Starting /dee2/code/volunteer_pipeline.sh SRR6126821 current disk space = 1526050492416 free memory = 1554482856 SRR6126821 SRAfilesize be1985da49a44b2b2cb0c2cb058f1a7e SRR6126821.sra SRR6126821.sra file validated SRR6126821 is single end SRR6126821 is conventional basespace SRR6126821 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6126821_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.5375 35.0 35.0 35.0 35.0 35.0 2 34.70325 35.0 35.0 35.0 35.0 35.0 3 34.51375 35.0 35.0 35.0 35.0 35.0 4 34.4395 35.0 35.0 35.0 35.0 35.0 5 34.71475 35.0 35.0 35.0 35.0 35.0 6 38.4515 39.0 39.0 40.0 37.0 40.0 7 39.0025 40.0 39.0 40.0 38.0 40.0 8 38.83075 40.0 39.0 40.0 38.0 40.0 9 39.097 40.0 39.0 40.0 39.0 40.0 10-11 39.08775 40.0 40.0 40.0 38.5 40.0 12-13 39.113749999999996 40.0 40.0 40.0 38.5 40.0 14-15 39.129999999999995 40.0 40.0 40.0 39.0 40.0 16-17 39.048 40.0 40.0 40.0 38.0 40.0 18-19 39.137625 40.0 40.0 40.0 39.0 40.0 20-21 39.005875 40.0 39.0 40.0 38.0 40.0 22-23 39.097875 40.0 39.0 40.0 38.0 40.0 24-25 39.062125 40.0 39.5 40.0 38.0 40.0 26-27 39.114374999999995 40.0 39.5 40.0 38.5 40.0 28-29 39.014125 40.0 39.5 40.0 38.0 40.0 30-31 39.0295 40.0 39.5 40.0 38.0 40.0 32-33 39.176500000000004 40.0 39.0 40.0 38.0 40.0 34-35 38.8985 40.0 39.5 40.0 38.0 40.0 36-37 39.025875 40.0 39.5 40.0 38.0 40.0 38-39 38.985125 40.0 39.0 40.0 38.0 40.0 40-41 38.936 40.0 39.0 40.0 38.0 40.0 42-43 38.9925 40.0 39.0 40.0 38.0 40.0 44-45 39.007999999999996 40.0 39.0 40.0 38.0 40.0 46-47 38.96362499999999 40.0 39.0 40.0 38.0 40.0 48-49 38.88525 40.0 39.0 40.0 38.0 40.0 50-51 38.949749999999995 40.0 39.0 40.0 38.0 40.0 52-53 38.865875 40.0 39.0 40.0 38.0 40.0 54-55 38.972750000000005 40.0 39.0 40.0 38.0 40.0 56-57 38.826875 40.0 39.0 40.0 38.0 40.0 58-59 38.802625 40.0 39.0 40.0 38.0 40.0 60-61 38.89275 40.0 39.0 40.0 38.0 40.0 62-63 38.737125000000006 40.0 39.0 40.0 38.0 40.0 64-65 39.0995 40.0 39.0 40.0 38.0 40.0 66-67 39.19825 40.0 39.0 40.0 38.0 40.0 68-69 39.095124999999996 40.0 39.0 40.0 38.0 40.0 70-71 39.13175 40.0 39.0 40.0 38.0 40.0 72-73 38.778999999999996 40.0 39.0 40.0 38.0 40.0 74-75 38.011875 40.0 39.0 40.0 38.0 40.0 76-77 37.941625 40.0 39.0 40.0 38.0 40.0 78-79 37.977125 40.0 39.0 40.0 38.0 40.0 80-81 37.931125 40.0 39.0 40.0 38.0 40.0 82-83 37.9545 40.0 39.0 40.0 38.0 40.0 84-85 37.90525 40.0 39.0 40.0 37.5 40.0 86-87 37.85275 40.0 39.0 40.0 37.0 40.0 88-89 37.81175 40.0 39.0 40.0 37.0 40.0 90-91 37.839749999999995 40.0 39.0 40.0 37.0 40.0 92-93 37.848124999999996 40.0 39.0 40.0 37.0 40.0 94-95 37.812 40.0 39.0 40.0 37.0 40.0 96-97 37.773375 40.0 39.0 40.0 37.0 40.0 98-99 37.768875 40.0 39.0 40.0 37.0 40.0 100-101 36.277625 39.5 36.5 39.5 32.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 2.0 18 5.0 19 17.0 20 29.0 21 21.0 22 27.0 23 14.0 24 8.0 25 8.0 26 5.0 27 6.0 28 11.0 29 9.0 30 9.0 31 12.0 32 15.0 33 11.0 34 20.0 35 37.0 36 47.0 37 90.0 38 336.0 39 3254.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.64038171772978 13.485685585133098 9.668508287292818 51.205424409844305 2 20.1 14.499999999999998 41.25 24.15 3 18.825 14.85 24.2 42.125 4 27.769423558897245 23.909774436090224 20.050125313283207 28.270676691729324 5 27.575 27.05 25.0 20.375 6 19.875 31.474999999999998 26.025 22.625 7 18.875 24.6 35.949999999999996 20.575 8 22.55 21.45 31.1 24.9 9 19.7 22.625 33.025 24.65 10-11 24.125 26.6 22.175 27.1 12-13 22.7 23.775 25.7375 27.787499999999998 14-15 21.4375 25.7125 25.2875 27.5625 16-17 25.525 23.775 25.087500000000002 25.6125 18-19 22.537499999999998 24.6 25.4625 27.400000000000002 20-21 24.0625 25.45 25.8625 24.625 22-23 22.7 25.412499999999998 25.112499999999997 26.775 24-25 22.275 23.425 26.825 27.474999999999998 26-27 22.5875 25.525 25.337500000000002 26.55 28-29 25.0 24.7375 25.112499999999997 25.15 30-31 22.412499999999998 25.587500000000002 23.724999999999998 28.275 32-33 22.525000000000002 23.674999999999997 24.575 29.225 34-35 25.525 26.025 23.8125 24.637500000000003 36-37 22.7375 25.650000000000002 24.587500000000002 27.025 38-39 22.45 25.2875 24.675 27.5875 40-41 23.375 23.2875 26.1 27.237499999999997 42-43 22.0125 23.3625 26.3625 28.262500000000003 44-45 24.075 23.25 27.1375 25.5375 46-47 23.25 25.575 25.687500000000004 25.4875 48-49 24.5625 23.9375 24.1125 27.3875 50-51 24.375 24.1375 24.224999999999998 27.2625 52-53 23.1375 24.462500000000002 25.687500000000004 26.7125 54-55 23.549999999999997 23.3125 26.25 26.887499999999996 56-57 22.912499999999998 23.35 25.7 28.037499999999998 58-59 24.45 24.075 23.974999999999998 27.500000000000004 60-61 23.4875 22.900000000000002 27.125 26.487500000000004 62-63 23.974999999999998 25.2125 25.074999999999996 25.7375 64-65 24.0625 26.400000000000002 23.674999999999997 25.8625 66-67 24.4 26.6625 23.7375 25.2 68-69 23.184777165748624 27.053079619429145 24.536805207811717 25.225338007010517 70-71 23.605901475368842 26.881720430107524 23.968492123030757 25.543885971492873 72-73 23.72796599574947 27.00337542192774 24.54056757094637 24.72809101137642 74-75 23.2875 26.674999999999997 24.775 25.2625 76-77 24.45 26.75 23.724999999999998 25.074999999999996 78-79 23.925 25.624999999999996 24.575 25.874999999999996 80-81 23.4125 25.424999999999997 25.3 25.8625 82-83 24.3 26.150000000000002 24.125 25.424999999999997 84-85 23.7875 25.35 24.2 26.6625 86-87 24.5625 25.7 24.8 24.9375 88-89 24.975 25.35 24.1625 25.5125 90-91 24.775 25.0625 24.0375 26.125 92-93 23.8625 25.8 24.7 25.637500000000003 94-95 24.8625 25.6125 24.325 25.2 96-97 24.325 25.575 24.224999999999998 25.874999999999996 98-99 24.825 25.1 24.25 25.825 100-101 25.1875 26.0125 24.2 24.6 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.0 28 3.0 29 3.0 30 2.5 31 3.5 32 7.5 33 12.0 34 18.0 35 25.5 36 38.0 37 56.5 38 74.0 39 92.5 40 111.0 41 129.0 42 152.5 43 148.0 44 160.5 45 178.5 46 170.0 47 179.0 48 176.0 49 178.5 50 180.5 51 160.0 52 143.5 53 146.0 54 141.5 55 121.5 56 133.5 57 138.0 58 121.0 59 118.0 60 117.0 61 105.0 62 90.5 63 80.0 64 59.5 65 53.5 66 50.5 67 36.5 68 25.5 69 21.5 70 16.0 71 8.0 72 4.5 73 2.0 74 1.5 75 2.5 76 2.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.0 3 0.0 4 0.25 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.15 70-71 0.025 72-73 0.0125 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.025 #Duplication Level Percentage of deduplicated Percentage of total 1 98.07945277558538 93.2 2 1.5522230991844252 2.9499999999999997 3 0.26308866087871613 0.75 4 0.026308866087871613 0.1 5 0.052617732175743226 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.026308866087871613 2.75 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCC 110 2.75 TruSeq Adapter, Index 7 (100% over 50bp) ATCGGAAGAGCACACGTCTGAACTCCCGTCACCAGATCATCTCGTATGCC 5 0.125 TruSeq Adapter, Index 7 (98% over 50bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGATCATCTCGTATGCC 5 0.125 TruSeq Adapter, Index 7 (98% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.025 0.0 2 0.0 0.0 0.0 0.025 0.0 3 0.0 0.0 0.0 0.025 0.0 4 0.0 0.0 0.0 0.025 0.0 5 0.0 0.0 0.0 0.025 0.0 6 0.0 0.0 0.0 0.025 0.0 7 0.0 0.0 0.0 0.025 0.0 8 0.0 0.0 0.0 0.025 0.0 9 0.0 0.0 0.0 0.025 0.0 10-11 0.0 0.0 0.0 0.025 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.025 0.0 0.0 0.025 0.0 50-51 0.025 0.0 0.0 0.025 0.0 52-53 0.025 0.0 0.0 0.025 0.0 54-55 0.025 0.0 0.0 0.025 0.0 56-57 0.025 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.05 0.0 0.0 0.025 0.0 62-63 0.075 0.0 0.0 0.025 0.0 64-65 0.1 0.0 0.0 0.025 0.0 66-67 0.1375 0.0 0.0 0.025 0.0 68-69 0.2 0.0 0.0 0.025 0.0 70-71 0.2875 0.0 0.0 0.025 0.0 72-73 0.4375 0.0 0.0 0.025 0.0 74-75 0.5875 0.0 0.0 0.025 0.0 76-77 0.7875 0.0 0.0 0.025 0.0 78-79 1.1124999999999998 0.0 0.0 0.025 0.0 80-81 1.325 0.0 0.0 0.025 0.0 82-83 1.5750000000000002 0.0 0.0 0.025 0.0 84-85 1.8875 0.0 0.0 0.025 0.0 86-87 2.3875 0.0 0.0 0.025 0.0 88-89 2.8125 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCACA 15 6.142176E-4 95.0 8 AGCACAC 15 6.142176E-4 95.0 9 GAAGAGC 20 0.0019257745 71.25 5 GGAAGAG 20 0.0019257745 71.25 4 AAGAGCA 25 0.0046641747 57.0 6 TCGGAAG 25 0.0046641747 57.0 2 CGGAAGA 25 0.0046641747 57.0 3 AGAGCAC 25 0.0046641747 57.0 7 GTATGCC 15 0.009957196 47.5 44-45 GTCACCA 15 0.009957196 47.5 28-29 CACACGT 15 0.009957196 47.5 10-11 ACGTCTG 15 0.009957196 47.5 14-15 CCAGTCA 15 0.009957196 47.5 24-25 CACGTCT 15 0.009957196 47.5 12-13 TATGCCG 15 0.009957196 47.5 44-45 CATCTCG 15 0.009957196 47.5 38-39 CCAGATC 15 0.009957196 47.5 32-33 CTCCAGT 15 0.009957196 47.5 22-23 CCGTCTT 15 0.009957196 47.5 48-49 GTCTGAA 15 0.009957196 47.5 16-17 >>END_MODULE Read 516894 spots for SRR6126821.sra Written 516894 spots for SRR6126821.sra Read 516894 spots for SRR6126821.sra Written 516894 spots for SRR6126821.sra Read 516894 spots for SRR6126821.sra Written 516894 spots for SRR6126821.sra Read 516894 spots for SRR6126821.sra Written 516894 spots for SRR6126821.sra Read 516894 spots for SRR6126821.sra Written 516894 spots for SRR6126821.sra Read 516894 spots for SRR6126821.sra Written 516894 spots for SRR6126821.sra Read 516894 spots for SRR6126821.sra Written 516894 spots for SRR6126821.sra Read 516894 spots for SRR6126821.sra Written 516894 spots for SRR6126821.sra Read 516894 spots for SRR6126821.sra Written 516894 spots for SRR6126821.sra Read 516894 spots for SRR6126821.sra Written 516894 spots for SRR6126821.sra Read 516894 spots for SRR6126821.sra Written 516894 spots for SRR6126821.sra Read 516894 spots for SRR6126821.sra Written 516894 spots for SRR6126821.sra Read 516894 spots for SRR6126821.sra Written 516894 spots for SRR6126821.sra Read 516894 spots for SRR6126821.sra Written 516894 spots for SRR6126821.sra Read 516894 spots for SRR6126821.sra Written 516894 spots for SRR6126821.sra Read 516906 spots for SRR6126821.sra Written 516906 spots for SRR6126821.sra Read 516894 spots for SRR6126821.sra Written 516894 spots for SRR6126821.sra Read 516894 spots for SRR6126821.sra Written 516894 spots for SRR6126821.sra Read 516894 spots for SRR6126821.sra Written 516894 spots for SRR6126821.sra Read 516894 spots for SRR6126821.sra Written 516894 spots for SRR6126821.sra SRR ids: ['SRR6126821.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z0r41zmt SRR6126821.sra spots: 10337892 blocks: [[1, 516894], [516895, 1033788], [1033789, 1550682], [1550683, 2067576], [2067577, 2584470], [2584471, 3101364], [3101365, 3618258], [3618259, 4135152], [4135153, 4652046], [4652047, 5168940], [5168941, 5685834], [5685835, 6202728], [6202729, 6719622], [6719623, 7236516], [7236517, 7753410], [7753411, 8270304], [8270305, 8787198], [8787199, 9304092], [9304093, 9820986], [9820987, 10337892]] SRR6126821 file size 2830995 SRR6126821 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6126821 SRR6126821_1.fastq Input file: SRR6126821_1.fastq trimmed: SRR6126821-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 05:12:28 2024 >> started Tue Dec 10 05:12:34 2024 >> done (6.385s) 10337892 reads processed; of these: 1187 ( 0.01%) short reads filtered out after trimming by size control 7037 ( 0.07%) empty reads filtered out after trimming by size control 10329668 (99.92%) reads available; of these: 554320 ( 5.37%) trimmed reads available after processing 9775348 (94.63%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 35 0.00% 19 42 0.00% 20 33 0.00% 21 35 0.00% 22 48 0.00% 23 47 0.00% 24 38 0.00% 25 40 0.00% 26 49 0.00% 27 39 0.00% 28 59 0.00% 29 56 0.00% 30 57 0.00% 31 58 0.00% 32 84 0.00% 33 70 0.00% 34 71 0.00% 35 79 0.00% 36 90 0.00% 37 89 0.00% 38 120 0.00% 39 148 0.00% 40 135 0.00% 41 177 0.00% 42 187 0.00% 43 200 0.00% 44 224 0.00% 45 226 0.00% 46 298 0.00% 47 320 0.00% 48 417 0.00% 49 426 0.00% 50 511 0.00% 51 583 0.01% 52 591 0.01% 53 640 0.01% 54 739 0.01% 55 805 0.01% 56 881 0.01% 57 981 0.01% 58 1177 0.01% 59 1289 0.01% 60 1483 0.01% 61 1827 0.02% 62 1993 0.02% 63 2335 0.02% 64 2662 0.03% 65 2845 0.03% 66 3361 0.03% 67 4144 0.04% 68 4563 0.04% 69 5078 0.05% 70 3234 0.03% 71 13637 0.13% 72 212093 2.05% 73 109864 1.06% 74 6514 0.06% 75 361 0.00% 76 246 0.00% 77 274 0.00% 78 259 0.00% 79 298 0.00% 80 355 0.00% 81 478 0.00% 82 402 0.00% 83 446 0.00% 84 567 0.01% 85 598 0.01% 86 588 0.01% 87 624 0.01% 88 714 0.01% 89 852 0.01% 90 1005 0.01% 91 1044 0.01% 92 1311 0.01% 93 1464 0.01% 94 1874 0.02% 95 2366 0.02% 96 3156 0.03% 97 4497 0.04% 98 6585 0.06% 99 12779 0.12% 100 123350 1.19% 101 9775348 94.63% 10329668 reads passed initial QC criterion=sequence-density sequence-density=2.50 sequence-density-rank=1 fanout-score=58.04 fanout-score-rank=1 prefix-density=3.37 prefix-fanout=43.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=2.50 sequence-density-rank=1 fanout-score=58.04 fanout-score-rank=1 prefix-density=3.37 prefix-fanout=43.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG -o SRR6126821 - Input file: STDIN trimmed: SRR6126821-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Tue Dec 10 05:13:04 2024 >> started Tue Dec 10 05:13:09 2024 >> done (5.190s) 3443223 reads processed; of these: 4 ( 0.00%) short reads filtered out after trimming by size control 121698 ( 3.53%) empty reads filtered out after trimming by size control 3321521 (96.47%) reads available; of these: 300969 ( 9.06%) trimmed reads available after processing 3020552 (90.94%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 12 0.00% 20 11 0.00% 21 13 0.00% 22 18 0.00% 23 13 0.00% 24 9 0.00% 25 8 0.00% 26 22 0.00% 27 11 0.00% 28 19 0.00% 29 17 0.00% 30 15 0.00% 31 21 0.00% 32 26 0.00% 33 35 0.00% 34 19 0.00% 35 25 0.00% 36 24 0.00% 37 26 0.00% 38 37 0.00% 39 48 0.00% 40 51 0.00% 41 55 0.00% 42 72 0.00% 43 71 0.00% 44 75 0.00% 45 59 0.00% 46 98 0.00% 47 105 0.00% 48 134 0.00% 49 152 0.00% 50 169 0.01% 51 190 0.01% 52 201 0.01% 53 216 0.01% 54 250 0.01% 55 277 0.01% 56 305 0.01% 57 351 0.01% 58 388 0.01% 59 414 0.01% 60 500 0.02% 61 599 0.02% 62 700 0.02% 63 783 0.02% 64 920 0.03% 65 997 0.03% 66 1093 0.03% 67 1272 0.04% 68 1457 0.04% 69 1459 0.04% 70 1807 0.05% 71 2615 0.08% 72 2845 0.09% 73 3502 0.11% 74 3155 0.09% 75 3054 0.09% 76 3331 0.10% 77 3707 0.11% 78 4084 0.12% 79 4564 0.14% 80 5087 0.15% 81 5589 0.17% 82 6407 0.19% 83 6414 0.19% 84 6929 0.21% 85 7769 0.23% 86 8248 0.25% 87 8691 0.26% 88 9622 0.29% 89 10184 0.31% 90 10851 0.33% 91 11859 0.36% 92 12579 0.38% 93 13717 0.41% 94 14979 0.45% 95 16374 0.49% 96 19946 0.60% 97 29986 0.90% 98 74610 2.25% 99 3908 0.12% 100 36705 1.11% 101 2954546 88.95% criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=7 prefix-density=0.65 prefix-fanout=3.1 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=14.42 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.7 sequence=CTGCATTTTCCTTGCAAACATTTCATGTTCCAAACAGGGCACAACTGCAAACAGCATCATCTTTTTGTAGTGTACAAGCACGTTAACGATCCCATCGTCTTAATCATACATCATCCTGAGAGTATGTCTGTCTATACATATATTACTCTCCTCACAACTCGATCTTCTAACGCTTACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA Started job on | Dec 10 05:13:32 Started mapping on | Dec 10 05:13:32 Finished on | Dec 10 05:13:49 Mapping speed, Million of reads per hour | 2161.69 Number of input reads | 10207966 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 8960754 Uniquely mapped reads % | 87.78% Average mapped length | 99.80 Number of splices: Total | 2838161 Number of splices: Annotated (sjdb) | 2686867 Number of splices: GT/AG | 2796220 Number of splices: GC/AG | 35330 Number of splices: AT/AC | 1093 Number of splices: Non-canonical | 5518 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 1.95 Insertion rate per base | 0.01% Insertion average length | 1.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 541194 % of reads mapped to multiple loci | 5.30% Number of reads mapped to too many loci | 252369 % of reads mapped to too many loci | 2.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.33% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 706018 706018 706018 N_multimapping 541194 541194 541194 N_noFeature 296889 8740604 356835 N_ambiguous 178193 614 18668 UnstrandedReadsAssigned:8485672 PositiveStrandReadsAssigned:219536 NegativeStrandReadsAssigned:8585251 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR6126821 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6126821-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,207,966 reads, 8,675,854 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52973 SRR6126821.ke.tsv 35125 SRR6126821.se.tsv 88098 total ==> SRR6126821.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 34.929 7.44739 PNS24247 1044 945 8.75 1.65241 PNS24249 1928 1829 3.75731 0.366611 PNS24246 1044 945 8.75 1.65241 PNS24248 1044 945 8.75 1.65241 PNS24244 1471 1372 46.0637 5.99166 PNS24243 293 194 0 0 KQK14069 1603 1504 1959.68 232.531 KQK14071 474 375 182.47 86.8366 ==> SRR6126821.se.tsv <== BRADI_1g14170v3 2830 BRADI_1g53295v3 12 BRADI_1g59795v3 167 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 524 BRADI_1g74790v3 51 BRADI_1g09890v3 0 BRADI_1g77505v3 124 BRADI_1g48960v3 0 SRR6126821 completed mapping pipeline successfully