Starting /dee2/code/volunteer_pipeline.sh SRR6126816 current disk space = 1525960216576 free memory = 1552886840 SRR6126816 SRAfilesize 3aa57d6dea33a31e9b2f4eb68aa1083c SRR6126816.sra SRR6126816.sra file validated SRR6126816 is single end SRR6126816 is conventional basespace SRR6126816 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6126816_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.5565 35.0 35.0 35.0 35.0 35.0 2 34.7435 35.0 35.0 35.0 35.0 35.0 3 34.72075 35.0 35.0 35.0 35.0 35.0 4 34.755 35.0 35.0 35.0 35.0 35.0 5 34.7925 35.0 35.0 35.0 35.0 35.0 6 39.074 40.0 39.0 40.0 38.0 40.0 7 39.326 40.0 39.0 40.0 39.0 40.0 8 39.479 40.0 39.0 40.0 39.0 40.0 9 39.525 40.0 40.0 40.0 39.0 40.0 10-11 39.585499999999996 40.0 40.0 40.0 39.0 40.0 12-13 39.62825 40.0 40.0 40.0 39.0 40.0 14-15 39.634625 40.0 40.0 40.0 39.0 40.0 16-17 39.604625 40.0 40.0 40.0 39.0 40.0 18-19 39.587125 40.0 40.0 40.0 39.0 40.0 20-21 39.58625 40.0 40.0 40.0 39.0 40.0 22-23 39.601124999999996 40.0 40.0 40.0 39.0 40.0 24-25 39.623875 40.0 40.0 40.0 39.0 40.0 26-27 39.598875 40.0 40.0 40.0 39.0 40.0 28-29 39.591499999999996 40.0 40.0 40.0 39.0 40.0 30-31 39.5945 40.0 40.0 40.0 39.0 40.0 32-33 39.61275 40.0 40.0 40.0 39.0 40.0 34-35 39.595625 40.0 40.0 40.0 39.0 40.0 36-37 39.59775 40.0 40.0 40.0 39.0 40.0 38-39 39.601 40.0 40.0 40.0 39.0 40.0 40-41 39.529375 40.0 40.0 40.0 39.0 40.0 42-43 39.5325 40.0 40.0 40.0 39.0 40.0 44-45 39.4985 40.0 40.0 40.0 39.0 40.0 46-47 39.48825 40.0 40.0 40.0 39.0 40.0 48-49 39.516125 40.0 40.0 40.0 39.0 40.0 50-51 39.509625 40.0 40.0 40.0 39.0 40.0 52-53 39.467749999999995 40.0 40.0 40.0 39.0 40.0 54-55 39.438125 40.0 40.0 40.0 39.0 40.0 56-57 39.459875 40.0 40.0 40.0 39.0 40.0 58-59 39.449 40.0 40.0 40.0 39.0 40.0 60-61 39.460875 40.0 39.5 40.0 39.0 40.0 62-63 39.46275 40.0 39.5 40.0 39.0 40.0 64-65 39.455375000000004 40.0 39.5 40.0 39.0 40.0 66-67 39.433875 40.0 39.5 40.0 39.0 40.0 68-69 39.35025 40.0 39.0 40.0 39.0 40.0 70-71 39.363749999999996 40.0 39.0 40.0 39.0 40.0 72-73 39.392125 40.0 39.0 40.0 39.0 40.0 74-75 39.240875 40.0 39.0 40.0 39.0 40.0 76-77 39.2195 40.0 39.0 40.0 39.0 40.0 78-79 39.185249999999996 40.0 39.0 40.0 39.0 40.0 80-81 39.14725 40.0 39.0 40.0 38.5 40.0 82-83 39.177125000000004 40.0 39.0 40.0 39.0 40.0 84-85 39.1085 40.0 39.0 40.0 38.0 40.0 86-87 39.132875 40.0 39.0 40.0 38.0 40.0 88-89 39.110375000000005 40.0 39.0 40.0 38.0 40.0 90-91 39.125375000000005 40.0 39.0 40.0 38.0 40.0 92-93 39.06825 40.0 39.0 40.0 38.0 40.0 94-95 39.088750000000005 40.0 39.0 40.0 38.0 40.0 96-97 39.051375 40.0 39.0 40.0 38.0 40.0 98-99 39.009875 40.0 39.0 40.0 38.0 40.0 100-101 37.571124999999995 39.5 37.0 39.5 34.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 2.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 0.0 23 0.0 24 1.0 25 1.0 26 1.0 27 1.0 28 12.0 29 13.0 30 2.0 31 10.0 32 9.0 33 12.0 34 14.0 35 22.0 36 29.0 37 75.0 38 343.0 39 3451.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.28301886792453 8.628930817610064 9.182389937106917 48.90566037735849 2 22.35 12.675 34.975 30.0 3 23.599999999999998 13.775 21.55 41.075 4 28.48560700876095 21.00125156445557 18.197747183979978 32.3153942428035 5 30.175 26.424999999999997 21.55 21.85 6 27.250000000000004 30.7 20.974999999999998 21.075 7 20.05 23.9 34.8 21.25 8 22.925 21.75 28.075 27.250000000000004 9 23.599999999999998 19.325 30.9 26.174999999999997 10-11 25.412499999999998 26.974999999999998 22.5625 25.05 12-13 24.712500000000002 22.2 25.474999999999998 27.6125 14-15 24.6875 24.4125 24.1875 26.7125 16-17 25.874999999999996 23.35 23.925 26.85 18-19 24.45 23.4125 25.0375 27.1 20-21 24.3 24.125 25.087500000000002 26.487500000000004 22-23 24.65 25.362499999999997 24.2625 25.724999999999998 24-25 26.1625 23.0 23.875 26.9625 26-27 24.625 23.8375 24.075 27.462500000000002 28-29 27.400000000000002 23.925 23.150000000000002 25.525 30-31 24.887500000000003 23.7375 24.2375 27.1375 32-33 24.8 24.1375 24.0375 27.025 34-35 26.187500000000004 23.6875 23.7125 26.4125 36-37 25.4875 23.2125 23.8375 27.462500000000002 38-39 24.6 23.3625 24.75 27.287499999999998 40-41 25.825 23.3125 24.175 26.687499999999996 42-43 25.1875 23.962500000000002 24.3125 26.5375 44-45 24.9375 23.4625 24.6125 26.987499999999997 46-47 25.5375 23.7625 23.9 26.8 48-49 24.775 23.9375 25.35 25.937500000000004 50-51 25.85 22.725 24.15 27.275 52-53 25.5 23.2375 24.2375 27.025 54-55 24.837500000000002 23.575 23.4875 28.1 56-57 23.9375 23.6125 25.025 27.425 58-59 26.424999999999997 23.0 23.925 26.650000000000002 60-61 25.6125 23.0 23.925 27.462500000000002 62-63 26.3625 23.6625 24.4 25.575 64-65 25.8625 24.15 23.2625 26.724999999999998 66-67 25.674999999999997 23.7875 23.799999999999997 26.737499999999997 68-69 25.7450538442274 23.816679188580014 24.04207362885049 26.3961933383421 70-71 25.240655081885237 23.89048631078885 24.50306288286036 26.365795724465556 72-73 25.75 23.9375 23.275000000000002 27.037499999999998 74-75 25.624999999999996 23.65 24.3625 26.3625 76-77 26.224999999999998 24.05 23.4125 26.3125 78-79 24.762500000000003 24.8625 23.7 26.674999999999997 80-81 26.075 23.9375 23.4625 26.525 82-83 25.9875 23.925 23.8125 26.275 84-85 25.7 24.3875 22.6 27.3125 86-87 26.450000000000003 24.025 22.675 26.85 88-89 25.4375 24.2 23.4875 26.875 90-91 25.837500000000002 24.025 23.275000000000002 26.8625 92-93 26.650000000000002 23.425 24.712500000000002 25.2125 94-95 25.6125 25.337500000000002 23.05 26.0 96-97 25.55 24.2875 23.025000000000002 27.1375 98-99 25.324999999999996 24.3875 22.7625 27.525 100-101 25.662499999999998 25.0125 22.8125 26.5125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 1.5 29 1.0 30 1.0 31 2.5 32 6.0 33 6.5 34 7.5 35 12.5 36 17.5 37 33.0 38 52.5 39 63.5 40 78.5 41 104.0 42 122.5 43 131.5 44 146.5 45 165.5 46 156.0 47 153.5 48 158.0 49 147.5 50 149.5 51 142.5 52 124.5 53 123.0 54 151.0 55 152.0 56 141.0 57 146.5 58 131.5 59 128.5 60 137.5 61 127.0 62 103.5 63 102.5 64 95.0 65 77.0 66 74.0 67 63.5 68 57.0 69 51.0 70 41.0 71 34.0 72 32.0 73 20.5 74 8.5 75 7.0 76 5.5 77 2.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.0 3 0.0 4 0.125 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.17500000000000002 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.65524349394485 94.75 2 2.138624065962381 4.15 3 0.12883277505797475 0.375 4 0.02576655501159495 0.1 5 0.02576655501159495 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02576655501159495 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGC 20 0.5 TruSeq Adapter, Index 9 (100% over 50bp) CCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.0875 0.0 0.0 0.0 0.0 54-55 0.2875 0.0 0.0 0.0 0.0 56-57 0.4125 0.0 0.0 0.0 0.0 58-59 0.5125 0.0 0.0 0.0 0.0 60-61 0.7 0.0 0.0 0.0 0.0 62-63 0.8500000000000001 0.0 0.0 0.0 0.0 64-65 1.0875 0.0 0.0 0.0 0.0 66-67 1.2999999999999998 0.0 0.0 0.0 0.0 68-69 1.5499999999999998 0.0 0.0 0.0 0.0 70-71 1.9125 0.0 0.0 0.0 0.0 72-73 2.4 0.0 0.0 0.0 0.0 74-75 3.075 0.0 0.0 0.0 0.0 76-77 3.7 0.0 0.0 0.0 0.0 78-79 4.225 0.0 0.0 0.0 0.0 80-81 4.75 0.0 0.0 0.0 0.0 82-83 5.5375 0.0 0.0 0.0 0.0 84-85 6.4 0.0 0.0 0.0 0.0 86-87 7.2375 0.0 0.0 0.0 0.0 88-89 8.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 508505 spots for SRR6126816.sra Written 508505 spots for SRR6126816.sra Read 508505 spots for SRR6126816.sra Written 508505 spots for SRR6126816.sra Read 508505 spots for SRR6126816.sra Written 508505 spots for SRR6126816.sra Read 508505 spots for SRR6126816.sra Written 508505 spots for SRR6126816.sra Read 508505 spots for SRR6126816.sra Written 508505 spots for SRR6126816.sra Read 508505 spots for SRR6126816.sra Written 508505 spots for SRR6126816.sra Read 508505 spots for SRR6126816.sra Written 508505 spots for SRR6126816.sra Read 508505 spots for SRR6126816.sra Written 508505 spots for SRR6126816.sra Read 508505 spots for SRR6126816.sra Written 508505 spots for SRR6126816.sra Read 508505 spots for SRR6126816.sra Written 508505 spots for SRR6126816.sra Read 508505 spots for SRR6126816.sra Written 508505 spots for SRR6126816.sra Read 508505 spots for SRR6126816.sra Written 508505 spots for SRR6126816.sra Read 508505 spots for SRR6126816.sra Written 508505 spots for SRR6126816.sra Read 508505 spots for SRR6126816.sra Written 508505 spots for SRR6126816.sra Read 508513 spots for SRR6126816.sra Written 508513 spots for SRR6126816.sra Read 508505 spots for SRR6126816.sra Written 508505 spots for SRR6126816.sra Read 508505 spots for SRR6126816.sra Written 508505 spots for SRR6126816.sra Read 508505 spots for SRR6126816.sra Written 508505 spots for SRR6126816.sra Read 508505 spots for SRR6126816.sra Written 508505 spots for SRR6126816.sra Read 508505 spots for SRR6126816.sra Written 508505 spots for SRR6126816.sra SRR ids: ['SRR6126816.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q1sufdbj SRR6126816.sra spots: 10170108 blocks: [[1, 508505], [508506, 1017010], [1017011, 1525515], [1525516, 2034020], [2034021, 2542525], [2542526, 3051030], [3051031, 3559535], [3559536, 4068040], [4068041, 4576545], [4576546, 5085050], [5085051, 5593555], [5593556, 6102060], [6102061, 6610565], [6610566, 7119070], [7119071, 7627575], [7627576, 8136080], [8136081, 8644585], [8644586, 9153090], [9153091, 9661595], [9661596, 10170108]] SRR6126816 file size 2784882 SRR6126816 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6126816 SRR6126816_1.fastq Input file: SRR6126816_1.fastq trimmed: SRR6126816-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 05:05:55 2024 >> started Tue Dec 10 05:06:01 2024 >> done (5.790s) 10170108 reads processed; of these: 1666 ( 0.02%) short reads filtered out after trimming by size control 77318 ( 0.76%) empty reads filtered out after trimming by size control 10091124 (99.22%) reads available; of these: 458275 ( 4.54%) trimmed reads available after processing 9632849 (95.46%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 52 0.00% 19 46 0.00% 20 51 0.00% 21 46 0.00% 22 66 0.00% 23 27 0.00% 24 59 0.00% 25 35 0.00% 26 37 0.00% 27 55 0.00% 28 65 0.00% 29 83 0.00% 30 101 0.00% 31 139 0.00% 32 139 0.00% 33 142 0.00% 34 164 0.00% 35 215 0.00% 36 261 0.00% 37 327 0.00% 38 435 0.00% 39 485 0.00% 40 652 0.01% 41 787 0.01% 42 901 0.01% 43 1071 0.01% 44 1261 0.01% 45 1329 0.01% 46 1676 0.02% 47 2077 0.02% 48 2440 0.02% 49 2962 0.03% 50 3526 0.03% 51 4017 0.04% 52 4790 0.05% 53 5354 0.05% 54 6039 0.06% 55 6513 0.06% 56 7152 0.07% 57 7866 0.08% 58 9115 0.09% 59 10422 0.10% 60 11331 0.11% 61 13235 0.13% 62 14826 0.15% 63 15759 0.16% 64 17204 0.17% 65 18045 0.18% 66 18757 0.19% 67 20024 0.20% 68 20711 0.21% 69 21182 0.21% 70 166 0.00% 71 321 0.00% 72 1966 0.02% 73 2181 0.02% 74 607 0.01% 75 172 0.00% 76 152 0.00% 77 192 0.00% 78 168 0.00% 79 205 0.00% 80 229 0.00% 81 310 0.00% 82 247 0.00% 83 293 0.00% 84 331 0.00% 85 366 0.00% 86 407 0.00% 87 427 0.00% 88 489 0.00% 89 570 0.01% 90 735 0.01% 91 807 0.01% 92 1006 0.01% 93 1201 0.01% 94 1520 0.02% 95 1927 0.02% 96 2646 0.03% 97 3652 0.04% 98 6128 0.06% 99 13071 0.13% 100 161729 1.60% 101 9632849 95.46% 10091124 reads passed initial QC criterion=sequence-density sequence-density=6.64 sequence-density-rank=1 fanout-score=53.36 fanout-score-rank=1 prefix-density=8.04 prefix-fanout=44.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=6.64 sequence-density-rank=1 fanout-score=53.36 fanout-score-rank=1 prefix-density=8.04 prefix-fanout=44.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG -o SRR6126816 - Input file: STDIN trimmed: SRR6126816-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Tue Dec 10 05:06:26 2024 >> started Tue Dec 10 05:06:39 2024 >> done (12.189s) 7207946 reads processed; of these: 7 ( 0.00%) short reads filtered out after trimming by size control 3590 ( 0.05%) empty reads filtered out after trimming by size control 7204349 (99.95%) reads available; of these: 1005786 (13.96%) trimmed reads available after processing 6198563 (86.04%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 36 0.00% 19 32 0.00% 20 44 0.00% 21 32 0.00% 22 47 0.00% 23 13 0.00% 24 47 0.00% 25 28 0.00% 26 25 0.00% 27 38 0.00% 28 55 0.00% 29 62 0.00% 30 75 0.00% 31 95 0.00% 32 98 0.00% 33 101 0.00% 34 127 0.00% 35 158 0.00% 36 193 0.00% 37 229 0.00% 38 322 0.00% 39 338 0.00% 40 469 0.01% 41 543 0.01% 42 637 0.01% 43 786 0.01% 44 922 0.01% 45 958 0.01% 46 1184 0.02% 47 1526 0.02% 48 1776 0.02% 49 2147 0.03% 50 2552 0.04% 51 2895 0.04% 52 3432 0.05% 53 3805 0.05% 54 4349 0.06% 55 4652 0.06% 56 5103 0.07% 57 5652 0.08% 58 6552 0.09% 59 7555 0.10% 60 8179 0.11% 61 9438 0.13% 62 10609 0.15% 63 11172 0.16% 64 12265 0.17% 65 12905 0.18% 66 13410 0.19% 67 14170 0.20% 68 14658 0.20% 69 15337 0.21% 70 16852 0.23% 71 17702 0.25% 72 19329 0.27% 73 20964 0.29% 74 21959 0.30% 75 22574 0.31% 76 22953 0.32% 77 23559 0.33% 78 24038 0.33% 79 25513 0.35% 80 26163 0.36% 81 27155 0.38% 82 28729 0.40% 83 29698 0.41% 84 30682 0.43% 85 32317 0.45% 86 33052 0.46% 87 33237 0.46% 88 34069 0.47% 89 34642 0.48% 90 34767 0.48% 91 36490 0.51% 92 36950 0.51% 93 38152 0.53% 94 40803 0.57% 95 42479 0.59% 96 49678 0.69% 97 66025 0.92% 98 148386 2.06% 99 8325 0.12% 100 97609 1.35% 101 5897665 81.86% criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=16 prefix-density=0.95 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.28 sequence-density-rank=27 fanout-score=10.22 fanout-score-rank=1 prefix-density=1.29 prefix-fanout=2.3 sequence=CCGAACATGGGAAGCTTCCACAT Started job on | Dec 10 05:07:02 Started mapping on | Dec 10 05:07:02 Finished on | Dec 10 05:07:18 Mapping speed, Million of reads per hour | 2269.69 Number of input reads | 10087527 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 9126746 Uniquely mapped reads % | 90.48% Average mapped length | 98.00 Number of splices: Total | 2687256 Number of splices: Annotated (sjdb) | 2554421 Number of splices: GT/AG | 2649411 Number of splices: GC/AG | 32300 Number of splices: AT/AC | 795 Number of splices: Non-canonical | 4750 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 1.85 Insertion rate per base | 0.01% Insertion average length | 1.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 540701 % of reads mapped to multiple loci | 5.36% Number of reads mapped to too many loci | 228923 % of reads mapped to too many loci | 2.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.80% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 420080 420080 420080 N_multimapping 540701 540701 540701 N_noFeature 265556 8910016 335019 N_ambiguous 165956 499 19374 UnstrandedReadsAssigned:8695234 PositiveStrandReadsAssigned:216231 NegativeStrandReadsAssigned:8772353 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR6126816 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6126816-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,087,527 reads, 8,837,449 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52973 SRR6126816.ke.tsv 35125 SRR6126816.se.tsv 88098 total ==> SRR6126816.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 16.1021 2.8906 PNS24249 1928 1829 27.3662 2.53827 PNS24246 1044 945 16.1021 2.8906 PNS24248 1044 945 16.1021 2.8906 PNS24244 1471 1372 35.3273 4.36811 PNS24243 293 194 0 0 KQK14069 1603 1504 2063.48 232.75 KQK14071 474 375 354.799 160.505 ==> SRR6126816.se.tsv <== BRADI_1g14170v3 2991 BRADI_1g53295v3 15 BRADI_1g59795v3 99 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 125 BRADI_1g74790v3 41 BRADI_1g09890v3 0 BRADI_1g77505v3 89 BRADI_1g48960v3 0 SRR6126816 completed mapping pipeline successfully