Starting /dee2/code/volunteer_pipeline.sh SRR6126813 current disk space = 1526116225024 free memory = 1599116636 SRR6126813 SRAfilesize 7ca4c7da63428a3f859962200d8b24d3 SRR6126813.sra SRR6126813.sra file validated SRR6126813 is single end SRR6126813 is conventional basespace SRR6126813 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6126813_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.55225 35.0 35.0 35.0 35.0 35.0 2 34.697 35.0 35.0 35.0 35.0 35.0 3 34.713 35.0 35.0 35.0 35.0 35.0 4 34.72075 35.0 35.0 35.0 35.0 35.0 5 34.74225 35.0 35.0 35.0 35.0 35.0 6 38.90425 39.0 39.0 40.0 37.0 40.0 7 39.27875 40.0 39.0 40.0 39.0 40.0 8 39.45075 40.0 39.0 40.0 39.0 40.0 9 39.46475 40.0 39.0 40.0 39.0 40.0 10-11 39.522999999999996 40.0 40.0 40.0 39.0 40.0 12-13 39.562375 40.0 40.0 40.0 39.0 40.0 14-15 39.5745 40.0 40.0 40.0 39.0 40.0 16-17 39.559250000000006 40.0 40.0 40.0 39.0 40.0 18-19 39.54875 40.0 40.0 40.0 39.0 40.0 20-21 39.56975 40.0 40.0 40.0 39.0 40.0 22-23 39.561125000000004 40.0 40.0 40.0 39.0 40.0 24-25 39.546625000000006 40.0 40.0 40.0 39.0 40.0 26-27 39.533 40.0 40.0 40.0 39.0 40.0 28-29 39.52475 40.0 40.0 40.0 39.0 40.0 30-31 39.536249999999995 40.0 40.0 40.0 39.0 40.0 32-33 39.501125 40.0 40.0 40.0 39.0 40.0 34-35 39.515625 40.0 40.0 40.0 39.0 40.0 36-37 39.50175 40.0 40.0 40.0 39.0 40.0 38-39 39.50625 40.0 40.0 40.0 39.0 40.0 40-41 39.468500000000006 40.0 39.5 40.0 39.0 40.0 42-43 39.486125 40.0 40.0 40.0 39.0 40.0 44-45 39.504125 40.0 40.0 40.0 39.0 40.0 46-47 39.485625 40.0 40.0 40.0 39.0 40.0 48-49 39.502875 40.0 39.5 40.0 39.0 40.0 50-51 39.464875 40.0 39.5 40.0 39.0 40.0 52-53 39.464375000000004 40.0 39.0 40.0 39.0 40.0 54-55 39.404250000000005 40.0 39.0 40.0 39.0 40.0 56-57 39.43075 40.0 39.0 40.0 39.0 40.0 58-59 39.409875 40.0 39.0 40.0 39.0 40.0 60-61 39.392875000000004 40.0 39.0 40.0 39.0 40.0 62-63 39.397375 40.0 39.0 40.0 39.0 40.0 64-65 39.409125 40.0 39.0 40.0 39.0 40.0 66-67 39.403625000000005 40.0 39.0 40.0 39.0 40.0 68-69 39.318875000000006 40.0 39.0 40.0 39.0 40.0 70-71 39.354375000000005 40.0 39.0 40.0 39.0 40.0 72-73 39.34925 40.0 39.0 40.0 39.0 40.0 74-75 39.179249999999996 40.0 39.0 40.0 38.5 40.0 76-77 39.196 40.0 39.0 40.0 39.0 40.0 78-79 39.186125000000004 40.0 39.0 40.0 38.0 40.0 80-81 39.1405 40.0 39.0 40.0 38.0 40.0 82-83 39.1485 40.0 39.0 40.0 38.0 40.0 84-85 39.168125 40.0 39.0 40.0 38.0 40.0 86-87 39.135374999999996 40.0 39.0 40.0 38.0 40.0 88-89 39.09 40.0 39.0 40.0 38.0 40.0 90-91 39.070625 40.0 39.0 40.0 38.0 40.0 92-93 39.051625 40.0 39.0 40.0 38.0 40.0 94-95 39.09325 40.0 39.0 40.0 38.0 40.0 96-97 38.99425 40.0 39.0 40.0 38.0 40.0 98-99 38.985 40.0 39.0 40.0 38.0 40.0 100-101 37.549375 39.5 37.0 39.5 34.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 3.0 22 1.0 23 0.0 24 0.0 25 2.0 26 1.0 27 3.0 28 8.0 29 5.0 30 8.0 31 7.0 32 11.0 33 11.0 34 14.0 35 21.0 36 38.0 37 85.0 38 458.0 39 3321.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.522012578616355 9.459119496855346 8.176100628930817 50.84276729559748 2 21.0 11.774999999999999 36.9 30.325000000000003 3 21.725 13.200000000000001 23.625 41.449999999999996 4 27.498121712997747 21.838216879539193 19.383921863260706 31.279739544202357 5 28.075 27.224999999999998 23.974999999999998 20.724999999999998 6 23.375 30.925000000000004 22.275 23.425 7 19.625 23.25 36.925000000000004 20.200000000000003 8 20.8 21.55 31.8 25.85 9 21.4 18.5 33.725 26.375 10-11 24.087500000000002 28.287499999999998 22.412499999999998 25.2125 12-13 23.875 22.0625 26.974999999999998 27.0875 14-15 23.4375 23.599999999999998 26.075 26.887499999999996 16-17 25.112499999999997 22.9875 24.5 27.400000000000002 18-19 23.2625 24.337500000000002 26.5 25.900000000000002 20-21 23.8875 24.6 25.5625 25.95 22-23 23.9125 25.112499999999997 24.349999999999998 26.625 24-25 23.9375 24.275 24.2875 27.500000000000004 26-27 23.0375 25.0125 25.3125 26.637499999999996 28-29 24.25 22.925 25.837500000000002 26.987499999999997 30-31 23.175 23.8875 25.0125 27.925 32-33 23.674999999999997 23.974999999999998 25.05 27.3 34-35 24.0 24.025 25.837500000000002 26.137500000000003 36-37 23.7625 24.099999999999998 25.8125 26.325 38-39 23.1125 24.0 25.624999999999996 27.2625 40-41 24.65 23.2125 25.35 26.787499999999998 42-43 23.8375 23.799999999999997 25.8 26.5625 44-45 23.8125 23.549999999999997 25.9875 26.650000000000002 46-47 23.45 23.849999999999998 25.837500000000002 26.8625 48-49 23.875 22.900000000000002 26.0375 27.187499999999996 50-51 23.1 24.175 25.35 27.375 52-53 23.5625 24.099999999999998 24.7 27.6375 54-55 23.525 24.087500000000002 25.7125 26.674999999999997 56-57 22.975 23.225 26.5 27.3 58-59 23.8375 24.1625 25.7125 26.2875 60-61 24.099999999999998 23.9875 25.087500000000002 26.825 62-63 24.1875 23.45 26.1625 26.200000000000003 64-65 24.1125 23.8875 25.4 26.6 66-67 23.0875 24.675 25.775 26.4625 68-69 24.81852315394243 24.267834793491865 26.14518147684606 24.76846057571965 70-71 24.678084760595073 23.81547693461683 24.065508188523566 27.440930116264532 72-73 24.4125 24.425 25.124999999999996 26.0375 74-75 24.5625 23.325000000000003 25.5 26.6125 76-77 24.2875 24.325 24.4125 26.974999999999998 78-79 24.05 24.4 25.525 26.025 80-81 23.8875 24.8125 24.375 26.924999999999997 82-83 25.2375 24.6875 23.5625 26.5125 84-85 24.6 24.5375 24.1125 26.75 86-87 24.8 24.3875 24.175 26.637499999999996 88-89 24.575 24.95 23.875 26.6 90-91 24.7875 24.8625 23.1 27.250000000000004 92-93 25.275 24.762500000000003 24.0375 25.924999999999997 94-95 25.7625 25.3 23.6125 25.324999999999996 96-97 23.95 25.074999999999996 23.425 27.55 98-99 24.3125 25.0625 24.0625 26.5625 100-101 24.4375 24.9875 23.9 26.674999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 0.5 28 0.5 29 2.5 30 2.5 31 4.0 32 6.0 33 6.0 34 11.0 35 15.0 36 21.5 37 36.5 38 45.5 39 57.0 40 77.0 41 104.0 42 129.0 43 140.5 44 158.5 45 172.5 46 181.5 47 192.5 48 181.0 49 180.5 50 183.0 51 173.0 52 155.5 53 154.0 54 159.5 55 166.0 56 173.5 57 147.0 58 132.5 59 124.5 60 107.5 61 99.0 62 94.5 63 86.5 64 75.0 65 56.5 66 49.0 67 48.0 68 35.5 69 20.0 70 11.5 71 8.0 72 6.0 73 4.5 74 1.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.0 3 0.0 4 0.17500000000000002 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.125 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 96.5670859538784 92.125 2 2.515723270440252 4.8 3 0.7075471698113208 2.025 4 0.07861635220125787 0.3 5 0.07861635220125787 0.375 6 0.026205450733752623 0.15 7 0.0 0.0 8 0.0 0.0 9 0.026205450733752623 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC 9 0.22499999999999998 TruSeq Adapter, Index 3 (100% over 50bp) CCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCA 6 0.15 No Hit GTGGTATTTCACTTGCGCCCGTAAAGGCTCCCACTTATCCTACACCTCTC 5 0.125 No Hit CCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCA 5 0.125 No Hit ATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCC 5 0.125 TruSeq Adapter, Index 3 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.037500000000000006 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.0625 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.175 0.0 0.0 0.0 0.0 52-53 0.2625 0.0 0.0 0.0 0.0 54-55 0.2875 0.0 0.0 0.0 0.0 56-57 0.3375 0.0 0.0 0.0 0.0 58-59 0.4 0.0 0.0 0.0 0.0 60-61 0.45 0.0 0.0 0.0 0.0 62-63 0.525 0.0 0.0 0.0 0.0 64-65 0.65 0.0 0.0 0.0 0.0 66-67 0.7375 0.0 0.0 0.0 0.0 68-69 0.9624999999999999 0.0 0.0 0.0 0.0 70-71 1.3125 0.0 0.0 0.0 0.0 72-73 1.7875 0.0 0.0 0.0 0.0 74-75 2.3 0.0 0.0 0.0 0.0 76-77 2.7625 0.0 0.0 0.0 0.0 78-79 3.4 0.0 0.0 0.0 0.0 80-81 3.85 0.0 0.0 0.0 0.0 82-83 4.7125 0.0 0.0 0.0 0.0 84-85 5.6125 0.0 0.0 0.0 0.0 86-87 6.3 0.0 0.0 0.0 0.0 88-89 7.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 527816 spots for SRR6126813.sra Written 527816 spots for SRR6126813.sra Read 527816 spots for SRR6126813.sra Written 527816 spots for SRR6126813.sra Read 527816 spots for SRR6126813.sra Written 527816 spots for SRR6126813.sra Read 527816 spots for SRR6126813.sra Written 527816 spots for SRR6126813.sra Read 527816 spots for SRR6126813.sra Written 527816 spots for SRR6126813.sra Read 527816 spots for SRR6126813.sra Written 527816 spots for SRR6126813.sra Read 527816 spots for SRR6126813.sra Written 527816 spots for SRR6126813.sra Read 527816 spots for SRR6126813.sra Written 527816 spots for SRR6126813.sra Read 527816 spots for SRR6126813.sra Written 527816 spots for SRR6126813.sra Read 527816 spots for SRR6126813.sra Written 527816 spots for SRR6126813.sra Read 527816 spots for SRR6126813.sra Written 527816 spots for SRR6126813.sra Read 527819 spots for SRR6126813.sra Written 527819 spots for SRR6126813.sra Read 527816 spots for SRR6126813.sra Written 527816 spots for SRR6126813.sra Read 527816 spots for SRR6126813.sra Written 527816 spots for SRR6126813.sra Read 527816 spots for SRR6126813.sra Written 527816 spots for SRR6126813.sra Read 527816 spots for SRR6126813.sra Written 527816 spots for SRR6126813.sra Read 527816 spots for SRR6126813.sra Written 527816 spots for SRR6126813.sra Read 527816 spots for SRR6126813.sra Written 527816 spots for SRR6126813.sra Read 527816 spots for SRR6126813.sra Written 527816 spots for SRR6126813.sra Read 527816 spots for SRR6126813.sra Written 527816 spots for SRR6126813.sra SRR ids: ['SRR6126813.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e63uhced SRR6126813.sra spots: 10556323 blocks: [[1, 527816], [527817, 1055632], [1055633, 1583448], [1583449, 2111264], [2111265, 2639080], [2639081, 3166896], [3166897, 3694712], [3694713, 4222528], [4222529, 4750344], [4750345, 5278160], [5278161, 5805976], [5805977, 6333792], [6333793, 6861608], [6861609, 7389424], [7389425, 7917240], [7917241, 8445056], [8445057, 8972872], [8972873, 9500688], [9500689, 10028504], [10028505, 10556323]] SRR6126813 file size 2891051 SRR6126813 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6126813 SRR6126813_1.fastq Input file: SRR6126813_1.fastq trimmed: SRR6126813-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 04:59:28 2024 >> started Tue Dec 10 04:59:36 2024 >> done (7.378s) 10556323 reads processed; of these: 1779 ( 0.02%) short reads filtered out after trimming by size control 38325 ( 0.36%) empty reads filtered out after trimming by size control 10516219 (99.62%) reads available; of these: 328460 ( 3.12%) trimmed reads available after processing 10187759 (96.88%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 43 0.00% 19 32 0.00% 20 39 0.00% 21 34 0.00% 22 45 0.00% 23 37 0.00% 24 52 0.00% 25 43 0.00% 26 47 0.00% 27 55 0.00% 28 93 0.00% 29 108 0.00% 30 105 0.00% 31 141 0.00% 32 169 0.00% 33 207 0.00% 34 232 0.00% 35 241 0.00% 36 263 0.00% 37 320 0.00% 38 356 0.00% 39 426 0.00% 40 488 0.00% 41 622 0.01% 42 676 0.01% 43 700 0.01% 44 769 0.01% 45 893 0.01% 46 982 0.01% 47 1172 0.01% 48 1403 0.01% 49 1648 0.02% 50 1783 0.02% 51 2047 0.02% 52 2398 0.02% 53 2574 0.02% 54 2783 0.03% 55 3150 0.03% 56 3461 0.03% 57 3803 0.04% 58 4514 0.04% 59 5234 0.05% 60 6022 0.06% 61 7023 0.07% 62 7912 0.08% 63 8865 0.08% 64 10032 0.10% 65 10840 0.10% 66 11991 0.11% 67 13124 0.12% 68 14325 0.14% 69 15122 0.14% 70 228 0.00% 71 682 0.01% 72 6218 0.06% 73 4673 0.04% 74 489 0.00% 75 172 0.00% 76 170 0.00% 77 172 0.00% 78 215 0.00% 79 244 0.00% 80 214 0.00% 81 317 0.00% 82 247 0.00% 83 278 0.00% 84 318 0.00% 85 397 0.00% 86 421 0.00% 87 442 0.00% 88 557 0.01% 89 595 0.01% 90 689 0.01% 91 821 0.01% 92 968 0.01% 93 1212 0.01% 94 1492 0.01% 95 1909 0.02% 96 2606 0.02% 97 3714 0.04% 98 6133 0.06% 99 12162 0.12% 100 130261 1.24% 101 10187759 96.88% 10516219 reads passed initial QC criterion=sequence-density sequence-density=6.42 sequence-density-rank=1 fanout-score=54.87 fanout-score-rank=1 prefix-density=8.01 prefix-fanout=44.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTGA criterion=fanout-score sequence-density=6.42 sequence-density-rank=1 fanout-score=54.87 fanout-score-rank=1 prefix-density=8.01 prefix-fanout=44.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTGA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTGA -o SRR6126813 - Input file: STDIN trimmed: SRR6126813-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Tue Dec 10 05:00:15 2024 >> started Tue Dec 10 05:00:27 2024 >> done (11.658s) 7511585 reads processed; of these: 6 ( 0.00%) short reads filtered out after trimming by size control 8981 ( 0.12%) empty reads filtered out after trimming by size control 7502598 (99.88%) reads available; of these: 1093417 (14.57%) trimmed reads available after processing 6409181 (85.43%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 30 0.00% 19 25 0.00% 20 32 0.00% 21 27 0.00% 22 38 0.00% 23 31 0.00% 24 36 0.00% 25 29 0.00% 26 34 0.00% 27 37 0.00% 28 62 0.00% 29 81 0.00% 30 81 0.00% 31 98 0.00% 32 110 0.00% 33 155 0.00% 34 166 0.00% 35 175 0.00% 36 195 0.00% 37 230 0.00% 38 259 0.00% 39 303 0.00% 40 333 0.00% 41 453 0.01% 42 488 0.01% 43 482 0.01% 44 570 0.01% 45 615 0.01% 46 705 0.01% 47 838 0.01% 48 1018 0.01% 49 1151 0.02% 50 1281 0.02% 51 1466 0.02% 52 1747 0.02% 53 1809 0.02% 54 2008 0.03% 55 2289 0.03% 56 2476 0.03% 57 2739 0.04% 58 3257 0.04% 59 3775 0.05% 60 4342 0.06% 61 5025 0.07% 62 5628 0.08% 63 6294 0.08% 64 7105 0.09% 65 7733 0.10% 66 8610 0.11% 67 9279 0.12% 68 10226 0.14% 69 10896 0.15% 70 12378 0.16% 71 13706 0.18% 72 15473 0.21% 73 17550 0.23% 74 18766 0.25% 75 19626 0.26% 76 20889 0.28% 77 21932 0.29% 78 23335 0.31% 79 26140 0.35% 80 27246 0.36% 81 28744 0.38% 82 30566 0.41% 83 31982 0.43% 84 34023 0.45% 85 36314 0.48% 86 37605 0.50% 87 38093 0.51% 88 40131 0.53% 89 40525 0.54% 90 40582 0.54% 91 43314 0.58% 92 44441 0.59% 93 46553 0.62% 94 48581 0.65% 95 50672 0.68% 96 58448 0.78% 97 79420 1.06% 98 160829 2.14% 99 7493 0.10% 100 78449 1.05% 101 6201920 82.66% criterion=sequence-density sequence-density=0.98 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=29 prefix-density=0.98 prefix-fanout=2.0 sequence=TTCGCTATCGGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=46.57 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.0 sequence=AGCAGCTCGAGCAATCCGCCGACAGCCGACGGGTTTGGGGCCGGGACCCCCGAGCCCAGTCCTCAGAGCCAATCCTTTTCCCGAAGTTACGGATCCGTTTTGCCGACTTCCCTTGCCTACATTGTTCCATTGGCCAGAGGCTGTTCACCTTGGAGACCTGATGCGGTTATGAGTACGACCGGGCGTGAACGGTACTCGGTCCTCCGGATTTTCATGGGCCGCCGGGGGCGCACCGGACACCGCGCGACGTGCGGTGCTCTTCCGGCCACTGGACCCTACCTCCGGCTGAACCGATTCCAGGGTTGGCAGGCCGTTAAGCAGAAAAGATAACTCTTCCCGAGGCCCCCGCCGGCGTCTCCGGACTTCCTAACGTCGCCGTCAACCGCCACATCCCGGCTCGGGAAATCTTAACCCGATTCCCTTTCGGGGGATACGCGTGATCGCGCTATCTGCCGGGGTTACCCCGTCCCTTAGGATCGGCTTACCCATGTGCAAGTGCCGTTCACATGGA Started job on | Dec 10 05:00:50 Started mapping on | Dec 10 05:00:50 Finished on | Dec 10 05:01:09 Mapping speed, Million of reads per hour | 1990.84 Number of input reads | 10507232 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 7774966 Uniquely mapped reads % | 74.00% Average mapped length | 98.45 Number of splices: Total | 2418346 Number of splices: Annotated (sjdb) | 2286516 Number of splices: GT/AG | 2382242 Number of splices: GC/AG | 30422 Number of splices: AT/AC | 853 Number of splices: Non-canonical | 4829 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 1.85 Insertion rate per base | 0.01% Insertion average length | 1.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1526297 % of reads mapped to multiple loci | 14.53% Number of reads mapped to too many loci | 932623 % of reads mapped to too many loci | 8.88% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.21% % of reads unmapped: other | 0.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1205969 1205969 1205969 N_multimapping 1526297 1526297 1526297 N_noFeature 357436 7568460 417398 N_ambiguous 164369 503 18180 UnstrandedReadsAssigned:7253161 PositiveStrandReadsAssigned:206003 NegativeStrandReadsAssigned:7339388 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR6126813 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6126813-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,507,232 reads, 7,604,406 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52973 SRR6126813.ke.tsv 35125 SRR6126813.se.tsv 88098 total ==> SRR6126813.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 22.6844 5.60447 PNS24247 1044 945 13.1118 2.86921 PNS24249 1928 1829 11.3221 1.2801 PNS24246 1044 945 13.1118 2.86921 PNS24248 1044 945 13.1118 2.86921 PNS24244 1471 1372 49.658 7.48458 PNS24243 293 194 0 0 KQK14069 1603 1504 7914.22 1088.16 KQK14071 474 375 633.687 349.442 ==> SRR6126813.se.tsv <== BRADI_1g14170v3 9936 BRADI_1g53295v3 8 BRADI_1g59795v3 192 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 74 BRADI_1g74790v3 24 BRADI_1g09890v3 0 BRADI_1g77505v3 62 BRADI_1g48960v3 0 SRR6126813 completed mapping pipeline successfully