Starting /dee2/code/volunteer_pipeline.sh SRR6126817 current disk space = 1525974175744 free memory = 1595997460 SRR6126817 SRAfilesize 1b658ff9bf649291660bef5b53c23d4b SRR6126817.sra SRR6126817.sra file validated SRR6126817 is single end SRR6126817 is conventional basespace SRR6126817 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6126817_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.46575 35.0 35.0 35.0 35.0 35.0 2 34.71125 35.0 35.0 35.0 35.0 35.0 3 34.77 35.0 35.0 35.0 35.0 35.0 4 34.79425 35.0 35.0 35.0 35.0 35.0 5 34.78425 35.0 35.0 35.0 35.0 35.0 6 38.9325 39.0 39.0 40.0 37.0 40.0 7 39.2925 40.0 39.0 40.0 39.0 40.0 8 39.51975 40.0 39.0 40.0 39.0 40.0 9 39.585 40.0 40.0 40.0 39.0 40.0 10-11 39.602125 40.0 40.0 40.0 39.0 40.0 12-13 39.627250000000004 40.0 40.0 40.0 39.0 40.0 14-15 39.631 40.0 40.0 40.0 39.0 40.0 16-17 39.594 40.0 40.0 40.0 39.0 40.0 18-19 39.64 40.0 40.0 40.0 39.0 40.0 20-21 39.60725 40.0 40.0 40.0 39.0 40.0 22-23 39.6185 40.0 40.0 40.0 39.0 40.0 24-25 39.611875 40.0 40.0 40.0 39.0 40.0 26-27 39.604749999999996 40.0 40.0 40.0 39.0 40.0 28-29 39.58925 40.0 40.0 40.0 39.0 40.0 30-31 39.562375 40.0 40.0 40.0 39.0 40.0 32-33 39.56925 40.0 40.0 40.0 39.0 40.0 34-35 39.585375 40.0 40.0 40.0 39.0 40.0 36-37 39.559 40.0 40.0 40.0 39.0 40.0 38-39 39.517375 40.0 40.0 40.0 39.0 40.0 40-41 39.509 40.0 40.0 40.0 39.0 40.0 42-43 39.51025 40.0 40.0 40.0 39.0 40.0 44-45 39.4995 40.0 40.0 40.0 39.0 40.0 46-47 39.509 40.0 40.0 40.0 39.0 40.0 48-49 39.358375 40.0 40.0 40.0 39.0 40.0 50-51 39.42375 40.0 40.0 40.0 39.0 40.0 52-53 39.46425 40.0 39.5 40.0 39.0 40.0 54-55 39.442 40.0 39.0 40.0 39.0 40.0 56-57 39.442875 40.0 39.0 40.0 39.0 40.0 58-59 39.422875000000005 40.0 39.0 40.0 39.0 40.0 60-61 39.404125 40.0 39.0 40.0 39.0 40.0 62-63 39.399125 40.0 39.0 40.0 39.0 40.0 64-65 39.421625000000006 40.0 39.0 40.0 39.0 40.0 66-67 39.386875 40.0 39.5 40.0 39.0 40.0 68-69 39.280249999999995 40.0 39.0 40.0 39.0 40.0 70-71 39.308499999999995 40.0 39.0 40.0 38.5 40.0 72-73 39.400625 40.0 39.0 40.0 39.0 40.0 74-75 39.131625 40.0 39.0 40.0 39.0 40.0 76-77 39.127250000000004 40.0 39.0 40.0 39.0 40.0 78-79 39.091875 40.0 39.0 40.0 38.5 40.0 80-81 39.051500000000004 40.0 39.0 40.0 38.0 40.0 82-83 39.057125 40.0 39.0 40.0 38.0 40.0 84-85 39.027874999999995 40.0 39.0 40.0 38.5 40.0 86-87 39.0385 40.0 39.0 40.0 38.0 40.0 88-89 39.04725 40.0 39.0 40.0 38.0 40.0 90-91 39.033 40.0 39.0 40.0 38.0 40.0 92-93 39.0045 40.0 39.0 40.0 38.0 40.0 94-95 38.991 40.0 39.0 40.0 38.0 40.0 96-97 38.985875 40.0 39.0 40.0 38.0 40.0 98-99 38.916 40.0 39.0 40.0 38.0 40.0 100-101 37.489125 39.5 37.0 39.5 34.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 2.0 27 2.0 28 23.0 29 14.0 30 5.0 31 4.0 32 15.0 33 13.0 34 18.0 35 26.0 36 33.0 37 87.0 38 372.0 39 3384.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.796062594649165 8.45532559313478 9.565875820292781 48.18273599192327 2 23.05 12.35 35.9 28.7 3 22.225 14.224999999999998 22.075 41.475 4 29.95 20.95 18.025 31.075000000000003 5 29.9 27.975 20.95 21.175 6 25.974999999999998 29.375 22.3 22.35 7 21.175 23.400000000000002 35.175 20.25 8 21.075 22.275 28.775000000000002 27.875 9 22.2 20.225 31.45 26.125 10-11 25.3125 27.712500000000002 21.975 25.0 12-13 24.4 22.325 24.962500000000002 28.3125 14-15 24.2375 23.4375 25.337500000000002 26.987499999999997 16-17 25.2 23.0625 24.0625 27.675 18-19 25.324999999999996 23.625 24.55 26.5 20-21 24.712500000000002 24.2625 24.637500000000003 26.387500000000003 22-23 25.275 24.3875 24.45 25.887500000000003 24-25 25.412499999999998 22.975 23.1625 28.449999999999996 26-27 23.625 23.0625 25.25 28.0625 28-29 25.900000000000002 23.45 23.225 27.425 30-31 25.1 23.549999999999997 24.5625 26.787499999999998 32-33 24.712500000000002 23.5125 25.2375 26.5375 34-35 25.2375 23.3375 24.3875 27.037499999999998 36-37 25.674999999999997 22.925 23.549999999999997 27.85 38-39 25.412499999999998 23.799999999999997 23.8375 26.950000000000003 40-41 25.2 23.4125 24.337500000000002 27.05 42-43 25.162499999999998 22.8875 24.65 27.3 44-45 25.8625 22.9625 24.087500000000002 27.0875 46-47 25.4375 23.962500000000002 24.275 26.325 48-49 26.21018309505894 23.46375721093554 23.037371457236016 27.2886882367695 50-51 25.275 23.425 24.525 26.775 52-53 25.55 23.1625 23.7875 27.500000000000004 54-55 25.7 22.25 23.95 28.1 56-57 24.575 23.375 24.6 27.450000000000003 58-59 24.875 23.65 24.775 26.700000000000003 60-61 25.05 22.7625 24.55 27.6375 62-63 26.6 22.8625 24.5125 26.025 64-65 25.874999999999996 23.45 23.6125 27.0625 66-67 26.2875 23.3875 23.150000000000002 27.175 68-69 25.394835798445726 23.70268237653547 23.740285785911254 27.162196039107545 70-71 26.3125 23.275000000000002 24.375 26.0375 72-73 25.974999999999998 24.3125 22.725 26.987499999999997 74-75 25.55 24.087500000000002 24.025 26.337500000000002 76-77 25.662499999999998 24.25 23.5125 26.575 78-79 26.200000000000003 23.3875 23.125 27.287499999999998 80-81 25.4625 25.2 22.675 26.6625 82-83 25.9625 23.6875 23.45 26.900000000000002 84-85 26.0125 24.4125 23.3 26.275 86-87 26.0 24.125 23.7375 26.137500000000003 88-89 26.625 24.65 22.475 26.25 90-91 26.6 24.087500000000002 22.775000000000002 26.5375 92-93 26.3625 24.6125 22.912499999999998 26.1125 94-95 26.05 24.95 22.1875 26.8125 96-97 26.1 25.412499999999998 21.087500000000002 27.400000000000002 98-99 25.4375 25.0125 22.537499999999998 27.0125 100-101 25.974999999999998 24.325 22.75 26.950000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 1.0 29 2.5 30 3.0 31 3.0 32 4.0 33 6.5 34 12.0 35 16.0 36 21.0 37 31.5 38 43.5 39 54.0 40 72.5 41 98.5 42 122.0 43 143.5 44 145.0 45 157.5 46 165.0 47 153.5 48 151.5 49 152.0 50 152.0 51 136.0 52 117.5 53 118.0 54 133.5 55 134.5 56 144.0 57 151.0 58 134.0 59 130.5 60 135.0 61 131.0 62 118.0 63 100.0 64 95.0 65 92.5 66 81.0 67 73.5 68 58.5 69 49.5 70 46.5 71 35.0 72 27.5 73 21.5 74 12.0 75 7.0 76 4.5 77 1.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.325 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.27499999999999997 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.95 #Duplication Level Percentage of deduplicated Percentage of total 1 97.75657555440948 94.77499999999999 2 1.9339865910263023 3.75 3 0.28365136668385765 0.8250000000000001 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0257864878803507 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGC 26 0.65 TruSeq Adapter, Index 9 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.037500000000000006 0.0 0.0 0.0 0.0 42-43 0.0625 0.0 0.0 0.0 0.0 44-45 0.0875 0.0 0.0 0.0 0.0 46-47 0.1375 0.0 0.0 0.0 0.0 48-49 0.15 0.0 0.0 0.0 0.0 50-51 0.15 0.0 0.0 0.0 0.0 52-53 0.2 0.0 0.0 0.0 0.0 54-55 0.3125 0.0 0.0 0.0 0.0 56-57 0.35 0.0 0.0 0.0 0.0 58-59 0.44999999999999996 0.0 0.0 0.0 0.0 60-61 0.6000000000000001 0.0 0.0 0.0 0.0 62-63 0.9125 0.0 0.0 0.0 0.0 64-65 1.125 0.0 0.0 0.0 0.0 66-67 1.4875 0.0 0.0 0.0 0.0 68-69 1.8375 0.0 0.0 0.0 0.0 70-71 2.2375 0.0 0.0 0.0 0.0 72-73 2.6125 0.0 0.0 0.0 0.0 74-75 3.225 0.0 0.0 0.0 0.0 76-77 3.75 0.0 0.0 0.0 0.0 78-79 4.324999999999999 0.0 0.0 0.0 0.0 80-81 5.050000000000001 0.0 0.0 0.0 0.0 82-83 5.887499999999999 0.0 0.0 0.0 0.0 84-85 6.7875 0.0 0.0 0.0 0.0 86-87 7.737500000000001 0.0 0.0 0.0 0.0 88-89 8.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGATCG 15 0.009967554 47.487495 88-89 >>END_MODULE Read 500751 spots for SRR6126817.sra Written 500751 spots for SRR6126817.sra Read 500751 spots for SRR6126817.sra Written 500751 spots for SRR6126817.sra Read 500751 spots for SRR6126817.sra Written 500751 spots for SRR6126817.sra Read 500751 spots for SRR6126817.sra Written 500751 spots for SRR6126817.sra Read 500751 spots for SRR6126817.sra Written 500751 spots for SRR6126817.sra Read 500751 spots for SRR6126817.sra Written 500751 spots for SRR6126817.sra Read 500751 spots for SRR6126817.sra Written 500751 spots for SRR6126817.sra Read 500751 spots for SRR6126817.sra Written 500751 spots for SRR6126817.sra Read 500751 spots for SRR6126817.sra Written 500751 spots for SRR6126817.sra Read 500751 spots for SRR6126817.sra Written 500751 spots for SRR6126817.sra Read 500751 spots for SRR6126817.sra Written 500751 spots for SRR6126817.sra Read 500751 spots for SRR6126817.sra Written 500751 spots for SRR6126817.sra Read 500751 spots for SRR6126817.sra Written 500751 spots for SRR6126817.sra Read 500751 spots for SRR6126817.sra Written 500751 spots for SRR6126817.sra Read 500751 spots for SRR6126817.sra Written 500751 spots for SRR6126817.sra Read 500751 spots for SRR6126817.sra Written 500751 spots for SRR6126817.sra Read 500751 spots for SRR6126817.sra Written 500751 spots for SRR6126817.sra Read 500751 spots for SRR6126817.sra Written 500751 spots for SRR6126817.sra Read 500767 spots for SRR6126817.sra Written 500767 spots for SRR6126817.sra Read 500751 spots for SRR6126817.sra Written 500751 spots for SRR6126817.sra SRR ids: ['SRR6126817.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_706arl6q SRR6126817.sra spots: 10015036 blocks: [[1, 500751], [500752, 1001502], [1001503, 1502253], [1502254, 2003004], [2003005, 2503755], [2503756, 3004506], [3004507, 3505257], [3505258, 4006008], [4006009, 4506759], [4506760, 5007510], [5007511, 5508261], [5508262, 6009012], [6009013, 6509763], [6509764, 7010514], [7010515, 7511265], [7511266, 8012016], [8012017, 8512767], [8512768, 9013518], [9013519, 9514269], [9514270, 10015036]] SRR6126817 file size 2742296 SRR6126817 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6126817 SRR6126817_1.fastq Input file: SRR6126817_1.fastq trimmed: SRR6126817-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 05:06:04 2024 >> started Tue Dec 10 05:06:11 2024 >> done (6.711s) 10015036 reads processed; of these: 1676 ( 0.02%) short reads filtered out after trimming by size control 75560 ( 0.75%) empty reads filtered out after trimming by size control 9937800 (99.23%) reads available; of these: 450552 ( 4.53%) trimmed reads available after processing 9487248 (95.47%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 47 0.00% 19 51 0.00% 20 37 0.00% 21 44 0.00% 22 71 0.00% 23 34 0.00% 24 54 0.00% 25 36 0.00% 26 47 0.00% 27 58 0.00% 28 64 0.00% 29 62 0.00% 30 84 0.00% 31 107 0.00% 32 151 0.00% 33 189 0.00% 34 197 0.00% 35 206 0.00% 36 266 0.00% 37 287 0.00% 38 392 0.00% 39 483 0.00% 40 613 0.01% 41 792 0.01% 42 885 0.01% 43 1031 0.01% 44 1190 0.01% 45 1400 0.01% 46 1569 0.02% 47 2028 0.02% 48 2457 0.02% 49 2792 0.03% 50 3422 0.03% 51 4146 0.04% 52 4726 0.05% 53 5245 0.05% 54 5727 0.06% 55 6545 0.07% 56 6886 0.07% 57 7854 0.08% 58 8983 0.09% 59 10007 0.10% 60 11485 0.12% 61 13141 0.13% 62 14282 0.14% 63 15505 0.16% 64 16920 0.17% 65 17675 0.18% 66 18390 0.19% 67 19724 0.20% 68 20429 0.21% 69 20804 0.21% 70 192 0.00% 71 398 0.00% 72 2249 0.02% 73 2489 0.03% 74 612 0.01% 75 174 0.00% 76 171 0.00% 77 182 0.00% 78 169 0.00% 79 165 0.00% 80 210 0.00% 81 327 0.00% 82 260 0.00% 83 287 0.00% 84 335 0.00% 85 311 0.00% 86 390 0.00% 87 467 0.00% 88 509 0.01% 89 594 0.01% 90 800 0.01% 91 1023 0.01% 92 955 0.01% 93 1187 0.01% 94 1529 0.02% 95 1918 0.02% 96 2578 0.03% 97 3543 0.04% 98 7095 0.07% 99 13006 0.13% 100 156807 1.58% 101 9487248 95.47% 9937800 reads passed initial QC criterion=sequence-density sequence-density=6.65 sequence-density-rank=1 fanout-score=53.29 fanout-score-rank=1 prefix-density=8.04 prefix-fanout=44.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTGA criterion=fanout-score sequence-density=6.65 sequence-density-rank=1 fanout-score=53.29 fanout-score-rank=1 prefix-density=8.04 prefix-fanout=44.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTGA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTGA -o SRR6126817 - Input file: STDIN trimmed: SRR6126817-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Tue Dec 10 05:06:33 2024 >> started Tue Dec 10 05:06:44 2024 >> done (10.629s) 7098429 reads processed; of these: 9 ( 0.00%) short reads filtered out after trimming by size control 4162 ( 0.06%) empty reads filtered out after trimming by size control 7094258 (99.94%) reads available; of these: 989771 (13.95%) trimmed reads available after processing 6104487 (86.05%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 37 0.00% 19 38 0.00% 20 34 0.00% 21 36 0.00% 22 48 0.00% 23 24 0.00% 24 39 0.00% 25 26 0.00% 26 32 0.00% 27 42 0.00% 28 46 0.00% 29 39 0.00% 30 60 0.00% 31 80 0.00% 32 126 0.00% 33 126 0.00% 34 152 0.00% 35 141 0.00% 36 191 0.00% 37 210 0.00% 38 282 0.00% 39 337 0.00% 40 446 0.01% 41 558 0.01% 42 632 0.01% 43 768 0.01% 44 882 0.01% 45 1005 0.01% 46 1148 0.02% 47 1459 0.02% 48 1796 0.03% 49 2021 0.03% 50 2457 0.03% 51 2999 0.04% 52 3398 0.05% 53 3766 0.05% 54 4099 0.06% 55 4736 0.07% 56 4934 0.07% 57 5640 0.08% 58 6497 0.09% 59 7226 0.10% 60 8178 0.12% 61 9389 0.13% 62 10268 0.14% 63 11053 0.16% 64 12119 0.17% 65 12610 0.18% 66 13229 0.19% 67 13942 0.20% 68 14607 0.21% 69 15165 0.21% 70 16520 0.23% 71 17201 0.24% 72 19091 0.27% 73 20715 0.29% 74 21316 0.30% 75 22280 0.31% 76 23001 0.32% 77 23230 0.33% 78 23595 0.33% 79 25191 0.36% 80 25639 0.36% 81 26601 0.37% 82 28522 0.40% 83 29188 0.41% 84 30269 0.43% 85 31919 0.45% 86 32348 0.46% 87 32362 0.46% 88 33809 0.48% 89 33874 0.48% 90 34435 0.49% 91 35684 0.50% 92 36561 0.52% 93 37285 0.53% 94 39696 0.56% 95 42103 0.59% 96 48801 0.69% 97 65159 0.92% 98 147179 2.07% 99 8276 0.12% 100 95314 1.34% 101 5807921 81.87% criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=20 prefix-density=0.95 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.28 sequence-density-rank=30 fanout-score=10.37 fanout-score-rank=1 prefix-density=1.27 prefix-fanout=2.3 sequence=CCGAACATGGGAAGCTTCCACAT Started job on | Dec 10 05:07:06 Started mapping on | Dec 10 05:07:06 Finished on | Dec 10 05:07:21 Mapping speed, Million of reads per hour | 2384.07 Number of input reads | 9933629 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 8987620 Uniquely mapped reads % | 90.48% Average mapped length | 97.99 Number of splices: Total | 2644794 Number of splices: Annotated (sjdb) | 2514080 Number of splices: GT/AG | 2607853 Number of splices: GC/AG | 31522 Number of splices: AT/AC | 814 Number of splices: Non-canonical | 4605 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.85 Insertion rate per base | 0.01% Insertion average length | 1.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 531840 % of reads mapped to multiple loci | 5.35% Number of reads mapped to too many loci | 220960 % of reads mapped to too many loci | 2.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.81% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 414169 414169 414169 N_multimapping 531840 531840 531840 N_noFeature 260938 8774681 329333 N_ambiguous 163014 545 19133 UnstrandedReadsAssigned:8563668 PositiveStrandReadsAssigned:212394 NegativeStrandReadsAssigned:8639154 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR6126817 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6126817-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,933,629 reads, 8,697,241 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,139 rounds 52973 SRR6126817.ke.tsv 35125 SRR6126817.se.tsv 88098 total ==> SRR6126817.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 12.3018 2.53417 PNS24247 1044 945 17.635 3.21764 PNS24249 1928 1829 11.9831 1.12967 PNS24246 1044 945 17.635 3.21764 PNS24248 1044 945 17.635 3.21764 PNS24244 1471 1372 26.8101 3.36929 PNS24243 293 194 0 0 KQK14069 1603 1504 1898.41 217.639 KQK14071 474 375 404.126 185.814 ==> SRR6126817.se.tsv <== BRADI_1g14170v3 2954 BRADI_1g53295v3 18 BRADI_1g59795v3 111 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 94 BRADI_1g74790v3 34 BRADI_1g09890v3 0 BRADI_1g77505v3 100 BRADI_1g48960v3 0 SRR6126817 completed mapping pipeline successfully