Starting /dee2/code/volunteer_pipeline.sh SRR6126818 current disk space = 1525949792256 free memory = 1554969188 SRR6126818 SRAfilesize e30e31079f6ff49c0fb4fbbed3dbb80c SRR6126818.sra SRR6126818.sra file validated SRR6126818 is single end SRR6126818 is conventional basespace SRR6126818 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6126818_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.4685 35.0 35.0 35.0 35.0 35.0 2 34.7245 35.0 35.0 35.0 35.0 35.0 3 34.764 35.0 35.0 35.0 35.0 35.0 4 34.8025 35.0 35.0 35.0 35.0 35.0 5 34.804 35.0 35.0 35.0 35.0 35.0 6 38.926 39.0 39.0 40.0 37.0 40.0 7 39.32 40.0 39.0 40.0 39.0 40.0 8 39.5035 40.0 40.0 40.0 39.0 40.0 9 39.56025 40.0 40.0 40.0 39.0 40.0 10-11 39.5895 40.0 40.0 40.0 39.0 40.0 12-13 39.629374999999996 40.0 40.0 40.0 39.0 40.0 14-15 39.634375 40.0 40.0 40.0 39.0 40.0 16-17 39.612 40.0 40.0 40.0 39.0 40.0 18-19 39.627125 40.0 40.0 40.0 39.0 40.0 20-21 39.604875 40.0 40.0 40.0 39.0 40.0 22-23 39.613625 40.0 40.0 40.0 39.0 40.0 24-25 39.561 40.0 40.0 40.0 39.0 40.0 26-27 39.592749999999995 40.0 40.0 40.0 39.0 40.0 28-29 39.610625 40.0 40.0 40.0 39.0 40.0 30-31 39.579125000000005 40.0 40.0 40.0 39.0 40.0 32-33 39.57525 40.0 40.0 40.0 39.0 40.0 34-35 39.567 40.0 40.0 40.0 39.0 40.0 36-37 39.554500000000004 40.0 40.0 40.0 39.0 40.0 38-39 39.5235 40.0 40.0 40.0 39.0 40.0 40-41 39.513000000000005 40.0 40.0 40.0 39.0 40.0 42-43 39.547375 40.0 40.0 40.0 39.0 40.0 44-45 39.467875 40.0 40.0 40.0 39.0 40.0 46-47 39.504 40.0 40.0 40.0 39.0 40.0 48-49 39.391375 40.0 40.0 40.0 39.0 40.0 50-51 39.413 40.0 39.5 40.0 39.0 40.0 52-53 39.477374999999995 40.0 40.0 40.0 39.0 40.0 54-55 39.450375 40.0 40.0 40.0 39.0 40.0 56-57 39.440875 40.0 40.0 40.0 39.0 40.0 58-59 39.4255 40.0 39.0 40.0 39.0 40.0 60-61 39.46325 40.0 39.0 40.0 39.0 40.0 62-63 39.48525 40.0 40.0 40.0 39.0 40.0 64-65 39.466375 40.0 39.5 40.0 39.0 40.0 66-67 39.459125 40.0 39.5 40.0 39.0 40.0 68-69 39.252250000000004 40.0 39.0 40.0 39.0 40.0 70-71 39.323499999999996 40.0 39.0 40.0 39.0 40.0 72-73 39.42075 40.0 39.0 40.0 39.0 40.0 74-75 39.402375 40.0 39.0 40.0 39.0 40.0 76-77 39.344 40.0 39.0 40.0 39.0 40.0 78-79 39.359624999999994 40.0 39.0 40.0 39.0 40.0 80-81 39.31425 40.0 39.0 40.0 39.0 40.0 82-83 39.343375 40.0 39.0 40.0 39.0 40.0 84-85 39.322374999999994 40.0 39.0 40.0 38.5 40.0 86-87 39.276125 40.0 39.0 40.0 38.5 40.0 88-89 39.287125 40.0 39.0 40.0 38.5 40.0 90-91 39.318875000000006 40.0 39.0 40.0 38.5 40.0 92-93 39.279250000000005 40.0 39.0 40.0 38.0 40.0 94-95 39.232124999999996 40.0 39.0 40.0 38.0 40.0 96-97 39.2325 40.0 39.0 40.0 38.0 40.0 98-99 39.238 40.0 39.0 40.0 38.0 40.0 100-101 37.888125 39.5 37.5 40.0 34.5 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 2.0 27 2.0 28 4.0 29 8.0 30 4.0 31 4.0 32 11.0 33 17.0 34 16.0 35 24.0 36 31.0 37 90.0 38 349.0 39 3437.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.76503284487114 9.247094492167761 7.150075795856494 48.8377968671046 2 22.1 13.225000000000001 38.95 25.724999999999998 3 22.05 16.675 22.75 38.525 4 29.025000000000002 23.65 19.575 27.750000000000004 5 28.4 28.749999999999996 21.349999999999998 21.5 6 23.674999999999997 30.325000000000003 23.275000000000002 22.725 7 19.175 21.325 38.550000000000004 20.95 8 22.35 21.55 29.299999999999997 26.8 9 20.225 20.05 34.050000000000004 25.674999999999997 10-11 25.387500000000003 28.050000000000004 22.162499999999998 24.4 12-13 25.174999999999997 22.15 25.525 27.150000000000002 14-15 24.25 24.637500000000003 25.124999999999996 25.9875 16-17 25.337500000000002 23.674999999999997 24.462500000000002 26.525 18-19 25.674999999999997 23.7625 24.837500000000002 25.724999999999998 20-21 24.425 24.75 25.0125 25.8125 22-23 24.65 24.175 24.075 27.1 24-25 25.124999999999996 24.0125 24.7875 26.075 26-27 24.075 24.75 25.2625 25.912499999999998 28-29 25.3 24.349999999999998 24.375 25.974999999999998 30-31 24.453056632079008 23.827978497312163 25.103137892236532 26.615826978372297 32-33 24.6 24.087500000000002 24.65 26.6625 34-35 24.575 24.525 24.587500000000002 26.3125 36-37 25.0 23.3375 24.975 26.687499999999996 38-39 24.318579644911228 23.85596399099775 25.09377344336084 26.731682920730183 40-41 24.5 24.0 25.025 26.474999999999998 42-43 25.7375 23.275000000000002 23.9125 27.075 44-45 25.093820365273956 24.1556167125344 25.293970477858394 25.456592444333246 46-47 25.7875 24.1875 23.974999999999998 26.05 48-49 24.95300162927685 24.52688306805364 23.97543551823537 26.544679784434138 50-51 23.5875 24.762500000000003 24.575 27.075 52-53 25.19064883110389 23.55294411801475 24.0780097512189 27.17839729966246 54-55 24.96248124062031 24.087043521760883 23.67433716858429 27.276138069034516 56-57 23.62135800925347 24.221583093660122 25.05939727397774 27.097661623108664 58-59 24.224612306153077 24.12456228114057 24.96248124062031 26.688344172086044 60-61 26.125 23.3625 24.625 25.887500000000003 62-63 24.5625 24.65 24.6 26.187500000000004 64-65 24.95 23.8625 24.2875 26.900000000000002 66-67 25.724999999999998 23.5875 23.825 26.8625 68-69 24.47061771707806 24.6460343315374 24.345320135321387 26.53802781606315 70-71 25.337500000000002 23.6875 24.6625 26.3125 72-73 25.15 22.5875 25.25 27.0125 74-75 25.3 24.1875 24.3625 26.150000000000002 76-77 24.587500000000002 24.462500000000002 24.337500000000002 26.6125 78-79 25.124999999999996 24.15 23.9125 26.8125 80-81 24.9375 23.575 24.65 26.8375 82-83 25.7125 24.3875 23.6375 26.2625 84-85 26.437500000000004 23.974999999999998 24.025 25.5625 86-87 24.825 23.6125 24.825 26.737499999999997 88-89 25.324999999999996 23.875 24.3625 26.437500000000004 90-91 26.487500000000004 23.2875 23.799999999999997 26.424999999999997 92-93 26.087500000000002 24.6 23.599999999999998 25.7125 94-95 24.962500000000002 25.2 23.775 26.0625 96-97 25.6125 23.775 23.5 27.1125 98-99 25.2875 24.4375 24.6625 25.6125 100-101 25.8125 23.9375 23.625 26.625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 0.5 28 0.0 29 0.5 30 1.0 31 5.0 32 7.5 33 5.5 34 12.5 35 19.0 36 23.5 37 33.0 38 57.5 39 81.5 40 98.0 41 121.0 42 140.0 43 161.0 44 166.0 45 144.5 46 146.0 47 154.5 48 160.0 49 148.0 50 136.0 51 153.0 52 144.5 53 135.0 54 140.0 55 132.0 56 130.5 57 140.5 58 133.0 59 136.5 60 137.5 61 122.5 62 118.5 63 104.5 64 81.5 65 70.0 66 69.0 67 61.5 68 51.0 69 39.5 70 25.5 71 17.5 72 11.5 73 9.0 74 7.0 75 4.0 76 1.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0125 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.025 40-41 0.0 42-43 0.0 44-45 0.075 46-47 0.0 48-49 0.2625 50-51 0.0 52-53 0.0125 54-55 0.05 56-57 0.0375 58-59 0.05 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.2375 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.32027827879412 94.425 2 2.3705230610667356 4.6 3 0.23189899510435455 0.675 4 0.07729966503478485 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.32499999999999996 0.0 0.0 0.0 0.0 70-71 0.4125 0.0 0.0 0.0 0.0 72-73 0.5125 0.0 0.0 0.0 0.0 74-75 0.6 0.0 0.0 0.0 0.0 76-77 0.7 0.0 0.0 0.0 0.0 78-79 0.95 0.0 0.0 0.0 0.0 80-81 1.1375000000000002 0.0 0.0 0.0 0.0 82-83 1.525 0.0 0.0 0.0 0.0 84-85 2.0250000000000004 0.0 0.0 0.0 0.0 86-87 2.4875 0.0 0.0 0.0 0.0 88-89 2.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 567521 spots for SRR6126818.sra Written 567521 spots for SRR6126818.sra Read 567521 spots for SRR6126818.sra Written 567521 spots for SRR6126818.sra Read 567521 spots for SRR6126818.sra Written 567521 spots for SRR6126818.sra Read 567521 spots for SRR6126818.sra Written 567521 spots for SRR6126818.sra Read 567521 spots for SRR6126818.sra Written 567521 spots for SRR6126818.sra Read 567534 spots for SRR6126818.sra Written 567534 spots for SRR6126818.sra Read 567521 spots for SRR6126818.sra Written 567521 spots for SRR6126818.sra Read 567521 spots for SRR6126818.sra Written 567521 spots for SRR6126818.sra Read 567521 spots for SRR6126818.sra Written 567521 spots for SRR6126818.sra Read 567521 spots for SRR6126818.sra Written 567521 spots for SRR6126818.sra Read 567521 spots for SRR6126818.sra Written 567521 spots for SRR6126818.sra Read 567521 spots for SRR6126818.sra Written 567521 spots for SRR6126818.sra Read 567521 spots for SRR6126818.sra Written 567521 spots for SRR6126818.sra Read 567521 spots for SRR6126818.sra Written 567521 spots for SRR6126818.sra Read 567521 spots for SRR6126818.sra Written 567521 spots for SRR6126818.sra Read 567521 spots for SRR6126818.sra Written 567521 spots for SRR6126818.sra Read 567521 spots for SRR6126818.sra Written 567521 spots for SRR6126818.sra Read 567521 spots for SRR6126818.sra Written 567521 spots for SRR6126818.sra Read 567521 spots for SRR6126818.sra Written 567521 spots for SRR6126818.sra Read 567521 spots for SRR6126818.sra Written 567521 spots for SRR6126818.sra SRR ids: ['SRR6126818.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0fqhpceb SRR6126818.sra spots: 11350433 blocks: [[1, 567521], [567522, 1135042], [1135043, 1702563], [1702564, 2270084], [2270085, 2837605], [2837606, 3405126], [3405127, 3972647], [3972648, 4540168], [4540169, 5107689], [5107690, 5675210], [5675211, 6242731], [6242732, 6810252], [6810253, 7377773], [7377774, 7945294], [7945295, 8512815], [8512816, 9080336], [9080337, 9647857], [9647858, 10215378], [10215379, 10782899], [10782900, 11350433]] SRR6126818 file size 3109403 SRR6126818 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6126818 SRR6126818_1.fastq Input file: SRR6126818_1.fastq trimmed: SRR6126818-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 05:08:33 2024 >> started Tue Dec 10 05:08:39 2024 >> done (6.186s) 11350433 reads processed; of these: 775 ( 0.01%) short reads filtered out after trimming by size control 2046 ( 0.02%) empty reads filtered out after trimming by size control 11347612 (99.98%) reads available; of these: 249614 ( 2.20%) trimmed reads available after processing 11097998 (97.80%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 32 0.00% 19 32 0.00% 20 25 0.00% 21 28 0.00% 22 44 0.00% 23 25 0.00% 24 41 0.00% 25 36 0.00% 26 26 0.00% 27 38 0.00% 28 37 0.00% 29 54 0.00% 30 61 0.00% 31 64 0.00% 32 63 0.00% 33 75 0.00% 34 100 0.00% 35 96 0.00% 36 110 0.00% 37 115 0.00% 38 130 0.00% 39 148 0.00% 40 186 0.00% 41 202 0.00% 42 234 0.00% 43 265 0.00% 44 258 0.00% 45 301 0.00% 46 344 0.00% 47 373 0.00% 48 489 0.00% 49 511 0.00% 50 634 0.01% 51 692 0.01% 52 788 0.01% 53 867 0.01% 54 872 0.01% 55 993 0.01% 56 1128 0.01% 57 1284 0.01% 58 1451 0.01% 59 1648 0.01% 60 1931 0.02% 61 2253 0.02% 62 2460 0.02% 63 2834 0.02% 64 3179 0.03% 65 3377 0.03% 66 3806 0.03% 67 4397 0.04% 68 4845 0.04% 69 5245 0.05% 70 134 0.00% 71 182 0.00% 72 541 0.00% 73 313 0.00% 74 154 0.00% 75 168 0.00% 76 167 0.00% 77 176 0.00% 78 209 0.00% 79 170 0.00% 80 230 0.00% 81 380 0.00% 82 283 0.00% 83 345 0.00% 84 350 0.00% 85 379 0.00% 86 411 0.00% 87 420 0.00% 88 567 0.00% 89 598 0.01% 90 786 0.01% 91 1085 0.01% 92 969 0.01% 93 1229 0.01% 94 1596 0.01% 95 2024 0.02% 96 2749 0.02% 97 3738 0.03% 98 7691 0.07% 99 13631 0.12% 100 158712 1.40% 101 11097998 97.80% 11347612 reads passed initial QC criterion=sequence-density sequence-density=2.89 sequence-density-rank=1 fanout-score=59.53 fanout-score-rank=1 prefix-density=3.93 prefix-fanout=43.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=2.89 sequence-density-rank=1 fanout-score=59.53 fanout-score-rank=1 prefix-density=3.93 prefix-fanout=43.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTG Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTG -o SRR6126818 - Input file: STDIN trimmed: SRR6126818-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Tue Dec 10 05:09:05 2024 >> started Tue Dec 10 05:09:09 2024 >> done (4.712s) 3782537 reads processed; of these: 1 ( 0.00%) short reads filtered out after trimming by size control 239 ( 0.01%) empty reads filtered out after trimming by size control 3782297 (99.99%) reads available; of these: 364248 ( 9.63%) trimmed reads available after processing 3418049 (90.37%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 8 0.00% 20 10 0.00% 21 8 0.00% 22 13 0.00% 23 13 0.00% 24 16 0.00% 25 11 0.00% 26 10 0.00% 27 7 0.00% 28 9 0.00% 29 16 0.00% 30 18 0.00% 31 24 0.00% 32 21 0.00% 33 22 0.00% 34 35 0.00% 35 32 0.00% 36 42 0.00% 37 53 0.00% 38 43 0.00% 39 53 0.00% 40 63 0.00% 41 62 0.00% 42 84 0.00% 43 87 0.00% 44 85 0.00% 45 106 0.00% 46 119 0.00% 47 130 0.00% 48 179 0.00% 49 178 0.00% 50 192 0.01% 51 243 0.01% 52 254 0.01% 53 307 0.01% 54 294 0.01% 55 322 0.01% 56 391 0.01% 57 414 0.01% 58 484 0.01% 59 553 0.01% 60 684 0.02% 61 750 0.02% 62 822 0.02% 63 975 0.03% 64 1078 0.03% 65 1146 0.03% 66 1317 0.03% 67 1432 0.04% 68 1571 0.04% 69 1777 0.05% 70 2078 0.05% 71 2228 0.06% 72 2492 0.07% 73 2877 0.08% 74 3246 0.09% 75 3616 0.10% 76 3867 0.10% 77 4357 0.12% 78 4735 0.13% 79 5384 0.14% 80 5956 0.16% 81 6566 0.17% 82 7315 0.19% 83 7853 0.21% 84 8692 0.23% 85 9704 0.26% 86 10130 0.27% 87 10976 0.29% 88 12132 0.32% 89 12733 0.34% 90 13872 0.37% 91 15184 0.40% 92 15942 0.42% 93 17192 0.45% 94 18897 0.50% 95 20267 0.54% 96 24950 0.66% 97 35060 0.93% 98 84333 2.23% 99 4180 0.11% 100 48593 1.28% 101 3340312 88.31% criterion=sequence-density sequence-density=1.10 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=15 prefix-density=1.10 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.33 sequence-density-rank=21 fanout-score=9.33 fanout-score-rank=1 prefix-density=1.48 prefix-fanout=2.1 sequence=CCGAACATGGGAAGCTTCCACAT Started job on | Dec 10 05:09:49 Started mapping on | Dec 10 05:09:50 Finished on | Dec 10 05:10:15 Mapping speed, Million of reads per hour | 1634.02 Number of input reads | 11347372 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 10356324 Uniquely mapped reads % | 91.27% Average mapped length | 99.75 Number of splices: Total | 3130007 Number of splices: Annotated (sjdb) | 2969040 Number of splices: GT/AG | 3084898 Number of splices: GC/AG | 38191 Number of splices: AT/AC | 921 Number of splices: Non-canonical | 5997 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.90 Insertion rate per base | 0.01% Insertion average length | 1.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 555647 % of reads mapped to multiple loci | 4.90% Number of reads mapped to too many loci | 208044 % of reads mapped to too many loci | 1.83% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.88% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 435401 435401 435401 N_multimapping 555647 555647 555647 N_noFeature 304557 10112216 376775 N_ambiguous 192266 593 21097 UnstrandedReadsAssigned:9859501 PositiveStrandReadsAssigned:243515 NegativeStrandReadsAssigned:9958452 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR6126818 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6126818-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,347,372 reads, 10,031,706 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52973 SRR6126818.ke.tsv 35125 SRR6126818.se.tsv 88098 total ==> SRR6126818.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 68.199 12.1917 PNS24247 1044 945 3.99045 0.631831 PNS24249 1928 1829 20.0109 1.63706 PNS24246 1044 945 3.99045 0.631831 PNS24248 1044 945 3.99045 0.631831 PNS24244 1471 1372 14.8188 1.6161 PNS24243 293 194 0 0 KQK14069 1603 1504 2141.74 213.074 KQK14071 474 375 352.006 140.453 ==> SRR6126818.se.tsv <== BRADI_1g14170v3 3014 BRADI_1g53295v3 14 BRADI_1g59795v3 179 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 152 BRADI_1g74790v3 44 BRADI_1g09890v3 0 BRADI_1g77505v3 105 BRADI_1g48960v3 0 SRR6126818 completed mapping pipeline successfully