Starting /dee2/code/volunteer_pipeline.sh SRR6126819 current disk space = 1525999247360 free memory = 1401915652 SRR6126819 SRAfilesize d67e977960793c0c22f17b0870a2e266 SRR6126819.sra SRR6126819.sra file validated SRR6126819 is single end SRR6126819 is conventional basespace SRR6126819 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6126819_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.59375 35.0 35.0 35.0 35.0 35.0 2 34.76225 35.0 35.0 35.0 35.0 35.0 3 34.75775 35.0 35.0 35.0 35.0 35.0 4 34.78875 35.0 35.0 35.0 35.0 35.0 5 34.836 35.0 35.0 35.0 35.0 35.0 6 39.111 40.0 39.0 40.0 38.0 40.0 7 39.39125 40.0 39.0 40.0 39.0 40.0 8 39.544 40.0 39.0 40.0 39.0 40.0 9 39.639 40.0 40.0 40.0 39.0 40.0 10-11 39.652375000000006 40.0 40.0 40.0 39.0 40.0 12-13 39.648250000000004 40.0 40.0 40.0 39.0 40.0 14-15 39.646 40.0 40.0 40.0 39.0 40.0 16-17 39.6275 40.0 40.0 40.0 39.0 40.0 18-19 39.613875 40.0 40.0 40.0 39.0 40.0 20-21 39.606 40.0 40.0 40.0 39.0 40.0 22-23 39.6185 40.0 40.0 40.0 39.0 40.0 24-25 39.623375 40.0 40.0 40.0 39.0 40.0 26-27 39.59625 40.0 40.0 40.0 39.0 40.0 28-29 39.604124999999996 40.0 40.0 40.0 39.0 40.0 30-31 39.625375 40.0 40.0 40.0 39.0 40.0 32-33 39.604375000000005 40.0 40.0 40.0 39.0 40.0 34-35 39.585375 40.0 40.0 40.0 39.0 40.0 36-37 39.587 40.0 40.0 40.0 39.0 40.0 38-39 39.5865 40.0 40.0 40.0 39.0 40.0 40-41 39.562875 40.0 40.0 40.0 39.0 40.0 42-43 39.572625 40.0 40.0 40.0 39.0 40.0 44-45 39.541124999999994 40.0 40.0 40.0 39.0 40.0 46-47 39.583124999999995 40.0 40.0 40.0 39.0 40.0 48-49 39.552125000000004 40.0 40.0 40.0 39.0 40.0 50-51 39.531125 40.0 40.0 40.0 39.0 40.0 52-53 39.510625000000005 40.0 40.0 40.0 39.0 40.0 54-55 39.521125 40.0 39.5 40.0 39.0 40.0 56-57 39.50675 40.0 40.0 40.0 39.0 40.0 58-59 39.50212500000001 40.0 40.0 40.0 39.0 40.0 60-61 39.519875 40.0 39.5 40.0 39.0 40.0 62-63 39.511 40.0 40.0 40.0 39.0 40.0 64-65 39.504 40.0 40.0 40.0 39.0 40.0 66-67 39.476625 40.0 40.0 40.0 39.0 40.0 68-69 39.389125 40.0 39.0 40.0 39.0 40.0 70-71 39.39675 40.0 39.0 40.0 39.0 40.0 72-73 39.404624999999996 40.0 39.0 40.0 39.0 40.0 74-75 39.402375 40.0 39.0 40.0 39.0 40.0 76-77 39.409 40.0 39.0 40.0 39.0 40.0 78-79 39.398375 40.0 39.0 40.0 39.0 40.0 80-81 39.3905 40.0 39.0 40.0 39.0 40.0 82-83 39.342749999999995 40.0 39.0 40.0 39.0 40.0 84-85 39.3395 40.0 39.0 40.0 39.0 40.0 86-87 39.326875 40.0 39.0 40.0 38.0 40.0 88-89 39.30775 40.0 39.0 40.0 38.5 40.0 90-91 39.347 40.0 39.0 40.0 39.0 40.0 92-93 39.299875 40.0 39.0 40.0 39.0 40.0 94-95 39.280625 40.0 39.0 40.0 38.0 40.0 96-97 39.253875 40.0 39.0 40.0 38.0 40.0 98-99 39.2025 40.0 39.0 40.0 38.0 40.0 100-101 37.860625 39.5 37.5 40.0 34.5 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 0.0 27 1.0 28 3.0 29 4.0 30 7.0 31 7.0 32 8.0 33 6.0 34 14.0 35 26.0 36 34.0 37 59.0 38 373.0 39 3456.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.90826840914802 9.399346569489822 6.63483287258105 49.057552148781106 2 23.225 12.4 38.675 25.7 3 23.025000000000002 13.775 23.225 39.975 4 28.6107634543179 22.92866082603254 19.59949937421777 28.86107634543179 5 29.2 26.575 23.35 20.875 6 24.925 29.925 22.35 22.8 7 19.325 23.275000000000002 37.35 20.05 8 21.575 22.425 29.15 26.85 9 21.15 19.275000000000002 33.6 25.974999999999998 10-11 25.4875 28.349999999999998 21.8 24.3625 12-13 24.349999999999998 22.05 25.55 28.050000000000004 14-15 22.8875 23.150000000000002 26.700000000000003 27.2625 16-17 24.637500000000003 23.7125 25.412499999999998 26.237500000000004 18-19 25.3125 23.0625 24.6625 26.9625 20-21 25.724999999999998 24.349999999999998 24.3 25.624999999999996 22-23 25.45 24.55 24.275 25.724999999999998 24-25 24.099999999999998 24.3625 23.5375 28.000000000000004 26-27 23.825 24.212500000000002 25.6125 26.35 28-29 25.724999999999998 24.349999999999998 24.15 25.775 30-31 24.85 23.8375 23.525 27.787499999999998 32-33 24.825 23.8875 24.9125 26.375 34-35 25.2625 23.9375 24.462500000000002 26.337500000000002 36-37 25.6 22.5125 24.087500000000002 27.800000000000004 38-39 23.925 23.625 25.337500000000002 27.1125 40-41 25.7625 23.625 23.2125 27.400000000000002 42-43 25.587500000000002 23.6125 24.25 26.55 44-45 24.375 23.9125 25.775 25.937500000000004 46-47 25.1 23.775 24.1875 26.937499999999996 48-49 25.337500000000002 22.650000000000002 24.462500000000002 27.55 50-51 24.6625 23.6125 24.875 26.85 52-53 25.7 23.8125 23.7375 26.75 54-55 25.337500000000002 23.4875 24.099999999999998 27.075 56-57 24.087500000000002 23.4625 25.0375 27.4125 58-59 24.65 25.275 24.2875 25.7875 60-61 25.95 22.95 23.2875 27.8125 62-63 24.65 24.2 23.5625 27.5875 64-65 25.224999999999998 24.087500000000002 25.025 25.662499999999998 66-67 25.837500000000002 22.825 24.6625 26.674999999999997 68-69 25.2784382430234 23.626579902390187 23.864347390814665 27.230634463771743 70-71 25.51887971992998 24.36859214803701 24.056014003500874 26.056514128532132 72-73 25.365670708838607 22.677834729341168 24.57807225903238 27.378422302787847 74-75 24.425 23.9375 24.3125 27.325 76-77 25.874999999999996 23.525 23.75 26.85 78-79 24.3125 23.4375 24.712500000000002 27.537499999999998 80-81 25.775 24.05 23.8875 26.2875 82-83 25.775 22.7625 24.8125 26.650000000000002 84-85 25.650000000000002 23.6875 23.799999999999997 26.8625 86-87 25.662499999999998 23.2375 24.1875 26.9125 88-89 26.625 23.05 23.875 26.450000000000003 90-91 25.674999999999997 23.775 23.825 26.724999999999998 92-93 25.7375 24.349999999999998 23.95 25.9625 94-95 25.5375 25.224999999999998 23.0125 26.224999999999998 96-97 24.212500000000002 23.849999999999998 24.525 27.4125 98-99 26.090761345168147 23.740467558444806 24.390548818602326 25.778222277784725 100-101 25.9875 24.4 23.3375 26.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.5 28 1.5 29 1.0 30 3.0 31 6.0 32 4.5 33 6.0 34 9.5 35 13.0 36 22.5 37 37.5 38 52.5 39 69.0 40 81.0 41 95.5 42 120.5 43 132.5 44 150.5 45 168.5 46 162.0 47 156.0 48 157.0 49 163.5 50 150.5 51 145.0 52 144.0 53 134.0 54 135.5 55 135.0 56 144.0 57 143.5 58 136.5 59 144.0 60 144.0 61 138.0 62 117.0 63 91.0 64 85.5 65 84.0 66 72.5 67 60.5 68 52.5 69 38.5 70 29.5 71 20.5 72 13.0 73 10.0 74 6.5 75 5.5 76 4.0 77 1.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.0 3 0.0 4 0.125 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.11249999999999999 70-71 0.025 72-73 0.0125 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0125 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.42002063983489 94.39999999999999 2 2.141382868937048 4.15 3 0.30959752321981426 0.8999999999999999 4 0.07739938080495357 0.3 5 0.05159958720330237 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGGCGTACAAGTACACATGCATGCATATATCGATCGTCCGATGGATGGAC 5 0.125 No Hit CTGCTGTTTAGGCCTTGCCGGACTCCTCGCAGCCTGGAGGCTTGAAGGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.1875 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.275 0.0 0.0 0.0 0.0 70-71 0.3125 0.0 0.0 0.0 0.0 72-73 0.44999999999999996 0.0 0.0 0.0 0.0 74-75 0.5249999999999999 0.0 0.0 0.0 0.0 76-77 0.7375 0.0 0.0 0.0 0.0 78-79 0.975 0.0 0.0 0.0 0.0 80-81 1.225 0.0 0.0 0.0 0.0 82-83 1.5750000000000002 0.0 0.0 0.0 0.0 84-85 1.9625 0.0 0.0 0.0 0.0 86-87 2.5125 0.0 0.0 0.0 0.0 88-89 3.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 576549 spots for SRR6126819.sra Written 576549 spots for SRR6126819.sra Read 576549 spots for SRR6126819.sra Written 576549 spots for SRR6126819.sra Read 576549 spots for SRR6126819.sra Written 576549 spots for SRR6126819.sra Read 576549 spots for SRR6126819.sra Written 576549 spots for SRR6126819.sra Read 576549 spots for SRR6126819.sra Written 576549 spots for SRR6126819.sra Read 576549 spots for SRR6126819.sra Written 576549 spots for SRR6126819.sra Read 576549 spots for SRR6126819.sra Written 576549 spots for SRR6126819.sra Read 576549 spots for SRR6126819.sra Written 576549 spots for SRR6126819.sra Read 576549 spots for SRR6126819.sra Written 576549 spots for SRR6126819.sra Read 576567 spots for SRR6126819.sra Written 576567 spots for SRR6126819.sra Read 576549 spots for SRR6126819.sra Written 576549 spots for SRR6126819.sra Read 576549 spots for SRR6126819.sra Written 576549 spots for SRR6126819.sra Read 576549 spots for SRR6126819.sra Written 576549 spots for SRR6126819.sra Read 576549 spots for SRR6126819.sra Written 576549 spots for SRR6126819.sra Read 576549 spots for SRR6126819.sra Written 576549 spots for SRR6126819.sra Read 576549 spots for SRR6126819.sra Written 576549 spots for SRR6126819.sra Read 576549 spots for SRR6126819.sra Written 576549 spots for SRR6126819.sra Read 576549 spots for SRR6126819.sra Written 576549 spots for SRR6126819.sra Read 576549 spots for SRR6126819.sra Written 576549 spots for SRR6126819.sra Read 576549 spots for SRR6126819.sra Written 576549 spots for SRR6126819.sra SRR ids: ['SRR6126819.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ue0a5q9m SRR6126819.sra spots: 11530998 blocks: [[1, 576549], [576550, 1153098], [1153099, 1729647], [1729648, 2306196], [2306197, 2882745], [2882746, 3459294], [3459295, 4035843], [4035844, 4612392], [4612393, 5188941], [5188942, 5765490], [5765491, 6342039], [6342040, 6918588], [6918589, 7495137], [7495138, 8071686], [8071687, 8648235], [8648236, 9224784], [9224785, 9801333], [9801334, 10377882], [10377883, 10954431], [10954432, 11530998]] SRR6126819 file size 3158986 SRR6126819 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6126819 SRR6126819_1.fastq Input file: SRR6126819_1.fastq trimmed: SRR6126819-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 05:09:11 2024 >> started Tue Dec 10 05:09:16 2024 >> done (5.480s) 11530998 reads processed; of these: 785 ( 0.01%) short reads filtered out after trimming by size control 1752 ( 0.02%) empty reads filtered out after trimming by size control 11528461 (99.98%) reads available; of these: 253679 ( 2.20%) trimmed reads available after processing 11274782 (97.80%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 32 0.00% 19 20 0.00% 20 30 0.00% 21 22 0.00% 22 55 0.00% 23 32 0.00% 24 32 0.00% 25 43 0.00% 26 29 0.00% 27 31 0.00% 28 38 0.00% 29 59 0.00% 30 63 0.00% 31 56 0.00% 32 70 0.00% 33 96 0.00% 34 86 0.00% 35 109 0.00% 36 83 0.00% 37 108 0.00% 38 155 0.00% 39 148 0.00% 40 170 0.00% 41 244 0.00% 42 236 0.00% 43 261 0.00% 44 284 0.00% 45 293 0.00% 46 378 0.00% 47 377 0.00% 48 488 0.00% 49 536 0.00% 50 633 0.01% 51 713 0.01% 52 805 0.01% 53 899 0.01% 54 923 0.01% 55 1069 0.01% 56 1097 0.01% 57 1254 0.01% 58 1528 0.01% 59 1670 0.01% 60 1998 0.02% 61 2205 0.02% 62 2534 0.02% 63 2829 0.02% 64 3215 0.03% 65 3583 0.03% 66 3821 0.03% 67 4598 0.04% 68 4980 0.04% 69 5251 0.05% 70 114 0.00% 71 168 0.00% 72 447 0.00% 73 344 0.00% 74 171 0.00% 75 163 0.00% 76 192 0.00% 77 199 0.00% 78 187 0.00% 79 219 0.00% 80 266 0.00% 81 385 0.00% 82 291 0.00% 83 287 0.00% 84 363 0.00% 85 402 0.00% 86 416 0.00% 87 467 0.00% 88 576 0.00% 89 611 0.01% 90 747 0.01% 91 868 0.01% 92 1106 0.01% 93 1218 0.01% 94 1501 0.01% 95 1992 0.02% 96 2821 0.02% 97 4031 0.03% 98 6421 0.06% 99 13444 0.12% 100 162993 1.41% 101 11274782 97.80% 11528461 reads passed initial QC criterion=sequence-density sequence-density=2.90 sequence-density-rank=1 fanout-score=59.30 fanout-score-rank=1 prefix-density=3.94 prefix-fanout=43.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTC criterion=fanout-score sequence-density=2.90 sequence-density-rank=1 fanout-score=59.30 fanout-score-rank=1 prefix-density=3.94 prefix-fanout=43.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTC -o SRR6126819 - Input file: STDIN trimmed: SRR6126819-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Tue Dec 10 05:09:46 2024 >> started Tue Dec 10 05:09:52 2024 >> done (5.342s) 3842820 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 1 ( 0.00%) empty reads filtered out after trimming by size control 3842819 (100.00%) reads available; of these: 370308 ( 9.64%) trimmed reads available after processing 3472511 (90.36%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 6 0.00% 20 9 0.00% 21 5 0.00% 22 15 0.00% 23 5 0.00% 24 10 0.00% 25 11 0.00% 26 14 0.00% 27 10 0.00% 28 15 0.00% 29 15 0.00% 30 23 0.00% 31 14 0.00% 32 20 0.00% 33 35 0.00% 34 34 0.00% 35 35 0.00% 36 27 0.00% 37 36 0.00% 38 60 0.00% 39 39 0.00% 40 57 0.00% 41 79 0.00% 42 81 0.00% 43 91 0.00% 44 83 0.00% 45 103 0.00% 46 132 0.00% 47 134 0.00% 48 163 0.00% 49 178 0.00% 50 200 0.01% 51 240 0.01% 52 292 0.01% 53 310 0.01% 54 300 0.01% 55 367 0.01% 56 389 0.01% 57 404 0.01% 58 538 0.01% 59 571 0.01% 60 672 0.02% 61 719 0.02% 62 871 0.02% 63 965 0.03% 64 1077 0.03% 65 1183 0.03% 66 1227 0.03% 67 1551 0.04% 68 1684 0.04% 69 1792 0.05% 70 2100 0.05% 71 2316 0.06% 72 2740 0.07% 73 3058 0.08% 74 3262 0.08% 75 3647 0.09% 76 3927 0.10% 77 4402 0.11% 78 4703 0.12% 79 5393 0.14% 80 6036 0.16% 81 6662 0.17% 82 7453 0.19% 83 7985 0.21% 84 8888 0.23% 85 9754 0.25% 86 10478 0.27% 87 11127 0.29% 88 12523 0.33% 89 13265 0.35% 90 13908 0.36% 91 15407 0.40% 92 16500 0.43% 93 17683 0.46% 94 19203 0.50% 95 20698 0.54% 96 25351 0.66% 97 35820 0.93% 98 84267 2.19% 99 4117 0.11% 100 49257 1.28% 101 3393985 88.32% criterion=sequence-density sequence-density=1.09 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=17 prefix-density=1.09 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=21.33 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.2 sequence=ATTGGATTGACTAATGGTACACACGATTCACGATTCTTCCGTCATTCATTCACTCGTGCACCTCATGCTTAATTACATTGCGCGGGGTTCACTCCACCATGGTACAAATCAACACATAACTAGACAAAGGTACAAGTTGATCTACGGCGTACAAGTACACATGCATGCATATATCGATCGTCCGATGGATGGACCGATATATACTACAGCTAGCTGCTAATTCTCATTTAGCTCCCGGGGGCGAAGTTGGTAGCAAAGGCCCATGCATTGTTGTTGACTGGGTCGGCGACGTGGTCGAAGAGGTTCTCGACGGGTCCCTTGCCCGTGACGATGGC Started job on | Dec 10 05:10:16 Started mapping on | Dec 10 05:10:16 Finished on | Dec 10 05:10:35 Mapping speed, Million of reads per hour | 2184.34 Number of input reads | 11528460 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 10524320 Uniquely mapped reads % | 91.29% Average mapped length | 99.75 Number of splices: Total | 3185154 Number of splices: Annotated (sjdb) | 3021106 Number of splices: GT/AG | 3139422 Number of splices: GC/AG | 38547 Number of splices: AT/AC | 998 Number of splices: Non-canonical | 6187 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 1.89 Insertion rate per base | 0.01% Insertion average length | 1.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 565045 % of reads mapped to multiple loci | 4.90% Number of reads mapped to too many loci | 214217 % of reads mapped to too many loci | 1.86% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.87% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 439095 439095 439095 N_multimapping 565045 565045 565045 N_noFeature 308848 10275569 382383 N_ambiguous 195846 634 21303 UnstrandedReadsAssigned:10019626 PositiveStrandReadsAssigned:248117 NegativeStrandReadsAssigned:10120634 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR6126819 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6126819-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,528,460 reads, 10,198,712 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52973 SRR6126819.ke.tsv 35125 SRR6126819.se.tsv 88098 total ==> SRR6126819.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 35.4242 6.22689 PNS24247 1044 945 6.84187 1.06522 PNS24249 1928 1829 10.6807 0.859179 PNS24246 1044 945 6.84187 1.06522 PNS24248 1044 945 6.84187 1.06522 PNS24244 1471 1372 48.3695 5.18698 PNS24243 293 194 0 0 KQK14069 1603 1504 2129.54 208.322 KQK14071 474 375 365.292 143.32 ==> SRR6126819.se.tsv <== BRADI_1g14170v3 3074 BRADI_1g53295v3 13 BRADI_1g59795v3 170 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 175 BRADI_1g74790v3 31 BRADI_1g09890v3 0 BRADI_1g77505v3 119 BRADI_1g48960v3 0 SRR6126819 completed mapping pipeline successfully