Starting /dee2/code/volunteer_pipeline.sh SRR6126820 current disk space = 1525994717184 free memory = 1595996160 SRR6126820 SRAfilesize 409d339f2a4e95dc1b558d238bce50b7 SRR6126820.sra SRR6126820.sra file validated SRR6126820 is single end SRR6126820 is conventional basespace SRR6126820 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6126820_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.45125 35.0 35.0 35.0 35.0 35.0 2 34.687 35.0 35.0 35.0 35.0 35.0 3 34.58425 35.0 35.0 35.0 35.0 35.0 4 34.5285 35.0 35.0 35.0 35.0 35.0 5 34.74125 35.0 35.0 35.0 35.0 35.0 6 38.2695 39.0 39.0 40.0 36.0 40.0 7 38.96 40.0 39.0 40.0 38.0 40.0 8 38.76175 40.0 39.0 40.0 38.0 40.0 9 38.923 40.0 39.0 40.0 38.0 40.0 10-11 38.98625 40.0 39.5 40.0 38.0 40.0 12-13 39.115625 40.0 40.0 40.0 38.0 40.0 14-15 39.137 40.0 40.0 40.0 38.0 40.0 16-17 38.990375 40.0 39.5 40.0 38.0 40.0 18-19 39.112125 40.0 40.0 40.0 38.0 40.0 20-21 38.962 40.0 40.0 40.0 38.0 40.0 22-23 39.054375 40.0 40.0 40.0 38.0 40.0 24-25 38.922875 40.0 39.0 40.0 38.0 40.0 26-27 38.993125 40.0 39.5 40.0 38.5 40.0 28-29 38.973 40.0 39.5 40.0 38.0 40.0 30-31 38.98125 40.0 39.0 40.0 38.0 40.0 32-33 39.14175 40.0 39.0 40.0 38.5 40.0 34-35 38.785875 40.0 39.0 40.0 38.0 40.0 36-37 38.949 40.0 39.0 40.0 38.0 40.0 38-39 38.93425 40.0 39.0 40.0 38.0 40.0 40-41 38.893625 40.0 39.0 40.0 38.0 40.0 42-43 38.943375 40.0 39.0 40.0 38.0 40.0 44-45 38.87975 40.0 39.0 40.0 38.0 40.0 46-47 38.988625 40.0 39.0 40.0 38.0 40.0 48-49 38.74025 40.0 39.0 40.0 38.0 40.0 50-51 38.91475 40.0 39.0 40.0 38.0 40.0 52-53 38.790375 40.0 39.0 40.0 38.0 40.0 54-55 38.905625 40.0 39.0 40.0 38.0 40.0 56-57 38.736375 40.0 39.0 40.0 38.0 40.0 58-59 38.678125 40.0 39.0 40.0 38.0 40.0 60-61 38.768249999999995 40.0 39.0 40.0 37.5 40.0 62-63 38.5115 40.0 39.0 40.0 37.5 40.0 64-65 39.0115 40.0 39.0 40.0 38.0 40.0 66-67 39.1905 40.0 39.0 40.0 38.5 40.0 68-69 39.110375000000005 40.0 39.0 40.0 38.0 40.0 70-71 39.149249999999995 40.0 39.0 40.0 38.0 40.0 72-73 38.722875 40.0 39.0 40.0 38.0 40.0 74-75 37.739000000000004 40.0 39.0 40.0 38.0 40.0 76-77 37.728875 40.0 39.0 40.0 37.5 40.0 78-79 37.69 40.0 39.0 40.0 37.0 40.0 80-81 37.66275 40.0 39.0 40.0 37.0 40.0 82-83 37.66075 40.0 39.0 40.0 37.0 40.0 84-85 37.61 40.0 39.0 40.0 37.0 40.0 86-87 37.601124999999996 40.0 39.0 40.0 37.0 40.0 88-89 37.598375000000004 40.0 39.0 40.0 37.0 40.0 90-91 37.60375 40.0 39.0 40.0 37.0 40.0 92-93 37.566500000000005 40.0 39.0 40.0 37.0 40.0 94-95 37.5955 40.0 39.0 40.0 36.5 40.0 96-97 37.551 40.0 39.0 40.0 36.0 40.0 98-99 37.5445 40.0 39.0 40.0 36.0 40.0 100-101 36.18925 39.5 37.0 39.5 32.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 2.0 18 2.0 19 10.0 20 25.0 21 43.0 22 28.0 23 22.0 24 19.0 25 12.0 26 6.0 27 8.0 28 16.0 29 9.0 30 13.0 31 13.0 32 20.0 33 14.0 34 21.0 35 41.0 36 43.0 37 57.0 38 373.0 39 3201.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.899091826437942 14.505549949545912 10.898082744702322 49.697275479313824 2 19.175 13.3 40.975 26.55 3 17.95 15.35 24.25 42.449999999999996 4 29.65 23.3 21.099999999999998 25.95 5 27.125 28.625 24.15 20.1 6 20.65 31.825 26.375 21.15 7 18.025 25.8 36.275 19.900000000000002 8 23.200000000000003 20.4 30.75 25.650000000000002 9 18.8 25.3 30.4 25.5 10-11 24.9375 26.775 22.0125 26.275 12-13 22.3375 24.349999999999998 25.7125 27.6 14-15 21.525 25.587500000000002 25.324999999999996 27.5625 16-17 25.275 23.1875 25.887500000000003 25.650000000000002 18-19 21.85 24.075 25.825 28.249999999999996 20-21 24.4125 26.55 23.225 25.8125 22-23 23.150000000000002 26.700000000000003 23.4875 26.6625 24-25 21.55 24.212500000000002 26.6 27.6375 26-27 22.475 26.437500000000004 25.2125 25.874999999999996 28-29 24.7 24.0125 26.75 24.5375 30-31 23.1625 25.825 22.95 28.0625 32-33 23.9 23.4625 24.0625 28.575 34-35 25.637500000000003 24.837500000000002 24.775 24.75 36-37 22.6 25.474999999999998 26.125 25.8 38-39 22.655663915978995 26.11902975743936 24.493623405851466 26.731682920730183 40-41 23.849999999999998 23.6625 26.125 26.3625 42-43 22.4875 24.3125 25.837500000000002 27.3625 44-45 24.974987493746873 23.724362181090545 26.113056528264135 25.18759379689845 46-47 23.2125 25.900000000000002 26.224999999999998 24.6625 48-49 24.592833876221498 23.365071410674016 24.517664745677774 27.524429967426713 50-51 24.349999999999998 23.962500000000002 23.075000000000003 28.6125 52-53 23.525 23.65 25.275 27.55 54-55 22.980745186296573 23.418354588647162 27.344336084021002 26.25656414103526 56-57 22.968242060515127 24.01850462615654 25.918979744936234 27.094273568392097 58-59 25.018754688672168 23.63090772693173 24.243560890222557 27.106776694173547 60-61 23.775 23.2125 28.375 24.637500000000003 62-63 25.0375 25.112499999999997 24.587500000000002 25.2625 64-65 23.1875 27.212500000000002 23.6375 25.9625 66-67 22.7625 27.775 24.3875 25.074999999999996 68-69 23.754069621838216 27.059854745805158 24.27998998246932 24.906085649887302 70-71 22.4875 28.1625 24.5625 24.7875 72-73 23.5875 27.5875 22.8875 25.937500000000004 74-75 23.3125 26.6 24.2 25.887500000000003 76-77 23.1875 26.525 24.5 25.7875 78-79 23.0 25.55 24.3875 27.0625 80-81 23.45 25.624999999999996 25.3 25.624999999999996 82-83 24.7375 24.9875 24.087500000000002 26.187500000000004 84-85 23.962500000000002 25.275 24.9875 25.775 86-87 23.474999999999998 25.5625 24.4 26.5625 88-89 24.0125 25.525 24.9375 25.525 90-91 24.349999999999998 25.087500000000002 24.3875 26.174999999999997 92-93 24.525 25.4 24.8 25.275 94-95 24.6 26.25 22.8125 26.337500000000002 96-97 24.224999999999998 25.7875 24.65 25.337500000000002 98-99 25.124999999999996 25.662499999999998 24.4375 24.775 100-101 24.837500000000002 26.924999999999997 23.1875 25.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.5 29 1.0 30 1.5 31 3.0 32 5.5 33 12.0 34 18.5 35 21.5 36 27.0 37 50.5 38 81.5 39 99.5 40 116.5 41 136.5 42 157.5 43 174.5 44 177.5 45 177.0 46 185.0 47 194.5 48 175.5 49 167.0 50 178.0 51 155.0 52 139.5 53 138.5 54 132.5 55 121.5 56 116.5 57 125.5 58 130.5 59 118.0 60 108.5 61 102.5 62 95.5 63 86.5 64 62.0 65 45.5 66 38.0 67 32.0 68 29.0 69 21.5 70 15.0 71 11.5 72 5.0 73 3.5 74 2.5 75 1.5 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.025 40-41 0.0 42-43 0.0 44-45 0.05 46-47 0.0 48-49 0.22499999999999998 50-51 0.0 52-53 0.0 54-55 0.025 56-57 0.025 58-59 0.025 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.17500000000000002 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.4126984126984 93.0 2 1.2962962962962963 2.45 3 0.15873015873015872 0.44999999999999996 4 0.07936507936507936 0.3 5 0.0 0.0 6 0.0 0.0 7 0.026455026455026457 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.026455026455026457 3.6249999999999996 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCC 145 3.6249999999999996 TruSeq Adapter, Index 7 (100% over 50bp) CGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.0875 0.0 0.0 0.0 0.0 60-61 0.1375 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.1875 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.2875 0.0 0.0 0.0 0.0 70-71 0.4 0.0 0.0 0.0 0.0 72-73 0.55 0.0 0.0 0.0 0.0 74-75 0.625 0.0 0.0 0.0 0.0 76-77 0.7124999999999999 0.0 0.0 0.0 0.0 78-79 0.8625 0.0 0.0 0.0 0.0 80-81 1.0375 0.0 0.0 0.0 0.0 82-83 1.2374999999999998 0.0 0.0 0.0 0.0 84-85 1.5875 0.0 0.0 0.0 0.0 86-87 1.95 0.0 0.0 0.0 0.0 88-89 2.4749999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAGCA 25 0.004669038 56.985 6 GAGCACA 25 0.004669038 56.985 8 ATCTCGT 15 0.009967554 47.487495 38-39 GTCACCA 15 0.009967554 47.487495 28-29 CATCTCG 15 0.009967554 47.487495 38-39 GAAAAAA 15 0.009967554 47.487495 62-63 CCGTCTT 15 0.009967554 47.487495 48-49 GAAGAGC 30 0.009604648 47.487495 5 CTGAACT 15 0.009967554 47.487495 18-19 TCTCGTA 15 0.009967554 47.487495 40-41 AGAGCAC 30 0.009604648 47.487495 7 GAACTCC 15 0.009967554 47.487495 20-21 TGCTTGA 15 0.009967554 47.487495 56-57 TCTGAAC 15 0.009967554 47.487495 16-17 GATCATC 15 0.009967554 47.487495 34-35 ATCATCT 15 0.009967554 47.487495 36-37 AGCACAC 30 0.009604648 47.487495 9 TGAACTC 15 0.009967554 47.487495 18-19 AGATCAT 15 0.009967554 47.487495 34-35 CGTCTTC 15 0.009967554 47.487495 50-51 >>END_MODULE Read 515269 spots for SRR6126820.sra Written 515269 spots for SRR6126820.sra Read 515269 spots for SRR6126820.sra Written 515269 spots for SRR6126820.sra Read 515269 spots for SRR6126820.sra Written 515269 spots for SRR6126820.sra Read 515269 spots for SRR6126820.sra Written 515269 spots for SRR6126820.sra Read 515269 spots for SRR6126820.sra Written 515269 spots for SRR6126820.sra Read 515269 spots for SRR6126820.sra Written 515269 spots for SRR6126820.sra Read 515269 spots for SRR6126820.sra Written 515269 spots for SRR6126820.sra Read 515269 spots for SRR6126820.sra Written 515269 spots for SRR6126820.sra Read 515269 spots for SRR6126820.sra Written 515269 spots for SRR6126820.sra Read 515269 spots for SRR6126820.sra Written 515269 spots for SRR6126820.sra Read 515269 spots for SRR6126820.sra Written 515269 spots for SRR6126820.sra Read 515269 spots for SRR6126820.sra Written 515269 spots for SRR6126820.sra Read 515269 spots for SRR6126820.sra Written 515269 spots for SRR6126820.sra Read 515269 spots for SRR6126820.sra Written 515269 spots for SRR6126820.sra Read 515269 spots for SRR6126820.sra Written 515269 spots for SRR6126820.sra Read 515269 spots for SRR6126820.sra Written 515269 spots for SRR6126820.sra Read 515269 spots for SRR6126820.sra Written 515269 spots for SRR6126820.sra Read 515269 spots for SRR6126820.sra Written 515269 spots for SRR6126820.sra Read 515269 spots for SRR6126820.sra Written 515269 spots for SRR6126820.sra Read 515277 spots for SRR6126820.sra Written 515277 spots for SRR6126820.sra SRR ids: ['SRR6126820.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ylazlq_n SRR6126820.sra spots: 10305388 blocks: [[1, 515269], [515270, 1030538], [1030539, 1545807], [1545808, 2061076], [2061077, 2576345], [2576346, 3091614], [3091615, 3606883], [3606884, 4122152], [4122153, 4637421], [4637422, 5152690], [5152691, 5667959], [5667960, 6183228], [6183229, 6698497], [6698498, 7213766], [7213767, 7729035], [7729036, 8244304], [8244305, 8759573], [8759574, 9274842], [9274843, 9790111], [9790112, 10305388]] SRR6126820 file size 2822093 SRR6126820 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6126820 SRR6126820_1.fastq Input file: SRR6126820_1.fastq trimmed: SRR6126820-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 05:09:33 2024 >> started Tue Dec 10 05:09:39 2024 >> done (5.647s) 10305388 reads processed; of these: 1106 ( 0.01%) short reads filtered out after trimming by size control 7096 ( 0.07%) empty reads filtered out after trimming by size control 10297186 (99.92%) reads available; of these: 638123 ( 6.20%) trimmed reads available after processing 9659063 (93.80%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 38 0.00% 19 44 0.00% 20 38 0.00% 21 45 0.00% 22 51 0.00% 23 53 0.00% 24 55 0.00% 25 47 0.00% 26 54 0.00% 27 31 0.00% 28 54 0.00% 29 52 0.00% 30 56 0.00% 31 59 0.00% 32 63 0.00% 33 71 0.00% 34 96 0.00% 35 90 0.00% 36 104 0.00% 37 105 0.00% 38 115 0.00% 39 157 0.00% 40 130 0.00% 41 155 0.00% 42 173 0.00% 43 210 0.00% 44 228 0.00% 45 250 0.00% 46 309 0.00% 47 291 0.00% 48 380 0.00% 49 388 0.00% 50 482 0.00% 51 540 0.01% 52 611 0.01% 53 598 0.01% 54 709 0.01% 55 799 0.01% 56 839 0.01% 57 962 0.01% 58 1158 0.01% 59 1259 0.01% 60 1514 0.01% 61 1745 0.02% 62 2071 0.02% 63 2312 0.02% 64 2560 0.02% 65 2969 0.03% 66 3226 0.03% 67 4126 0.04% 68 4361 0.04% 69 5534 0.05% 70 5503 0.05% 71 20711 0.20% 72 275981 2.68% 73 123611 1.20% 74 5224 0.05% 75 426 0.00% 76 263 0.00% 77 264 0.00% 78 259 0.00% 79 308 0.00% 80 376 0.00% 81 492 0.00% 82 483 0.00% 83 498 0.00% 84 601 0.01% 85 549 0.01% 86 581 0.01% 87 643 0.01% 88 743 0.01% 89 851 0.01% 90 1015 0.01% 91 1244 0.01% 92 1288 0.01% 93 1534 0.01% 94 1875 0.02% 95 2372 0.02% 96 3151 0.03% 97 4068 0.04% 98 7372 0.07% 99 12879 0.13% 100 120591 1.17% 101 9659063 93.80% 10297186 reads passed initial QC criterion=sequence-density sequence-density=2.48 sequence-density-rank=1 fanout-score=57.78 fanout-score-rank=1 prefix-density=3.34 prefix-fanout=42.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=2.48 sequence-density-rank=1 fanout-score=57.78 fanout-score-rank=1 prefix-density=3.34 prefix-fanout=42.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG -o SRR6126820 - Input file: STDIN trimmed: SRR6126820-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Tue Dec 10 05:10:06 2024 >> started Tue Dec 10 05:10:11 2024 >> done (4.441s) 3432395 reads processed; of these: 3 ( 0.00%) short reads filtered out after trimming by size control 151999 ( 4.43%) empty reads filtered out after trimming by size control 3280393 (95.57%) reads available; of these: 296590 ( 9.04%) trimmed reads available after processing 2983803 (90.96%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 9 0.00% 20 13 0.00% 21 19 0.00% 22 16 0.00% 23 20 0.00% 24 11 0.00% 25 16 0.00% 26 18 0.00% 27 8 0.00% 28 18 0.00% 29 16 0.00% 30 12 0.00% 31 19 0.00% 32 21 0.00% 33 41 0.00% 34 33 0.00% 35 35 0.00% 36 29 0.00% 37 30 0.00% 38 30 0.00% 39 60 0.00% 40 40 0.00% 41 55 0.00% 42 58 0.00% 43 77 0.00% 44 86 0.00% 45 92 0.00% 46 84 0.00% 47 97 0.00% 48 121 0.00% 49 110 0.00% 50 156 0.00% 51 155 0.00% 52 188 0.01% 53 197 0.01% 54 229 0.01% 55 287 0.01% 56 271 0.01% 57 317 0.01% 58 387 0.01% 59 441 0.01% 60 515 0.02% 61 612 0.02% 62 724 0.02% 63 779 0.02% 64 863 0.03% 65 976 0.03% 66 1066 0.03% 67 1256 0.04% 68 1285 0.04% 69 1575 0.05% 70 1909 0.06% 71 2784 0.08% 72 3085 0.09% 73 3764 0.11% 74 3101 0.09% 75 3002 0.09% 76 3353 0.10% 77 3639 0.11% 78 3888 0.12% 79 4502 0.14% 80 5092 0.16% 81 5636 0.17% 82 6294 0.19% 83 6395 0.19% 84 7025 0.21% 85 7534 0.23% 86 8092 0.25% 87 8678 0.26% 88 9441 0.29% 89 9893 0.30% 90 10683 0.33% 91 11717 0.36% 92 12536 0.38% 93 13357 0.41% 94 14763 0.45% 95 16081 0.49% 96 20141 0.61% 97 29321 0.89% 98 73386 2.24% 99 4010 0.12% 100 36100 1.10% 101 2917604 88.94% criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=3.32 fanout-score-rank=8 prefix-density=0.65 prefix-fanout=3.1 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=13.72 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=2.8 sequence=AACATTTCATGTTCCAAACAGGGCACAACTGCAAACAGCATCATCTTTTTGTAGTGTACAAGCACGTTAACGATCCCATCGTCTTAATCATACATCATCCTGAGAGTATGTCTGTCTATACATATATTACTCTCCTCACAACTCGATCTTCTAACGCTTACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA Started job on | Dec 10 05:10:34 Started mapping on | Dec 10 05:10:34 Finished on | Dec 10 05:10:52 Mapping speed, Million of reads per hour | 2029.04 Number of input reads | 10145184 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 8847166 Uniquely mapped reads % | 87.21% Average mapped length | 99.79 Number of splices: Total | 2794783 Number of splices: Annotated (sjdb) | 2646145 Number of splices: GT/AG | 2753723 Number of splices: GC/AG | 34762 Number of splices: AT/AC | 986 Number of splices: Non-canonical | 5312 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.94 Insertion rate per base | 0.01% Insertion average length | 1.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 535762 % of reads mapped to multiple loci | 5.28% Number of reads mapped to too many loci | 242440 % of reads mapped to too many loci | 2.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.96% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 762256 762256 762256 N_multimapping 535762 535762 535762 N_noFeature 293656 8629537 353169 N_ambiguous 175803 602 18422 UnstrandedReadsAssigned:8377707 PositiveStrandReadsAssigned:217027 NegativeStrandReadsAssigned:8475575 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR6126820 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6126820-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,145,184 reads, 8,562,986 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,077 rounds 52973 SRR6126820.ke.tsv 35125 SRR6126820.se.tsv 88098 total ==> SRR6126820.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 25.0441 5.41261 PNS24247 1044 945 13.3986 2.5648 PNS24249 1928 1829 7.36185 0.728115 PNS24246 1044 945 13.3986 2.5648 PNS24248 1044 945 13.3986 2.5648 PNS24244 1471 1372 34.3983 4.53534 PNS24243 293 194 0 0 KQK14069 1603 1504 1975.93 237.656 KQK14071 474 375 214.043 103.251 ==> SRR6126820.se.tsv <== BRADI_1g14170v3 2806 BRADI_1g53295v3 14 BRADI_1g59795v3 136 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 535 BRADI_1g74790v3 56 BRADI_1g09890v3 2 BRADI_1g77505v3 142 BRADI_1g48960v3 0 SRR6126820 completed mapping pipeline successfully