04% 58 4408 0.04% 59 5078 0.05% 60 5942 0.06% 61 6778 0.07% 62 7738 0.07% 63 8761 0.08% 64 9941 0.10% 65 10674 0.10% 66 11529 0.11% 67 12806 0.12% 68 14064 0.14% 69 14668 0.14% 70 338 0.00% 71 995 0.01% 72 8216 0.08% 73 5138 0.05% 74 432 0.00% 75 144 0.00% 76 148 0.00% 77 160 0.00% 78 144 0.00% 79 180 0.00% 80 220 0.00% 81 328 0.00% 82 229 0.00% 83 321 0.00% 84 299 0.00% 85 341 0.00% 86 445 0.00% 87 421 0.00% 88 501 0.00% 89 525 0.01% 90 824 0.01% 91 1052 0.01% 92 950 0.01% 93 1197 0.01% 94 1572 0.02% 95 1856 0.02% 96 2587 0.03% 97 3587 0.03% 98 7045 0.07% 99 12026 0.12% 100 126095 1.22% 101 10019772 96.86% 10344413 reads passed initial QC criterion=sequence-density sequence-density=6.40 sequence-density-rank=1 fanout-score=55.07 fanout-score-rank=1 prefix-density=7.98 prefix-fanout=44.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=6.40 sequence-density-rank=1 fanout-score=55.07 fanout-score-rank=1 prefix-density=7.98 prefix-fanout=44.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR6126812 - Input file: STDIN trimmed: SRR6126812-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Tue Dec 10 04:59:25 2024 >> started Tue Dec 10 04:59:36 2024 >> done (10.822s) 7388867 reads processed; of these: 10 ( 0.00%) short reads filtered out after trimming by size control 11167 ( 0.15%) empty reads filtered out after trimming by size control 7377690 (99.85%) reads available; of these: 1070966 (14.52%) trimmed reads available after processing 6306724 (85.48%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 34 0.00% 19 28 0.00% 20 24 0.00% 21 22 0.00% 22 30 0.00% 23 29 0.00% 24 30 0.00% 25 47 0.00% 26 29 0.00% 27 50 0.00% 28 50 0.00% 29 72 0.00% 30 87 0.00% 31 110 0.00% 32 132 0.00% 33 135 0.00% 34 137 0.00% 35 187 0.00% 36 176 0.00% 37 199 0.00% 38 241 0.00% 39 300 0.00% 40 385 0.01% 41 435 0.01% 42 463 0.01% 43 510 0.01% 44 542 0.01% 45 613 0.01% 46 688 0.01% 47 842 0.01% 48 972 0.01% 49 1131 0.02% 50 1272 0.02% 51 1441 0.02% 52 1752 0.02% 53 1779 0.02% 54 1951 0.03% 55 2230 0.03% 56 2419 0.03% 57 2863 0.04% 58 3177 0.04% 59 3689 0.05% 60 4243 0.06% 61 4827 0.07% 62 5577 0.08% 63 6271 0.08% 64 7161 0.10% 65 7621 0.10% 66 8304 0.11% 67 9076 0.12% 68 9974 0.14% 69 10576 0.14% 70 12265 0.17% 71 13460 0.18% 72 15257 0.21% 73 16840 0.23% 74 18087 0.25% 75 19309 0.26% 76 20412 0.28% 77 21771 0.30% 78 22849 0.31% 79 25534 0.35% 80 26492 0.36% 81 28047 0.38% 82 29923 0.41% 83 31247 0.42% 84 33372 0.45% 85 36031 0.49% 86 36875 0.50% 87 37503 0.51% 88 39076 0.53% 89 39536 0.54% 90 40070 0.54% 91 42303 0.57% 92 43684 0.59% 93 45447 0.62% 94 47211 0.64% 95 50242 0.68% 96 56999 0.77% 97 78074 1.06% 98 158102 2.14% 99 7442 0.10% 100 76776 1.04% 101 6102521 82.72% criterion=sequence-density sequence-density=0.97 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=27 prefix-density=0.98 prefix-fanout=2.0 sequence=TTCGCTATCGGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=44.54 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.1 sequence=AGCAGCTCGAGCAATCCGCCGACAGCCGACGGGTTTGGGGCCGGGACCCCCGAGCCCAGTCCTCAGAGCCAATCCTTTTCCCGAAGTTACGGATCCGTTTTGCCGACTTCCCTTGCCTACATTGTTCCATTGGCCAGAGGCTGTTCACCTTGGAGACCTGATGCGGTTATGAGTACGACCGGGCGTGAACGGTACTCGGTCCTCCGGATTTTCATGGGCCGCCGGGGGCGCACCGGACACCGCGCGACGTGCGGTGCTCTTCCGGCCACTGGACCCTACCTCCGGCTGAACCGATTCCAGGGTTGGCAGGCCGTTAAGCAGAAAAGATAACTCTTCCCGAGGCCCCCGCCGGCGTCTCCGGACTTCCTAACGTCGCCGTCAACCGCCACATCCCGGCTCGGGAAATCTTAACCCGATTCCCTTTCGGGGGATACGCGTGATCGCGCTATCTGCCGGGGTTACCCCGTCCCTTAGGATCGGCTTACCCATGTGCAAGTGCCGTTCACATGGA Started job on | Dec 10 05:00:01 Started mapping on | Dec 10 05:00:02 Finished on | Dec 10 05:00:27 Mapping speed, Million of reads per hour | 1487.99 Number of input reads | 10333236 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 7644229 Uniquely mapped reads % | 73.98% Average mapped length | 98.45 Number of splices: Total | 2373258 Number of splices: Annotated (sjdb) | 2244215 Number of splices: GT/AG | 2338104 Number of splices: GC/AG | 29554 Number of splices: AT/AC | 860 Number of splices: Non-canonical | 4740 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.85 Insertion rate per base | 0.01% Insertion average length | 1.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1500973 % of reads mapped to multiple loci | 14.53% Number of reads mapped to too many loci | 898005 % of reads mapped to too many loci | 8.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.22% % of reads unmapped: other | 0.59% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1188034 1188034 1188034 N_multimapping 1500973 1500973 1500973 N_noFeature 350488 7441311 409684 N_ambiguous 161132 501 17723 UnstrandedReadsAssigned:7132609 PositiveStrandReadsAssigned:202417 NegativeStrandReadsAssigned:7216822 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR6126812 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6126812-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,333,236 reads, 7,472,858 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,121 rounds 52973 SRR6126812.ke.tsv 35125 SRR6126812.se.tsv 88098 total ==> SRR6126812.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 20.4919 4.56553 PNS24249 1928 1829 8.00438 0.921413 PNS24246 1044 945 20.4919 4.56553 PNS24248 1044 945 20.4919 4.56553 PNS24244 1471 1372 59.5199 9.13375 PNS24243 293 194 0 0 KQK14069 1603 1504 7684.89 1075.8 KQK14071 474 375 604.927 339.635 ==> SRR6126812.se.tsv <== BRADI_1g14170v3 9726 BRADI_1g53295v3 5 BRADI_1g59795v3 199 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 94 BRADI_1g74790v3 28 BRADI_1g09890v3 0 BRADI_1g77505v3 81 BRADI_1g48960v3 0 SRR6126812 completed mapping pipeline successfully