Starting /dee2/code/volunteer_pipeline.sh SRR6126815 current disk space = 1526025416704 free memory = 1595999908 SRR6126815 SRAfilesize 428cb28318498e8a50101b85e80c9c3e SRR6126815.sra SRR6126815.sra file validated SRR6126815 is single end SRR6126815 is conventional basespace SRR6126815 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6126815_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.674 35.0 35.0 35.0 35.0 35.0 2 34.78725 35.0 35.0 35.0 35.0 35.0 3 34.77375 35.0 35.0 35.0 35.0 35.0 4 34.72 35.0 35.0 35.0 35.0 35.0 5 34.7885 35.0 35.0 35.0 35.0 35.0 6 39.02425 40.0 39.0 40.0 38.0 40.0 7 39.3775 40.0 39.0 40.0 39.0 40.0 8 39.5545 40.0 39.0 40.0 39.0 40.0 9 39.61975 40.0 40.0 40.0 39.0 40.0 10-11 39.588375 40.0 40.0 40.0 39.0 40.0 12-13 39.618125000000006 40.0 40.0 40.0 39.0 40.0 14-15 39.639375 40.0 40.0 40.0 39.0 40.0 16-17 39.629875 40.0 40.0 40.0 39.0 40.0 18-19 39.604375000000005 40.0 40.0 40.0 39.0 40.0 20-21 39.58225 40.0 40.0 40.0 39.0 40.0 22-23 39.615375 40.0 40.0 40.0 39.0 40.0 24-25 39.613125 40.0 40.0 40.0 39.0 40.0 26-27 39.623374999999996 40.0 40.0 40.0 39.0 40.0 28-29 39.620625000000004 40.0 40.0 40.0 39.0 40.0 30-31 39.595125 40.0 40.0 40.0 39.0 40.0 32-33 39.602875 40.0 40.0 40.0 39.0 40.0 34-35 39.591375 40.0 40.0 40.0 39.0 40.0 36-37 39.573499999999996 40.0 40.0 40.0 39.0 40.0 38-39 39.58775 40.0 40.0 40.0 39.0 40.0 40-41 39.566375 40.0 40.0 40.0 39.0 40.0 42-43 39.55375 40.0 40.0 40.0 39.0 40.0 44-45 39.554874999999996 40.0 40.0 40.0 39.0 40.0 46-47 39.54475 40.0 40.0 40.0 39.0 40.0 48-49 39.5215 40.0 40.0 40.0 39.0 40.0 50-51 39.525875 40.0 40.0 40.0 39.0 40.0 52-53 39.504374999999996 40.0 40.0 40.0 39.0 40.0 54-55 39.501625000000004 40.0 39.5 40.0 39.0 40.0 56-57 39.513374999999996 40.0 40.0 40.0 39.0 40.0 58-59 39.497125 40.0 40.0 40.0 39.0 40.0 60-61 39.529624999999996 40.0 40.0 40.0 39.0 40.0 62-63 39.509249999999994 40.0 40.0 40.0 39.0 40.0 64-65 39.505624999999995 40.0 40.0 40.0 39.0 40.0 66-67 39.432874999999996 40.0 39.5 40.0 39.0 40.0 68-69 39.27775 40.0 39.0 40.0 39.0 40.0 70-71 39.422124999999994 40.0 39.0 40.0 39.0 40.0 72-73 39.416375 40.0 39.0 40.0 39.0 40.0 74-75 39.39825 40.0 39.0 40.0 39.0 40.0 76-77 39.39325 40.0 39.0 40.0 39.0 40.0 78-79 39.328125 40.0 39.0 40.0 39.0 40.0 80-81 39.33 40.0 39.0 40.0 39.0 40.0 82-83 39.314625 40.0 39.0 40.0 39.0 40.0 84-85 39.303 40.0 39.0 40.0 39.0 40.0 86-87 39.292 40.0 39.0 40.0 39.0 40.0 88-89 39.26025 40.0 39.0 40.0 38.5 40.0 90-91 39.278000000000006 40.0 39.0 40.0 38.5 40.0 92-93 39.238749999999996 40.0 39.0 40.0 38.0 40.0 94-95 39.216875 40.0 39.0 40.0 38.0 40.0 96-97 39.194375 40.0 39.0 40.0 38.0 40.0 98-99 39.151125 40.0 39.0 40.0 38.0 40.0 100-101 37.716750000000005 39.5 37.5 39.5 34.5 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 2.0 22 0.0 23 0.0 24 2.0 25 1.0 26 0.0 27 1.0 28 5.0 29 3.0 30 3.0 31 7.0 32 8.0 33 9.0 34 13.0 35 22.0 36 31.0 37 85.0 38 370.0 39 3437.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.126160020065214 8.17657386506145 10.684725357411589 50.01254075746176 2 22.925 12.775 35.3 28.999999999999996 3 23.599999999999998 15.35 22.05 39.0 4 29.606417648533466 22.16094259212835 18.149912258711456 30.08272750062672 5 27.800000000000004 26.950000000000003 22.650000000000002 22.6 6 23.799999999999997 29.725 23.325000000000003 23.150000000000002 7 18.8 22.35 38.0 20.849999999999998 8 21.925 20.025000000000002 29.349999999999998 28.7 9 20.674999999999997 20.0 33.2 26.125 10-11 23.962500000000002 28.0625 22.725 25.25 12-13 23.4125 22.675 25.937500000000004 27.975 14-15 22.5 24.4125 26.7625 26.325 16-17 24.3125 23.5875 25.324999999999996 26.775 18-19 24.1875 24.0375 25.3 26.474999999999998 20-21 25.0375 24.337500000000002 24.9 25.724999999999998 22-23 25.0 24.337500000000002 24.6125 26.05 24-25 24.975 24.3125 24.099999999999998 26.6125 26-27 23.8375 24.5125 24.525 27.125 28-29 24.3 23.6375 25.5 26.5625 30-31 24.075 24.462500000000002 24.887500000000003 26.575 32-33 24.025 24.0625 25.674999999999997 26.237500000000004 34-35 24.8 23.3375 25.15 26.7125 36-37 24.05 24.3125 24.962500000000002 26.674999999999997 38-39 24.1125 24.525 25.1875 26.174999999999997 40-41 24.349999999999998 23.400000000000002 25.15 27.1 42-43 25.2 23.7 25.2125 25.887500000000003 44-45 24.675 23.75 24.762500000000003 26.8125 46-47 24.6 25.087500000000002 24.95 25.362499999999997 48-49 24.025 23.4375 24.962500000000002 27.575 50-51 24.825 24.0125 24.712500000000002 26.450000000000003 52-53 23.5875 23.95 24.837500000000002 27.625 54-55 24.6875 23.2625 24.5125 27.537499999999998 56-57 23.1625 24.8125 24.1875 27.8375 58-59 24.4375 24.3125 24.962500000000002 26.2875 60-61 23.9875 23.724999999999998 25.587500000000002 26.700000000000003 62-63 24.6 24.375 24.0625 26.9625 64-65 24.775 23.5375 24.725 26.9625 66-67 25.0625 23.95 24.425 26.5625 68-69 24.46421857375611 25.140995112169445 24.55194886577265 25.842837448301793 70-71 24.843710927731934 23.768442110527634 24.01850462615654 27.369342335583895 72-73 24.428053506688336 24.640580072509064 23.51543942992874 27.415926990873857 74-75 25.5125 25.1875 23.9 25.4 76-77 25.624999999999996 25.374999999999996 23.0125 25.9875 78-79 24.462500000000002 24.2875 24.5625 26.687499999999996 80-81 24.95 24.3625 24.349999999999998 26.337500000000002 82-83 24.9125 25.1 23.5625 26.424999999999997 84-85 25.2125 25.4375 23.3125 26.0375 86-87 25.025 24.4375 24.087500000000002 26.450000000000003 88-89 25.15 25.0125 23.075000000000003 26.7625 90-91 24.9 25.05 23.95 26.1 92-93 25.112499999999997 25.624999999999996 23.799999999999997 25.4625 94-95 25.05 25.0375 23.1375 26.775 96-97 24.603075384423054 25.728216027003377 22.615326915864483 27.053381672709087 98-99 24.85310663832979 24.85310663832979 23.76547068383548 26.52831603950494 100-101 24.925 24.925 22.9375 27.212500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 1.0 26 2.0 27 1.5 28 0.5 29 1.0 30 2.0 31 2.5 32 6.0 33 12.0 34 15.5 35 19.0 36 31.5 37 43.0 38 50.5 39 71.5 40 96.0 41 107.0 42 116.5 43 145.5 44 165.0 45 154.5 46 157.0 47 174.5 48 180.0 49 168.0 50 171.0 51 169.0 52 143.5 53 139.5 54 135.5 55 142.0 56 155.5 57 144.5 58 119.0 59 116.0 60 117.0 61 109.5 62 95.5 63 73.0 64 69.5 65 66.0 66 56.5 67 48.0 68 47.5 69 46.0 70 36.0 71 25.5 72 15.5 73 10.5 74 11.0 75 6.0 76 2.0 77 3.0 78 2.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.27499999999999997 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.2625 70-71 0.025 72-73 0.0125 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0125 98-99 0.0125 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.975 #Duplication Level Percentage of deduplicated Percentage of total 1 98.18831334524113 96.2 2 1.5820362337330953 3.1 3 0.20413370757846389 0.6 4 0.025516713447307986 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1625 0.0 0.0 0.0 0.0 50-51 0.25 0.0 0.0 0.0 0.0 52-53 0.3125 0.0 0.0 0.0 0.0 54-55 0.4375 0.0 0.0 0.0 0.0 56-57 0.5375000000000001 0.0 0.0 0.0 0.0 58-59 0.825 0.0 0.0 0.0 0.0 60-61 1.1625 0.0 0.0 0.0 0.0 62-63 1.4375 0.0 0.0 0.0 0.0 64-65 1.75 0.0 0.0 0.0 0.0 66-67 2.175 0.0 0.0 0.0 0.0 68-69 2.675 0.0 0.0 0.0 0.0 70-71 3.3125 0.0 0.0 0.0 0.0 72-73 3.8375000000000004 0.0 0.0 0.0 0.0 74-75 4.4 0.0 0.0 0.0 0.0 76-77 4.9625 0.0 0.0 0.0 0.0 78-79 5.65 0.0 0.0 0.0 0.0 80-81 6.475 0.0 0.0 0.0 0.0 82-83 7.2125 0.0 0.0 0.0 0.0 84-85 8.0125 0.0 0.0 0.0 0.0 86-87 8.837499999999999 0.0 0.0 0.0 0.0 88-89 9.725000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 482380 spots for SRR6126815.sra Written 482380 spots for SRR6126815.sra Read 482380 spots for SRR6126815.sra Written 482380 spots for SRR6126815.sra Read 482380 spots for SRR6126815.sra Written 482380 spots for SRR6126815.sra Read 482380 spots for SRR6126815.sra Written 482380 spots for SRR6126815.sra Read 482380 spots for SRR6126815.sra Written 482380 spots for SRR6126815.sra Read 482380 spots for SRR6126815.sra Written 482380 spots for SRR6126815.sra Read 482380 spots for SRR6126815.sra Written 482380 spots for SRR6126815.sra Read 482380 spots for SRR6126815.sra Written 482380 spots for SRR6126815.sra Read 482380 spots for SRR6126815.sra Written 482380 spots for SRR6126815.sra Read 482380 spots for SRR6126815.sra Written 482380 spots for SRR6126815.sra Read 482380 spots for SRR6126815.sra Written 482380 spots for SRR6126815.sra Read 482380 spots for SRR6126815.sra Written 482380 spots for SRR6126815.sra Read 482380 spots for SRR6126815.sra Written 482380 spots for SRR6126815.sra Read 482380 spots for SRR6126815.sra Written 482380 spots for SRR6126815.sra Read 482392 spots for SRR6126815.sra Written 482392 spots for SRR6126815.sra Read 482380 spots for SRR6126815.sra Written 482380 spots for SRR6126815.sra Read 482380 spots for SRR6126815.sra Written 482380 spots for SRR6126815.sra Read 482380 spots for SRR6126815.sra Written 482380 spots for SRR6126815.sra Read 482380 spots for SRR6126815.sra Written 482380 spots for SRR6126815.sra Read 482380 spots for SRR6126815.sra Written 482380 spots for SRR6126815.sra SRR ids: ['SRR6126815.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6rj95hzy SRR6126815.sra spots: 9647612 blocks: [[1, 482380], [482381, 964760], [964761, 1447140], [1447141, 1929520], [1929521, 2411900], [2411901, 2894280], [2894281, 3376660], [3376661, 3859040], [3859041, 4341420], [4341421, 4823800], [4823801, 5306180], [5306181, 5788560], [5788561, 6270940], [6270941, 6753320], [6753321, 7235700], [7235701, 7718080], [7718081, 8200460], [8200461, 8682840], [8682841, 9165220], [9165221, 9647612]] SRR6126815 file size 2641593 SRR6126815 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6126815 SRR6126815_1.fastq Input file: SRR6126815_1.fastq trimmed: SRR6126815-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 05:02:53 2024 >> started Tue Dec 10 05:02:59 2024 >> done (6.290s) 9647612 reads processed; of these: 1029 ( 0.01%) short reads filtered out after trimming by size control 19142 ( 0.20%) empty reads filtered out after trimming by size control 9627441 (99.79%) reads available; of these: 473980 ( 4.92%) trimmed reads available after processing 9153461 (95.08%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 38 0.00% 19 36 0.00% 20 26 0.00% 21 28 0.00% 22 38 0.00% 23 37 0.00% 24 43 0.00% 25 35 0.00% 26 34 0.00% 27 48 0.00% 28 69 0.00% 29 80 0.00% 30 100 0.00% 31 122 0.00% 32 162 0.00% 33 187 0.00% 34 235 0.00% 35 251 0.00% 36 294 0.00% 37 380 0.00% 38 510 0.01% 39 631 0.01% 40 882 0.01% 41 1079 0.01% 42 1310 0.01% 43 1468 0.02% 44 1663 0.02% 45 1870 0.02% 46 2395 0.02% 47 2706 0.03% 48 3288 0.03% 49 3942 0.04% 50 4778 0.05% 51 5674 0.06% 52 6374 0.07% 53 7337 0.08% 54 7814 0.08% 55 8316 0.09% 56 9117 0.09% 57 9841 0.10% 58 11285 0.12% 59 12528 0.13% 60 13776 0.14% 61 15717 0.16% 62 17002 0.18% 63 18695 0.19% 64 20004 0.21% 65 20615 0.21% 66 21062 0.22% 67 22024 0.23% 68 22575 0.23% 69 23152 0.24% 70 126 0.00% 71 274 0.00% 72 2013 0.02% 73 1272 0.01% 74 306 0.00% 75 157 0.00% 76 143 0.00% 77 177 0.00% 78 203 0.00% 79 185 0.00% 80 203 0.00% 81 288 0.00% 82 246 0.00% 83 293 0.00% 84 309 0.00% 85 354 0.00% 86 391 0.00% 87 407 0.00% 88 479 0.00% 89 521 0.01% 90 638 0.01% 91 738 0.01% 92 928 0.01% 93 1038 0.01% 94 1344 0.01% 95 1834 0.02% 96 2357 0.02% 97 3326 0.03% 98 5398 0.06% 99 11220 0.12% 100 135139 1.40% 101 9153461 95.08% 9627441 reads passed initial QC criterion=sequence-density sequence-density=7.25 sequence-density-rank=1 fanout-score=53.28 fanout-score-rank=1 prefix-density=8.71 prefix-fanout=44.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=7.25 sequence-density-rank=1 fanout-score=53.28 fanout-score-rank=1 prefix-density=8.71 prefix-fanout=44.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG -o SRR6126815 - Input file: STDIN trimmed: SRR6126815-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Tue Dec 10 05:03:24 2024 >> started Tue Dec 10 05:03:34 2024 >> done (9.822s) 7220581 reads processed; of these: 2 ( 0.00%) short reads filtered out after trimming by size control 2736 ( 0.04%) empty reads filtered out after trimming by size control 7217843 (99.96%) reads available; of these: 1070029 (14.82%) trimmed reads available after processing 6147814 (85.18%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 28 0.00% 19 26 0.00% 20 18 0.00% 21 18 0.00% 22 32 0.00% 23 27 0.00% 24 36 0.00% 25 29 0.00% 26 29 0.00% 27 38 0.00% 28 51 0.00% 29 49 0.00% 30 73 0.00% 31 93 0.00% 32 121 0.00% 33 130 0.00% 34 186 0.00% 35 192 0.00% 36 225 0.00% 37 287 0.00% 38 398 0.01% 39 465 0.01% 40 696 0.01% 41 801 0.01% 42 1014 0.01% 43 1120 0.02% 44 1266 0.02% 45 1410 0.02% 46 1790 0.02% 47 2073 0.03% 48 2507 0.03% 49 2953 0.04% 50 3648 0.05% 51 4281 0.06% 52 4753 0.07% 53 5517 0.08% 54 5856 0.08% 55 6289 0.09% 56 6911 0.10% 57 7411 0.10% 58 8476 0.12% 59 9461 0.13% 60 10481 0.15% 61 11790 0.16% 62 12849 0.18% 63 14120 0.20% 64 14867 0.21% 65 15521 0.22% 66 15753 0.22% 67 16217 0.22% 68 16802 0.23% 69 17548 0.24% 70 18998 0.26% 71 20058 0.28% 72 21868 0.30% 73 23519 0.33% 74 24412 0.34% 75 24659 0.34% 76 25584 0.35% 77 26098 0.36% 78 25747 0.36% 79 27529 0.38% 80 28537 0.40% 81 29322 0.41% 82 30889 0.43% 83 32204 0.45% 84 33567 0.47% 85 34960 0.48% 86 35585 0.49% 87 35468 0.49% 88 36107 0.50% 89 36118 0.50% 90 36316 0.50% 91 37889 0.52% 92 38610 0.53% 93 40313 0.56% 94 41966 0.58% 95 44549 0.62% 96 51723 0.72% 97 69517 0.96% 98 149281 2.07% 99 7474 0.10% 100 84977 1.18% 101 5817267 80.60% criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=12 prefix-density=0.60 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=33.66 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=2.8 sequence=AGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCATTCTTGCGAACGTACTCCCCAGGCGGGATACTTAACGCGTTAGCTACAGCACTGCACGGGTCGAGTCGCACAGCACCTAGTATCCATCGTTTACGGCTAGGACTACTGGGGTCTCTAATCCCATTTGCTCCCCTAGCTTTCGTCTCTCAGTGTCAGTGTCGGCCCAGCAGAGTGCTTTCGCCGTTGGTGTTCTTTCCGATCTCAATGCATTTCACCG Started job on | Dec 10 05:03:58 Started mapping on | Dec 10 05:03:59 Finished on | Dec 10 05:04:14 Mapping speed, Million of reads per hour | 2309.93 Number of input reads | 9624703 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 8284561 Uniquely mapped reads % | 86.08% Average mapped length | 97.57 Number of splices: Total | 2380447 Number of splices: Annotated (sjdb) | 2252425 Number of splices: GT/AG | 2346259 Number of splices: GC/AG | 28371 Number of splices: AT/AC | 776 Number of splices: Non-canonical | 5041 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 1.81 Insertion rate per base | 0.01% Insertion average length | 1.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 764320 % of reads mapped to multiple loci | 7.94% Number of reads mapped to too many loci | 328255 % of reads mapped to too many loci | 3.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.42% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 575822 575822 575822 N_multimapping 764320 764320 764320 N_noFeature 316919 8062601 380003 N_ambiguous 176418 538 17634 UnstrandedReadsAssigned:7791224 PositiveStrandReadsAssigned:221422 NegativeStrandReadsAssigned:7886924 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR6126815 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6126815-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,624,703 reads, 7,995,933 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52973 SRR6126815.ke.tsv 35125 SRR6126815.se.tsv 88098 total ==> SRR6126815.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 15.5881 3.53024 PNS24247 1044 945 19.7081 3.9532 PNS24249 1928 1829 10.2633 1.06367 PNS24246 1044 945 19.7081 3.9532 PNS24248 1044 945 19.7081 3.9532 PNS24244 1471 1372 53.0244 7.32584 PNS24243 293 194 0 0 KQK14069 1603 1504 10291.6 1297.09 KQK14071 474 375 1247.75 630.715 ==> SRR6126815.se.tsv <== BRADI_1g14170v3 13328 BRADI_1g53295v3 13 BRADI_1g59795v3 268 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 122 BRADI_1g74790v3 25 BRADI_1g09890v3 0 BRADI_1g77505v3 94 BRADI_1g48960v3 0 SRR6126815 completed mapping pipeline successfully