Starting /dee2/code/volunteer_pipeline.sh SRR6126814 current disk space = 1526036549632 free memory = 1550397576 SRR6126814 SRAfilesize 755e435fad5347d7cdbdfb309230d4d7 SRR6126814.sra SRR6126814.sra file validated SRR6126814 is single end SRR6126814 is conventional basespace SRR6126814 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6126814_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.536 35.0 35.0 35.0 35.0 35.0 2 34.76 35.0 35.0 35.0 35.0 35.0 3 34.81475 35.0 35.0 35.0 35.0 35.0 4 34.7885 35.0 35.0 35.0 35.0 35.0 5 34.8575 35.0 35.0 35.0 35.0 35.0 6 38.99275 39.0 39.0 40.0 38.0 40.0 7 39.38575 40.0 39.0 40.0 39.0 40.0 8 39.56875 40.0 40.0 40.0 39.0 40.0 9 39.60375 40.0 40.0 40.0 39.0 40.0 10-11 39.647875 40.0 40.0 40.0 39.0 40.0 12-13 39.652625 40.0 40.0 40.0 39.0 40.0 14-15 39.619749999999996 40.0 40.0 40.0 39.0 40.0 16-17 39.631 40.0 40.0 40.0 39.0 40.0 18-19 39.6335 40.0 40.0 40.0 39.0 40.0 20-21 39.637875 40.0 40.0 40.0 39.0 40.0 22-23 39.646625 40.0 40.0 40.0 39.0 40.0 24-25 39.60275 40.0 40.0 40.0 39.0 40.0 26-27 39.627125 40.0 40.0 40.0 39.0 40.0 28-29 39.591625 40.0 40.0 40.0 39.0 40.0 30-31 39.584625 40.0 40.0 40.0 39.0 40.0 32-33 39.563125 40.0 40.0 40.0 39.0 40.0 34-35 39.589625 40.0 40.0 40.0 39.0 40.0 36-37 39.583625 40.0 40.0 40.0 39.0 40.0 38-39 39.586749999999995 40.0 40.0 40.0 39.0 40.0 40-41 39.5765 40.0 40.0 40.0 39.0 40.0 42-43 39.559375 40.0 40.0 40.0 39.0 40.0 44-45 39.549499999999995 40.0 40.0 40.0 39.0 40.0 46-47 39.556375 40.0 40.0 40.0 39.0 40.0 48-49 39.443250000000006 40.0 40.0 40.0 39.0 40.0 50-51 39.497625 40.0 40.0 40.0 39.0 40.0 52-53 39.542625 40.0 40.0 40.0 39.0 40.0 54-55 39.51675 40.0 40.0 40.0 39.0 40.0 56-57 39.528999999999996 40.0 40.0 40.0 39.0 40.0 58-59 39.48825 40.0 39.5 40.0 39.0 40.0 60-61 39.510625000000005 40.0 39.0 40.0 39.0 40.0 62-63 39.488875 40.0 40.0 40.0 39.0 40.0 64-65 39.459 40.0 40.0 40.0 39.0 40.0 66-67 39.483875 40.0 39.5 40.0 39.0 40.0 68-69 39.329125000000005 40.0 39.0 40.0 39.0 40.0 70-71 39.429874999999996 40.0 39.0 40.0 39.0 40.0 72-73 39.429874999999996 40.0 39.0 40.0 39.0 40.0 74-75 39.334374999999994 40.0 39.0 40.0 39.0 40.0 76-77 39.304249999999996 40.0 39.0 40.0 39.0 40.0 78-79 39.29325 40.0 39.0 40.0 39.0 40.0 80-81 39.334 40.0 39.0 40.0 39.0 40.0 82-83 39.312875 40.0 39.0 40.0 39.0 40.0 84-85 39.251374999999996 40.0 39.0 40.0 39.0 40.0 86-87 39.260875 40.0 39.0 40.0 39.0 40.0 88-89 39.298 40.0 39.0 40.0 39.0 40.0 90-91 39.252875 40.0 39.0 40.0 39.0 40.0 92-93 39.230625 40.0 39.0 40.0 38.0 40.0 94-95 39.232749999999996 40.0 39.0 40.0 38.5 40.0 96-97 39.200874999999996 40.0 39.0 40.0 38.0 40.0 98-99 39.107375000000005 40.0 39.0 40.0 38.0 40.0 100-101 37.748 39.5 37.5 40.0 34.5 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 0.0 24 2.0 25 0.0 26 0.0 27 2.0 28 6.0 29 6.0 30 2.0 31 3.0 32 6.0 33 12.0 34 22.0 35 25.0 36 26.0 37 77.0 38 355.0 39 3453.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.500630517023957 8.524590163934425 10.239596469104665 49.73518284993695 2 22.925 12.375 34.925 29.775000000000002 3 24.2 15.45 22.400000000000002 37.95 4 28.475 23.175 18.725 29.625 5 28.725 27.825 22.1 21.349999999999998 6 23.849999999999998 31.574999999999996 22.6 21.975 7 19.725 21.15 38.35 20.775 8 21.7 22.125 27.85 28.325 9 20.175 19.775000000000002 33.875 26.174999999999997 10-11 24.65 28.000000000000004 21.75 25.6 12-13 23.95 22.3375 25.775 27.9375 14-15 22.55 24.1875 25.85 27.4125 16-17 24.675 23.5 25.525 26.3 18-19 23.925 23.9875 25.4625 26.625 20-21 23.5375 23.6875 25.3125 27.462500000000002 22-23 25.0125 24.65 23.9375 26.400000000000002 24-25 24.712500000000002 24.275 24.7 26.3125 26-27 23.3625 23.2375 25.275 28.125 28-29 25.05 23.9125 24.7375 26.3 30-31 22.9875 24.75 24.3125 27.950000000000003 32-33 24.6875 23.9 24.962500000000002 26.450000000000003 34-35 24.45 23.549999999999997 25.637500000000003 26.3625 36-37 24.425 23.849999999999998 24.975 26.75 38-39 24.775 23.7375 25.137500000000003 26.35 40-41 24.9875 23.4375 24.7375 26.8375 42-43 24.7875 22.900000000000002 25.137500000000003 27.175 44-45 25.034387895460796 22.996123546329876 25.472052019507313 26.49743653870201 46-47 25.112499999999997 24.762500000000003 24.587500000000002 25.5375 48-49 24.924812030075188 22.844611528822057 24.686716791979947 27.54385964912281 50-51 24.8 24.075 24.075 27.05 52-53 25.1875 23.925 24.2625 26.625 54-55 24.809303488808304 22.896086032262097 24.384144054020258 27.91046642490934 56-57 24.15 23.925 25.224999999999998 26.700000000000003 58-59 25.184444166562457 23.35875953482556 25.221958234337876 26.2348380642741 60-61 24.8 23.425 24.9125 26.8625 62-63 24.825 23.8125 26.1625 25.2 64-65 25.087500000000002 23.875 23.3 27.737499999999997 66-67 24.3 24.4125 24.5625 26.724999999999998 68-69 23.8065405337677 24.194963037213384 24.533266507956398 27.465229921062523 70-71 25.25 24.837500000000002 23.2875 26.625 72-73 24.525 25.5625 23.599999999999998 26.3125 74-75 25.724999999999998 23.1875 24.85 26.237500000000004 76-77 24.7 24.4375 24.087500000000002 26.775 78-79 24.65 24.9 23.4875 26.9625 80-81 24.2375 24.725 24.1125 26.924999999999997 82-83 25.9875 24.1625 24.125 25.724999999999998 84-85 25.2 23.775 23.9125 27.1125 86-87 25.412499999999998 25.275 23.849999999999998 25.4625 88-89 25.2125 24.95 23.474999999999998 26.3625 90-91 25.362499999999997 24.5625 23.5 26.575 92-93 25.8 24.3 23.775 26.125 94-95 24.7 25.112499999999997 23.525 26.6625 96-97 25.2125 24.0125 23.325000000000003 27.450000000000003 98-99 24.7375 25.7 23.425 26.137500000000003 100-101 24.9375 25.5625 22.7375 26.7625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.0 28 2.0 29 2.5 30 4.0 31 4.5 32 6.5 33 10.0 34 11.5 35 19.0 36 32.0 37 41.0 38 52.0 39 66.5 40 83.5 41 103.0 42 128.0 43 150.0 44 162.5 45 161.5 46 161.0 47 161.0 48 149.0 49 156.0 50 157.5 51 147.5 52 154.5 53 154.5 54 148.5 55 153.0 56 158.0 57 152.0 58 124.5 59 102.0 60 110.5 61 106.0 62 96.5 63 89.5 64 76.5 65 71.0 66 72.5 67 64.5 68 44.0 69 36.5 70 30.5 71 26.0 72 20.5 73 14.5 74 11.5 75 6.0 76 2.5 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8750000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0375 46-47 0.0 48-49 0.25 50-51 0.0 52-53 0.0 54-55 0.0375 56-57 0.0 58-59 0.0375 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.2375 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.05 #Duplication Level Percentage of deduplicated Percentage of total 1 98.47016828148904 96.55 2 1.3513513513513513 2.65 3 0.12748597654258031 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025497195308516064 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025497195308516064 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGC 10 0.25 TruSeq Adapter, Index 1 (100% over 50bp) CCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0125 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.037500000000000006 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.1375 0.0 0.0 0.0 0.0 46-47 0.175 0.0 0.0 0.0 0.0 48-49 0.25 0.0 0.0 0.0 0.0 50-51 0.3125 0.0 0.0 0.0 0.0 52-53 0.375 0.0 0.0 0.0 0.0 54-55 0.5 0.0 0.0 0.0 0.0 56-57 0.675 0.0 0.0 0.0 0.0 58-59 0.875 0.0 0.0 0.0 0.0 60-61 1.0875 0.0 0.0 0.0 0.0 62-63 1.3875 0.0 0.0 0.0 0.0 64-65 1.7999999999999998 0.0 0.0 0.0 0.0 66-67 2.1875 0.0 0.0 0.0 0.0 68-69 2.5875 0.0 0.0 0.0 0.0 70-71 3.0625 0.0 0.0 0.0 0.0 72-73 3.6375 0.0 0.0 0.0 0.0 74-75 4.1875 0.0 0.0 0.0 0.0 76-77 4.862500000000001 0.0 0.0 0.0 0.0 78-79 5.800000000000001 0.0 0.0 0.0 0.0 80-81 6.55 0.0 0.0 0.0 0.0 82-83 7.3125 0.0 0.0 0.0 0.0 84-85 8.1375 0.0 0.0 0.0 0.0 86-87 9.175 0.0 0.0 0.0 0.0 88-89 10.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 474828 spots for SRR6126814.sra Written 474828 spots for SRR6126814.sra Read 474828 spots for SRR6126814.sra Written 474828 spots for SRR6126814.sra Read 474828 spots for SRR6126814.sra Written 474828 spots for SRR6126814.sra Read 474828 spots for SRR6126814.sra Written 474828 spots for SRR6126814.sra Read 474828 spots for SRR6126814.sra Written 474828 spots for SRR6126814.sra Read 474828 spots for SRR6126814.sra Written 474828 spots for SRR6126814.sra Read 474828 spots for SRR6126814.sra Written 474828 spots for SRR6126814.sra Read 474828 spots for SRR6126814.sra Written 474828 spots for SRR6126814.sra Read 474828 spots for SRR6126814.sra Written 474828 spots for SRR6126814.sra Read 474828 spots for SRR6126814.sra Written 474828 spots for SRR6126814.sra Read 474828 spots for SRR6126814.sra Written 474828 spots for SRR6126814.sra Read 474839 spots for SRR6126814.sra Written 474839 spots for SRR6126814.sra Read 474828 spots for SRR6126814.sra Written 474828 spots for SRR6126814.sra Read 474828 spots for SRR6126814.sra Written 474828 spots for SRR6126814.sra Read 474828 spots for SRR6126814.sra Written 474828 spots for SRR6126814.sra Read 474828 spots for SRR6126814.sra Written 474828 spots for SRR6126814.sra Read 474828 spots for SRR6126814.sra Written 474828 spots for SRR6126814.sra Read 474828 spots for SRR6126814.sra Written 474828 spots for SRR6126814.sra Read 474828 spots for SRR6126814.sra Written 474828 spots for SRR6126814.sra Read 474828 spots for SRR6126814.sra Written 474828 spots for SRR6126814.sra SRR ids: ['SRR6126814.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_79uy_jj7 SRR6126814.sra spots: 9496571 blocks: [[1, 474828], [474829, 949656], [949657, 1424484], [1424485, 1899312], [1899313, 2374140], [2374141, 2848968], [2848969, 3323796], [3323797, 3798624], [3798625, 4273452], [4273453, 4748280], [4748281, 5223108], [5223109, 5697936], [5697937, 6172764], [6172765, 6647592], [6647593, 7122420], [7122421, 7597248], [7597249, 8072076], [8072077, 8546904], [8546905, 9021732], [9021733, 9496571]] SRR6126814 file size 2600262 SRR6126814 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6126814 SRR6126814_1.fastq Input file: SRR6126814_1.fastq trimmed: SRR6126814-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 05:02:49 2024 >> started Tue Dec 10 05:03:14 2024 >> done (25.393s) 9496571 reads processed; of these: 957 ( 0.01%) short reads filtered out after trimming by size control 19097 ( 0.20%) empty reads filtered out after trimming by size control 9476517 (99.79%) reads available; of these: 464607 ( 4.90%) trimmed reads available after processing 9011910 (95.10%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 36 0.00% 19 37 0.00% 20 20 0.00% 21 25 0.00% 22 50 0.00% 23 26 0.00% 24 31 0.00% 25 46 0.00% 26 47 0.00% 27 53 0.00% 28 55 0.00% 29 75 0.00% 30 101 0.00% 31 133 0.00% 32 185 0.00% 33 181 0.00% 34 239 0.00% 35 265 0.00% 36 282 0.00% 37 361 0.00% 38 489 0.01% 39 597 0.01% 40 818 0.01% 41 1054 0.01% 42 1231 0.01% 43 1541 0.02% 44 1588 0.02% 45 1831 0.02% 46 2210 0.02% 47 2714 0.03% 48 3258 0.03% 49 3943 0.04% 50 4689 0.05% 51 5531 0.06% 52 6269 0.07% 53 7067 0.07% 54 7647 0.08% 55 8138 0.09% 56 9027 0.10% 57 9741 0.10% 58 11137 0.12% 59 12185 0.13% 60 13375 0.14% 61 15394 0.16% 62 16893 0.18% 63 18211 0.19% 64 19564 0.21% 65 19984 0.21% 66 20787 0.22% 67 21724 0.23% 68 22319 0.24% 69 22469 0.24% 70 133 0.00% 71 363 0.00% 72 2615 0.03% 73 1451 0.02% 74 296 0.00% 75 135 0.00% 76 149 0.00% 77 157 0.00% 78 166 0.00% 79 195 0.00% 80 199 0.00% 81 347 0.00% 82 251 0.00% 83 246 0.00% 84 326 0.00% 85 323 0.00% 86 373 0.00% 87 382 0.00% 88 441 0.00% 89 527 0.01% 90 684 0.01% 91 918 0.01% 92 871 0.01% 93 1001 0.01% 94 1313 0.01% 95 1701 0.02% 96 2268 0.02% 97 3081 0.03% 98 6296 0.07% 99 11144 0.12% 100 130582 1.38% 101 9011910 95.10% 9476517 reads passed initial QC criterion=sequence-density sequence-density=7.25 sequence-density-rank=1 fanout-score=53.25 fanout-score-rank=1 prefix-density=8.71 prefix-fanout=44.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=7.25 sequence-density-rank=1 fanout-score=53.25 fanout-score-rank=1 prefix-density=8.71 prefix-fanout=44.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG -o SRR6126814 - Input file: STDIN trimmed: SRR6126814-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Tue Dec 10 05:05:37 2024 >> started Tue Dec 10 05:06:16 2024 >> done (39.264s) 7107388 reads processed; of these: 4 ( 0.00%) short reads filtered out after trimming by size control 3336 ( 0.05%) empty reads filtered out after trimming by size control 7104048 (99.95%) reads available; of these: 1049904 (14.78%) trimmed reads available after processing 6054144 (85.22%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 27 0.00% 19 25 0.00% 20 14 0.00% 21 19 0.00% 22 40 0.00% 23 19 0.00% 24 24 0.00% 25 37 0.00% 26 42 0.00% 27 33 0.00% 28 38 0.00% 29 50 0.00% 30 80 0.00% 31 97 0.00% 32 141 0.00% 33 136 0.00% 34 179 0.00% 35 206 0.00% 36 213 0.00% 37 279 0.00% 38 366 0.01% 39 462 0.01% 40 599 0.01% 41 801 0.01% 42 929 0.01% 43 1184 0.02% 44 1204 0.02% 45 1421 0.02% 46 1663 0.02% 47 2087 0.03% 48 2439 0.03% 49 2980 0.04% 50 3592 0.05% 51 4140 0.06% 52 4759 0.07% 53 5363 0.08% 54 5799 0.08% 55 6213 0.09% 56 6887 0.10% 57 7419 0.10% 58 8430 0.12% 59 9291 0.13% 60 10111 0.14% 61 11609 0.16% 62 12774 0.18% 63 13616 0.19% 64 14815 0.21% 65 14958 0.21% 66 15507 0.22% 67 16018 0.23% 68 16625 0.23% 69 17185 0.24% 70 18587 0.26% 71 19918 0.28% 72 21598 0.30% 73 23019 0.32% 74 23660 0.33% 75 24665 0.35% 76 25139 0.35% 77 25580 0.36% 78 25424 0.36% 79 26886 0.38% 80 27496 0.39% 81 28401 0.40% 82 30215 0.43% 83 31398 0.44% 84 32973 0.46% 85 34370 0.48% 86 34857 0.49% 87 34558 0.49% 88 35355 0.50% 89 35199 0.50% 90 35944 0.51% 91 37329 0.53% 92 37999 0.53% 93 39586 0.56% 94 41319 0.58% 95 44358 0.62% 96 51071 0.72% 97 68069 0.96% 98 146670 2.06% 99 7365 0.10% 100 82506 1.16% 101 5729589 80.65% criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=14 prefix-density=0.59 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=34.73 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=2.8 sequence=AGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCATTCTTGCGAACGTACTCCCCAGGCGGGATACTTAACGCGTTAGCTACAGCACTGCACGGGTCGAGTCGCACAGCACCTAGTATCCATCGTTTACGGCTAGGACTACTGGGGTCTCTAATCCCATTTGCTCCCCTAGCTTTCGTCTCTCAGTGTCAGTGTCGGCCCAGCAGAGTGCTTTCGCCGTTGGTGTTCTTTCCGATCTCAATGCATTTCACCG Started job on | Dec 10 05:08:35 Started mapping on | Dec 10 05:08:36 Finished on | Dec 10 05:10:35 Mapping speed, Million of reads per hour | 286.58 Number of input reads | 9473177 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 8151639 Uniquely mapped reads % | 86.05% Average mapped length | 97.58 Number of splices: Total | 2338054 Number of splices: Annotated (sjdb) | 2212500 Number of splices: GT/AG | 2304583 Number of splices: GC/AG | 27856 Number of splices: AT/AC | 771 Number of splices: Non-canonical | 4844 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.82 Insertion rate per base | 0.01% Insertion average length | 1.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 753668 % of reads mapped to multiple loci | 7.96% Number of reads mapped to too many loci | 317319 % of reads mapped to too many loci | 3.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.42% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 567870 567870 567870 N_multimapping 753668 753668 753668 N_noFeature 312059 7932613 374261 N_ambiguous 173958 527 17264 UnstrandedReadsAssigned:7665622 PositiveStrandReadsAssigned:218499 NegativeStrandReadsAssigned:7760114 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR6126814 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6126814-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,473,177 reads, 7,862,512 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52973 SRR6126814.ke.tsv 35125 SRR6126814.se.tsv 88098 total ==> SRR6126814.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 18.2665 4.20715 PNS24247 1044 945 9.91951 2.02356 PNS24249 1928 1829 13.7292 1.44707 PNS24246 1044 945 9.91951 2.02356 PNS24248 1044 945 9.91951 2.02356 PNS24244 1471 1372 54.2457 7.62199 PNS24243 293 194 0 0 KQK14069 1603 1504 10057.2 1289.1 KQK14071 474 375 1370.96 704.774 ==> SRR6126814.se.tsv <== BRADI_1g14170v3 13158 BRADI_1g53295v3 13 BRADI_1g59795v3 247 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 121 BRADI_1g74790v3 29 BRADI_1g09890v3 0 BRADI_1g77505v3 83 BRADI_1g48960v3 0 SRR6126814 completed mapping pipeline successfully