Starting /dee2/code/volunteer_pipeline.sh SRR6126822 current disk space = 1526052204544 free memory = 1401105252 SRR6126822 SRAfilesize 9e03efd3630627b1e7cd31739eeaeb48 SRR6126822.sra SRR6126822.sra file validated SRR6126822 is single end SRR6126822 is conventional basespace SRR6126822 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6126822_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.56175 35.0 35.0 35.0 35.0 35.0 2 34.7825 35.0 35.0 35.0 35.0 35.0 3 34.83375 35.0 35.0 35.0 35.0 35.0 4 34.78425 35.0 35.0 35.0 35.0 35.0 5 34.82525 35.0 35.0 35.0 35.0 35.0 6 38.993 39.0 39.0 40.0 38.0 40.0 7 39.3765 40.0 39.0 40.0 39.0 40.0 8 39.5585 40.0 40.0 40.0 39.0 40.0 9 39.6085 40.0 40.0 40.0 39.0 40.0 10-11 39.629875 40.0 40.0 40.0 39.0 40.0 12-13 39.662375 40.0 40.0 40.0 39.0 40.0 14-15 39.639375 40.0 40.0 40.0 39.0 40.0 16-17 39.642125 40.0 40.0 40.0 39.0 40.0 18-19 39.636125 40.0 40.0 40.0 39.0 40.0 20-21 39.59875 40.0 40.0 40.0 39.0 40.0 22-23 39.59075 40.0 40.0 40.0 39.0 40.0 24-25 39.606375 40.0 40.0 40.0 39.0 40.0 26-27 39.593875 40.0 40.0 40.0 39.0 40.0 28-29 39.5965 40.0 40.0 40.0 39.0 40.0 30-31 39.597625 40.0 40.0 40.0 39.0 40.0 32-33 39.587625 40.0 40.0 40.0 39.0 40.0 34-35 39.557125 40.0 40.0 40.0 39.0 40.0 36-37 39.54625 40.0 40.0 40.0 39.0 40.0 38-39 39.547875 40.0 40.0 40.0 39.0 40.0 40-41 39.534499999999994 40.0 40.0 40.0 39.0 40.0 42-43 39.549125 40.0 40.0 40.0 39.0 40.0 44-45 39.538 40.0 40.0 40.0 39.0 40.0 46-47 39.54025 40.0 40.0 40.0 39.0 40.0 48-49 39.41475 40.0 40.0 40.0 39.0 40.0 50-51 39.47075 40.0 40.0 40.0 39.0 40.0 52-53 39.528000000000006 40.0 40.0 40.0 39.0 40.0 54-55 39.494375 40.0 40.0 40.0 39.0 40.0 56-57 39.483125 40.0 40.0 40.0 39.0 40.0 58-59 39.4285 40.0 39.5 40.0 39.0 40.0 60-61 39.4395 40.0 39.5 40.0 39.0 40.0 62-63 39.449875 40.0 39.5 40.0 39.0 40.0 64-65 39.46825 40.0 39.5 40.0 39.0 40.0 66-67 39.476625 40.0 40.0 40.0 39.0 40.0 68-69 39.313125 40.0 39.0 40.0 39.0 40.0 70-71 39.3845 40.0 39.0 40.0 39.0 40.0 72-73 39.439375 40.0 39.0 40.0 39.0 40.0 74-75 39.378875 40.0 39.0 40.0 39.0 40.0 76-77 39.374624999999995 40.0 39.0 40.0 39.0 40.0 78-79 39.35525 40.0 39.0 40.0 39.0 40.0 80-81 39.35825 40.0 39.0 40.0 39.0 40.0 82-83 39.4005 40.0 39.0 40.0 39.0 40.0 84-85 39.372625 40.0 39.0 40.0 39.0 40.0 86-87 39.361625000000004 40.0 39.0 40.0 39.0 40.0 88-89 39.350125 40.0 39.0 40.0 39.0 40.0 90-91 39.3665 40.0 39.0 40.0 39.0 40.0 92-93 39.3305 40.0 39.0 40.0 39.0 40.0 94-95 39.321625 40.0 39.0 40.0 38.5 40.0 96-97 39.26775 40.0 39.0 40.0 38.0 40.0 98-99 39.256375 40.0 39.0 40.0 38.0 40.0 100-101 37.913250000000005 39.5 37.5 40.0 34.5 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 1.0 26 2.0 27 1.0 28 3.0 29 6.0 30 9.0 31 6.0 32 4.0 33 10.0 34 16.0 35 22.0 36 22.0 37 61.0 38 382.0 39 3453.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.240544629349472 8.69894099848714 9.833585476550681 50.22692889561271 2 21.9 12.125 36.25 29.725 3 21.6 15.024999999999999 24.325 39.050000000000004 4 27.525 20.849999999999998 19.45 32.175 5 28.1 26.55 21.9 23.45 6 23.3 30.875000000000004 22.425 23.400000000000002 7 19.025 22.15 37.75 21.075 8 21.425 21.25 29.549999999999997 27.775 9 20.325 20.0 33.074999999999996 26.6 10-11 24.1125 27.85 22.975 25.0625 12-13 24.212500000000002 21.825 25.674999999999997 28.287499999999998 14-15 22.4625 23.8875 26.974999999999998 26.674999999999997 16-17 23.5875 24.325 25.1 26.987499999999997 18-19 23.7875 23.5375 25.775 26.900000000000002 20-21 23.2625 24.3625 25.637500000000003 26.737499999999997 22-23 23.674999999999997 24.4875 24.4375 27.400000000000002 24-25 25.074999999999996 23.625 24.4375 26.8625 26-27 24.15 23.962500000000002 25.687500000000004 26.200000000000003 28-29 24.325 23.8875 25.3 26.487500000000004 30-31 23.0625 24.5 25.7875 26.650000000000002 32-33 23.8375 23.474999999999998 25.674999999999997 27.0125 34-35 23.400000000000002 23.6375 26.075 26.887499999999996 36-37 24.15 23.95 24.925 26.974999999999998 38-39 23.87798474809351 24.315539442430303 25.315664458057256 26.490811351418923 40-41 24.962500000000002 23.125 25.1 26.8125 42-43 24.425 23.825 24.625 27.125 44-45 23.66183091545773 23.62431215607804 25.400200100050025 27.313656828414207 46-47 24.3875 24.224999999999998 25.1875 26.200000000000003 48-49 25.087719298245613 23.847117794486216 24.82456140350877 26.240601503759397 50-51 23.150000000000002 24.8125 24.6625 27.375 52-53 24.099999999999998 23.7625 24.975 27.1625 54-55 23.733900212579716 24.284106539952482 24.959359759909965 27.022633487557833 56-57 23.93397524071527 23.608853319995 26.35988495685882 26.09728648243091 58-59 24.434162811054144 24.309115918469427 25.24696761285482 26.00975365762161 60-61 24.775 23.95 25.4625 25.8125 62-63 24.4875 23.7625 25.874999999999996 25.874999999999996 64-65 24.474999999999998 23.95 24.25 27.325 66-67 24.7 23.5375 24.6 27.1625 68-69 24.693059383613132 23.778501628664493 24.9185667752443 26.609872212478074 70-71 24.5625 24.224999999999998 24.125 27.0875 72-73 24.325 23.962500000000002 24.4125 27.3 74-75 23.6125 24.0125 25.0125 27.3625 76-77 25.362499999999997 24.925 23.1375 26.575 78-79 24.8625 24.3125 24.05 26.775 80-81 24.837500000000002 24.6875 24.325 26.150000000000002 82-83 24.3875 24.55 24.099999999999998 26.9625 84-85 24.85 25.124999999999996 23.525 26.5 86-87 24.7875 24.474999999999998 24.65 26.087500000000002 88-89 24.887500000000003 25.412499999999998 23.175 26.525 90-91 25.162499999999998 24.474999999999998 24.15 26.2125 92-93 24.5 25.15 24.1125 26.237500000000004 94-95 25.424999999999997 25.0375 23.25 26.2875 96-97 25.324999999999996 24.3125 23.6125 26.75 98-99 24.474999999999998 25.5375 23.0125 26.974999999999998 100-101 25.05 25.162499999999998 23.6125 26.174999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.5 30 3.5 31 3.0 32 2.0 33 8.0 34 10.5 35 14.0 36 31.0 37 38.0 38 41.5 39 60.5 40 81.5 41 99.5 42 122.5 43 147.5 44 169.0 45 177.5 46 173.5 47 180.0 48 183.0 49 175.0 50 169.5 51 173.5 52 167.5 53 158.5 54 141.5 55 141.5 56 159.5 57 145.0 58 121.0 59 112.0 60 102.5 61 101.5 62 106.5 63 84.5 64 73.0 65 68.5 66 52.5 67 49.0 68 47.5 69 36.5 70 27.0 71 19.0 72 9.5 73 5.0 74 3.0 75 1.5 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0125 40-41 0.0 42-43 0.0 44-45 0.05 46-47 0.0 48-49 0.25 50-51 0.0 52-53 0.0 54-55 0.0375 56-57 0.0375 58-59 0.0375 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.22499999999999998 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.875 #Duplication Level Percentage of deduplicated Percentage of total 1 98.08429118773945 96.0 2 1.711366538952746 3.35 3 0.17879948914431673 0.525 4 0.0 0.0 5 0.02554278416347382 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.025 9 0.0 0.0 0.0 0.0 0.025 10-11 0.0 0.0 0.0 0.0 0.025 12-13 0.0 0.0 0.0 0.0 0.025 14-15 0.0 0.0 0.0 0.0 0.025 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.025 0.0 0.0 0.0 0.025 40-41 0.025 0.0 0.0 0.0 0.025 42-43 0.025 0.0 0.0 0.0 0.025 44-45 0.025 0.0 0.0 0.0 0.025 46-47 0.025 0.0 0.0 0.0 0.025 48-49 0.037500000000000006 0.0 0.0 0.0 0.025 50-51 0.1125 0.0 0.0 0.0 0.025 52-53 0.125 0.0 0.0 0.0 0.025 54-55 0.175 0.0 0.0 0.0 0.025 56-57 0.25 0.0 0.0 0.0 0.025 58-59 0.2875 0.0 0.0 0.0 0.025 60-61 0.5 0.0 0.0 0.0 0.025 62-63 0.6875 0.0 0.0 0.0 0.025 64-65 0.8625 0.0 0.0 0.0 0.025 66-67 1.0875 0.0 0.0 0.0 0.025 68-69 1.4125 0.0 0.0 0.0 0.025 70-71 1.7 0.0 0.0 0.0 0.025 72-73 2.0625 0.0 0.0 0.0 0.025 74-75 2.4 0.0 0.0 0.0 0.025 76-77 2.9375 0.0 0.0 0.0 0.025 78-79 3.5 0.0 0.0 0.0 0.025 80-81 4.075 0.0 0.0 0.0 0.025 82-83 4.775 0.0 0.0 0.0 0.025 84-85 5.8125 0.0 0.0 0.0 0.025 86-87 6.6875 0.0 0.0 0.0 0.025 88-89 7.6125 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 517117 spots for SRR6126822.sra Written 517117 spots for SRR6126822.sra Read 517117 spots for SRR6126822.sra Written 517117 spots for SRR6126822.sra Read 517117 spots for SRR6126822.sra Written 517117 spots for SRR6126822.sra Read 517117 spots for SRR6126822.sra Written 517117 spots for SRR6126822.sra Read 517117 spots for SRR6126822.sra Written 517117 spots for SRR6126822.sra Read 517117 spots for SRR6126822.sra Written 517117 spots for SRR6126822.sra Read 517117 spots for SRR6126822.sra Written 517117 spots for SRR6126822.sra Read 517117 spots for SRR6126822.sra Written 517117 spots for SRR6126822.sra Read 517117 spots for SRR6126822.sra Written 517117 spots for SRR6126822.sra Read 517117 spots for SRR6126822.sra Written 517117 spots for SRR6126822.sra Read 517117 spots for SRR6126822.sra Written 517117 spots for SRR6126822.sra Read 517117 spots for SRR6126822.sra Written 517117 spots for SRR6126822.sra Read 517118 spots for SRR6126822.sra Written 517118 spots for SRR6126822.sra Read 517117 spots for SRR6126822.sra Written 517117 spots for SRR6126822.sra Read 517117 spots for SRR6126822.sra Written 517117 spots for SRR6126822.sra Read 517117 spots for SRR6126822.sra Written 517117 spots for SRR6126822.sra Read 517117 spots for SRR6126822.sra Written 517117 spots for SRR6126822.sra Read 517117 spots for SRR6126822.sra Written 517117 spots for SRR6126822.sra Read 517117 spots for SRR6126822.sra Written 517117 spots for SRR6126822.sra Read 517117 spots for SRR6126822.sra Written 517117 spots for SRR6126822.sra SRR ids: ['SRR6126822.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p6ujmo7v SRR6126822.sra spots: 10342341 blocks: [[1, 517117], [517118, 1034234], [1034235, 1551351], [1551352, 2068468], [2068469, 2585585], [2585586, 3102702], [3102703, 3619819], [3619820, 4136936], [4136937, 4654053], [4654054, 5171170], [5171171, 5688287], [5688288, 6205404], [6205405, 6722521], [6722522, 7239638], [7239639, 7756755], [7756756, 8273872], [8273873, 8790989], [8790990, 9308106], [9308107, 9825223], [9825224, 10342341]] SRR6126822 file size 2832271 SRR6126822 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6126822 SRR6126822_1.fastq Input file: SRR6126822_1.fastq trimmed: SRR6126822-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 05:12:29 2024 >> started Tue Dec 10 05:12:36 2024 >> done (6.601s) 10342341 reads processed; of these: 602 ( 0.01%) short reads filtered out after trimming by size control 6674 ( 0.06%) empty reads filtered out after trimming by size control 10335065 (99.93%) reads available; of these: 370310 ( 3.58%) trimmed reads available after processing 9964755 (96.42%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 32 0.00% 20 23 0.00% 21 17 0.00% 22 33 0.00% 23 27 0.00% 24 34 0.00% 25 40 0.00% 26 35 0.00% 27 38 0.00% 28 35 0.00% 29 44 0.00% 30 51 0.00% 31 81 0.00% 32 89 0.00% 33 100 0.00% 34 138 0.00% 35 113 0.00% 36 171 0.00% 37 207 0.00% 38 252 0.00% 39 334 0.00% 40 396 0.00% 41 533 0.01% 42 603 0.01% 43 757 0.01% 44 820 0.01% 45 1001 0.01% 46 1057 0.01% 47 1384 0.01% 48 1630 0.02% 49 2066 0.02% 50 2429 0.02% 51 2987 0.03% 52 3471 0.03% 53 4037 0.04% 54 4561 0.04% 55 5068 0.05% 56 5548 0.05% 57 6252 0.06% 58 7102 0.07% 59 8191 0.08% 60 9374 0.09% 61 11064 0.11% 62 12154 0.12% 63 13767 0.13% 64 15076 0.15% 65 15667 0.15% 66 16330 0.16% 67 17310 0.17% 68 18200 0.18% 69 18663 0.18% 70 129 0.00% 71 176 0.00% 72 568 0.01% 73 441 0.00% 74 133 0.00% 75 135 0.00% 76 129 0.00% 77 162 0.00% 78 167 0.00% 79 181 0.00% 80 217 0.00% 81 367 0.00% 82 233 0.00% 83 253 0.00% 84 303 0.00% 85 352 0.00% 86 319 0.00% 87 434 0.00% 88 482 0.00% 89 503 0.00% 90 725 0.01% 91 948 0.01% 92 878 0.01% 93 1057 0.01% 94 1318 0.01% 95 1703 0.02% 96 2294 0.02% 97 3193 0.03% 98 6185 0.06% 99 11321 0.11% 100 125591 1.22% 101 9964755 96.42% 10335065 reads passed initial QC criterion=sequence-density sequence-density=5.96 sequence-density-rank=1 fanout-score=53.45 fanout-score-rank=1 prefix-density=7.23 prefix-fanout=44.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=5.96 sequence-density-rank=1 fanout-score=53.45 fanout-score-rank=1 prefix-density=7.23 prefix-fanout=44.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG -o SRR6126822 - Input file: STDIN trimmed: SRR6126822-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Tue Dec 10 05:13:08 2024 >> started Tue Dec 10 05:13:18 2024 >> done (10.026s) 6890043 reads processed; of these: 2 ( 0.00%) short reads filtered out after trimming by size control 639 ( 0.01%) empty reads filtered out after trimming by size control 6889402 (99.99%) reads available; of these: 884774 (12.84%) trimmed reads available after processing 6004628 (87.16%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 24 0.00% 20 19 0.00% 21 16 0.00% 22 19 0.00% 23 17 0.00% 24 24 0.00% 25 30 0.00% 26 21 0.00% 27 27 0.00% 28 27 0.00% 29 26 0.00% 30 31 0.00% 31 50 0.00% 32 67 0.00% 33 70 0.00% 34 95 0.00% 35 86 0.00% 36 120 0.00% 37 147 0.00% 38 181 0.00% 39 218 0.00% 40 267 0.00% 41 365 0.01% 42 417 0.01% 43 511 0.01% 44 555 0.01% 45 665 0.01% 46 712 0.01% 47 899 0.01% 48 1101 0.02% 49 1346 0.02% 50 1640 0.02% 51 2005 0.03% 52 2348 0.03% 53 2747 0.04% 54 3080 0.04% 55 3359 0.05% 56 3741 0.05% 57 4152 0.06% 58 4803 0.07% 59 5484 0.08% 60 6327 0.09% 61 7423 0.11% 62 8122 0.12% 63 9106 0.13% 64 10098 0.15% 65 10415 0.15% 66 10994 0.16% 67 11411 0.17% 68 12061 0.18% 69 12403 0.18% 70 14122 0.20% 71 14988 0.22% 72 16360 0.24% 73 17675 0.26% 74 18509 0.27% 75 19335 0.28% 76 19646 0.29% 77 20345 0.30% 78 20384 0.30% 79 21579 0.31% 80 22292 0.32% 81 23207 0.34% 82 24443 0.35% 83 25712 0.37% 84 26997 0.39% 85 27878 0.40% 86 28670 0.42% 87 28697 0.42% 88 29515 0.43% 89 29517 0.43% 90 29891 0.43% 91 31405 0.46% 92 32192 0.47% 93 33449 0.49% 94 35355 0.51% 95 37382 0.54% 96 44537 0.65% 97 62535 0.91% 98 139954 2.03% 99 6723 0.10% 100 72777 1.06% 101 5773448 83.80% criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=16 prefix-density=0.56 prefix-fanout=2.1 sequence=AGTACAGGAATATT criterion=fanout-score sequence-density=0.10 sequence-density-rank=26 fanout-score=6.77 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=2.7 sequence=TACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA Started job on | Dec 10 05:13:46 Started mapping on | Dec 10 05:13:46 Finished on | Dec 10 05:14:07 Mapping speed, Million of reads per hour | 1771.62 Number of input reads | 10334424 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 8734097 Uniquely mapped reads % | 84.51% Average mapped length | 98.38 Number of splices: Total | 2757345 Number of splices: Annotated (sjdb) | 2611173 Number of splices: GT/AG | 2717895 Number of splices: GC/AG | 33388 Number of splices: AT/AC | 925 Number of splices: Non-canonical | 5137 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.84 Insertion rate per base | 0.01% Insertion average length | 1.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 958809 % of reads mapped to multiple loci | 9.28% Number of reads mapped to too many loci | 354753 % of reads mapped to too many loci | 3.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.55% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 641518 641518 641518 N_multimapping 958809 958809 958809 N_noFeature 319054 8508368 380196 N_ambiguous 182902 559 18601 UnstrandedReadsAssigned:8232141 PositiveStrandReadsAssigned:225170 NegativeStrandReadsAssigned:8335300 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR6126822 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6126822-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,334,424 reads, 8,479,066 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52973 SRR6126822.ke.tsv 35125 SRR6126822.se.tsv 88098 total ==> SRR6126822.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 58.6043 12.7985 PNS24247 1044 945 16.6144 3.21372 PNS24249 1928 1829 16.0088 1.59992 PNS24246 1044 945 16.6144 3.21372 PNS24248 1044 945 16.6144 3.21372 PNS24244 1471 1372 19.5437 2.60381 PNS24243 293 194 0 0 KQK14069 1603 1504 10793.3 1311.78 KQK14071 474 375 778.779 379.611 ==> SRR6126822.se.tsv <== BRADI_1g14170v3 12933 BRADI_1g53295v3 12 BRADI_1g59795v3 208 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 95 BRADI_1g74790v3 32 BRADI_1g09890v3 0 BRADI_1g77505v3 112 BRADI_1g48960v3 0 SRR6126822 completed mapping pipeline successfully