Starting /dee2/code/volunteer_pipeline.sh SRR6126823 current disk space = 1526050332672 free memory = 1595982868 SRR6126823 SRAfilesize 5fea4bc90ceba00c6a33ef0db80f9e59 SRR6126823.sra SRR6126823.sra file validated SRR6126823 is single end SRR6126823 is conventional basespace SRR6126823 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6126823_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.6465 35.0 35.0 35.0 35.0 35.0 2 34.784 35.0 35.0 35.0 35.0 35.0 3 34.79725 35.0 35.0 35.0 35.0 35.0 4 34.7715 35.0 35.0 35.0 35.0 35.0 5 34.818 35.0 35.0 35.0 35.0 35.0 6 39.08875 40.0 39.0 40.0 38.0 40.0 7 39.41 40.0 39.0 40.0 39.0 40.0 8 39.522 40.0 39.0 40.0 39.0 40.0 9 39.60575 40.0 40.0 40.0 39.0 40.0 10-11 39.611125 40.0 40.0 40.0 39.0 40.0 12-13 39.657 40.0 40.0 40.0 39.0 40.0 14-15 39.623125 40.0 40.0 40.0 39.0 40.0 16-17 39.62875 40.0 40.0 40.0 39.0 40.0 18-19 39.61525 40.0 40.0 40.0 39.0 40.0 20-21 39.609125000000006 40.0 40.0 40.0 39.0 40.0 22-23 39.61925 40.0 40.0 40.0 39.0 40.0 24-25 39.611000000000004 40.0 40.0 40.0 39.0 40.0 26-27 39.62575 40.0 40.0 40.0 39.0 40.0 28-29 39.613 40.0 40.0 40.0 39.0 40.0 30-31 39.619875 40.0 40.0 40.0 39.0 40.0 32-33 39.579625 40.0 40.0 40.0 39.0 40.0 34-35 39.607749999999996 40.0 40.0 40.0 39.0 40.0 36-37 39.595375000000004 40.0 40.0 40.0 39.0 40.0 38-39 39.597875 40.0 40.0 40.0 39.0 40.0 40-41 39.581 40.0 40.0 40.0 39.0 40.0 42-43 39.557625 40.0 40.0 40.0 39.0 40.0 44-45 39.554375 40.0 40.0 40.0 39.0 40.0 46-47 39.56325 40.0 40.0 40.0 39.0 40.0 48-49 39.57825 40.0 40.0 40.0 39.0 40.0 50-51 39.558375 40.0 40.0 40.0 39.0 40.0 52-53 39.529375 40.0 40.0 40.0 39.0 40.0 54-55 39.510875 40.0 40.0 40.0 39.0 40.0 56-57 39.51925 40.0 40.0 40.0 39.0 40.0 58-59 39.528875 40.0 40.0 40.0 39.0 40.0 60-61 39.469625 40.0 39.5 40.0 39.0 40.0 62-63 39.525375 40.0 40.0 40.0 39.0 40.0 64-65 39.485 40.0 40.0 40.0 39.0 40.0 66-67 39.463750000000005 40.0 39.5 40.0 39.0 40.0 68-69 39.294624999999996 40.0 39.0 40.0 39.0 40.0 70-71 39.3945 40.0 39.0 40.0 39.0 40.0 72-73 39.405625 40.0 39.0 40.0 39.0 40.0 74-75 39.39375 40.0 39.0 40.0 39.0 40.0 76-77 39.436 40.0 39.0 40.0 39.0 40.0 78-79 39.3975 40.0 39.0 40.0 39.0 40.0 80-81 39.365624999999994 40.0 39.0 40.0 39.0 40.0 82-83 39.372625 40.0 39.0 40.0 39.0 40.0 84-85 39.31725 40.0 39.0 40.0 38.5 40.0 86-87 39.338375 40.0 39.0 40.0 39.0 40.0 88-89 39.329375 40.0 39.0 40.0 38.5 40.0 90-91 39.31925 40.0 39.0 40.0 38.5 40.0 92-93 39.26475000000001 40.0 39.0 40.0 38.5 40.0 94-95 39.312125 40.0 39.0 40.0 39.0 40.0 96-97 39.245625000000004 40.0 39.0 40.0 38.0 40.0 98-99 39.18775 40.0 39.0 40.0 38.0 40.0 100-101 37.863125 39.5 37.5 40.0 34.5 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 0.0 25 0.0 26 2.0 27 1.0 28 3.0 29 1.0 30 2.0 31 4.0 32 9.0 33 10.0 34 16.0 35 22.0 36 30.0 37 88.0 38 381.0 39 3429.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.91775325977934 8.926780341023068 9.027081243731194 51.1283851554664 2 21.95 11.625 37.4 29.025000000000002 3 21.125 13.4 24.3 41.175 4 26.92885771543086 21.417835671342687 20.36573146292585 31.2875751503006 5 30.025000000000002 25.8 20.599999999999998 23.575 6 24.725 29.625 22.025 23.625 7 20.575 23.0 36.85 19.575 8 21.525 21.224999999999998 31.15 26.1 9 21.224999999999998 19.25 33.475 26.05 10-11 24.25 28.299999999999997 22.75 24.7 12-13 23.7 22.3375 26.3125 27.650000000000002 14-15 22.675 24.2375 26.237500000000004 26.85 16-17 24.1625 24.075 25.0125 26.75 18-19 23.8375 24.587500000000002 24.712500000000002 26.8625 20-21 23.3375 23.3625 26.337500000000002 26.9625 22-23 23.8625 23.9375 25.525 26.674999999999997 24-25 23.6625 23.7625 24.8 27.775 26-27 23.3625 24.212500000000002 25.85 26.575 28-29 24.65 23.825 24.7875 26.737499999999997 30-31 23.9 23.9875 25.112499999999997 27.0 32-33 23.65 23.724999999999998 25.624999999999996 27.0 34-35 23.2125 23.8625 25.525 27.400000000000002 36-37 23.5875 24.762500000000003 24.825 26.825 38-39 24.2 24.587500000000002 24.224999999999998 26.987499999999997 40-41 24.2625 24.2 25.650000000000002 25.887500000000003 42-43 24.5375 23.6625 24.65 27.150000000000002 44-45 24.175 24.0 25.05 26.775 46-47 24.275 24.1125 24.9125 26.700000000000003 48-49 23.9875 24.275 24.6125 27.125 50-51 24.224999999999998 24.375 23.9125 27.487499999999997 52-53 24.349999999999998 23.9875 24.825 26.8375 54-55 24.4375 24.224999999999998 24.675 26.6625 56-57 23.45 23.724999999999998 25.95 26.875 58-59 24.325 24.15 24.575 26.950000000000003 60-61 24.025 23.65 25.2875 27.037499999999998 62-63 24.762500000000003 23.4375 24.637500000000003 27.1625 64-65 24.087500000000002 24.1125 24.349999999999998 27.450000000000003 66-67 24.575 24.4125 24.3875 26.625 68-69 24.17899222862873 23.82802707445475 25.357232389069946 26.63574830784658 70-71 24.643660915228807 24.131032758189548 24.981245311327832 26.244061015253813 72-73 24.2375 24.2875 24.837500000000002 26.637499999999996 74-75 25.887500000000003 24.6125 24.2625 25.2375 76-77 24.0 24.075 25.1 26.825 78-79 23.474999999999998 23.9 25.025 27.6 80-81 24.224999999999998 24.224999999999998 24.7875 26.7625 82-83 25.412499999999998 25.174999999999997 23.3125 26.1 84-85 24.337500000000002 24.5375 24.025 27.1 86-87 24.1125 24.349999999999998 24.7875 26.75 88-89 24.637500000000003 24.1375 24.474999999999998 26.75 90-91 24.8125 25.374999999999996 23.5625 26.25 92-93 24.9875 26.0625 23.375 25.575 94-95 24.525 24.1625 24.375 26.937499999999996 96-97 23.549999999999997 24.3875 24.4 27.6625 98-99 24.712500000000002 24.4125 23.825 27.05 100-101 25.0125 24.375 24.087500000000002 26.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 0.5 28 1.0 29 1.5 30 4.5 31 5.5 32 2.5 33 4.0 34 7.5 35 10.0 36 20.0 37 35.5 38 39.0 39 53.5 40 91.5 41 114.0 42 126.5 43 143.0 44 174.5 45 183.0 46 171.0 47 181.0 48 182.0 49 188.5 50 189.0 51 167.0 52 156.0 53 148.5 54 141.0 55 139.0 56 145.5 57 147.0 58 124.5 59 111.0 60 113.0 61 105.5 62 94.5 63 81.0 64 74.5 65 69.5 66 64.5 67 58.0 68 39.5 69 27.0 70 23.0 71 16.5 72 9.5 73 7.0 74 3.0 75 2.0 76 2.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.2 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.27499999999999997 70-71 0.025 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.16044966785897 96.05 2 1.5585079202861523 3.05 3 0.22994379151762903 0.675 4 0.02554931016862545 0.1 5 0.02554931016862545 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.2 0.0 0.0 0.0 0.0 56-57 0.275 0.0 0.0 0.0 0.0 58-59 0.45 0.0 0.0 0.0 0.0 60-61 0.6625 0.0 0.0 0.0 0.0 62-63 0.8375 0.0 0.0 0.0 0.0 64-65 1.125 0.0 0.0 0.0 0.0 66-67 1.375 0.0 0.0 0.0 0.0 68-69 1.725 0.0 0.0 0.0 0.0 70-71 2.1625 0.0 0.0 0.0 0.0 72-73 2.6125 0.0 0.0 0.0 0.0 74-75 3.2750000000000004 0.0 0.0 0.0 0.0 76-77 3.7375 0.0 0.0 0.0 0.0 78-79 4.1 0.0 0.0 0.0 0.0 80-81 4.7 0.0 0.0 0.0 0.0 82-83 5.4125 0.0 0.0 0.0 0.0 84-85 6.3375 0.0 0.0 0.0 0.0 86-87 7.1 0.0 0.0 0.0 0.0 88-89 7.574999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTCGG 15 6.1550457E-4 94.95 6 >>END_MODULE Read 525293 spots for SRR6126823.sra Written 525293 spots for SRR6126823.sra Read 525293 spots for SRR6126823.sra Written 525293 spots for SRR6126823.sra Read 525293 spots for SRR6126823.sra Written 525293 spots for SRR6126823.sra Read 525293 spots for SRR6126823.sra Written 525293 spots for SRR6126823.sra Read 525293 spots for SRR6126823.sra Written 525293 spots for SRR6126823.sra Read 525293 spots for SRR6126823.sra Written 525293 spots for SRR6126823.sra Read 525293 spots for SRR6126823.sra Written 525293 spots for SRR6126823.sra Read 525293 spots for SRR6126823.sra Written 525293 spots for SRR6126823.sra Read 525293 spots for SRR6126823.sra Written 525293 spots for SRR6126823.sra Read 525293 spots for SRR6126823.sra Written 525293 spots for SRR6126823.sra Read 525293 spots for SRR6126823.sra Written 525293 spots for SRR6126823.sra Read 525293 spots for SRR6126823.sra Written 525293 spots for SRR6126823.sra Read 525296 spots for SRR6126823.sra Written 525296 spots for SRR6126823.sra Read 525293 spots for SRR6126823.sra Written 525293 spots for SRR6126823.sra Read 525293 spots for SRR6126823.sra Written 525293 spots for SRR6126823.sra Read 525293 spots for SRR6126823.sra Written 525293 spots for SRR6126823.sra Read 525293 spots for SRR6126823.sra Written 525293 spots for SRR6126823.sra Read 525293 spots for SRR6126823.sra Written 525293 spots for SRR6126823.sra Read 525293 spots for SRR6126823.sra Written 525293 spots for SRR6126823.sra Read 525293 spots for SRR6126823.sra Written 525293 spots for SRR6126823.sra SRR ids: ['SRR6126823.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8z2gx75y SRR6126823.sra spots: 10505863 blocks: [[1, 525293], [525294, 1050586], [1050587, 1575879], [1575880, 2101172], [2101173, 2626465], [2626466, 3151758], [3151759, 3677051], [3677052, 4202344], [4202345, 4727637], [4727638, 5252930], [5252931, 5778223], [5778224, 6303516], [6303517, 6828809], [6828810, 7354102], [7354103, 7879395], [7879396, 8404688], [8404689, 8929981], [8929982, 9455274], [9455275, 9980567], [9980568, 10505863]] SRR6126823 file size 2877180 SRR6126823 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6126823 SRR6126823_1.fastq Input file: SRR6126823_1.fastq trimmed: SRR6126823-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 05:12:46 2024 >> started Tue Dec 10 05:12:53 2024 >> done (6.391s) 10505863 reads processed; of these: 629 ( 0.01%) short reads filtered out after trimming by size control 6311 ( 0.06%) empty reads filtered out after trimming by size control 10498923 (99.93%) reads available; of these: 375479 ( 3.58%) trimmed reads available after processing 10123444 (96.42%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 20 0.00% 20 18 0.00% 21 22 0.00% 22 20 0.00% 23 9 0.00% 24 31 0.00% 25 27 0.00% 26 37 0.00% 27 36 0.00% 28 46 0.00% 29 42 0.00% 30 55 0.00% 31 79 0.00% 32 101 0.00% 33 98 0.00% 34 120 0.00% 35 144 0.00% 36 147 0.00% 37 176 0.00% 38 251 0.00% 39 304 0.00% 40 426 0.00% 41 513 0.00% 42 602 0.01% 43 735 0.01% 44 853 0.01% 45 981 0.01% 46 1113 0.01% 47 1377 0.01% 48 1679 0.02% 49 1965 0.02% 50 2542 0.02% 51 2995 0.03% 52 3603 0.03% 53 3905 0.04% 54 4435 0.04% 55 4970 0.05% 56 5586 0.05% 57 6149 0.06% 58 7374 0.07% 59 8292 0.08% 60 9613 0.09% 61 11152 0.11% 62 12761 0.12% 63 14028 0.13% 64 15161 0.14% 65 16210 0.15% 66 16340 0.16% 67 17731 0.17% 68 18555 0.18% 69 18936 0.18% 70 94 0.00% 71 166 0.00% 72 478 0.00% 73 402 0.00% 74 149 0.00% 75 148 0.00% 76 178 0.00% 77 164 0.00% 78 198 0.00% 79 196 0.00% 80 209 0.00% 81 366 0.00% 82 255 0.00% 83 336 0.00% 84 340 0.00% 85 371 0.00% 86 427 0.00% 87 384 0.00% 88 481 0.00% 89 567 0.01% 90 644 0.01% 91 798 0.01% 92 1000 0.01% 93 1017 0.01% 94 1308 0.01% 95 1836 0.02% 96 2346 0.02% 97 3312 0.03% 98 5306 0.05% 99 11038 0.11% 100 128581 1.22% 101 10123444 96.42% 10498923 reads passed initial QC criterion=sequence-density sequence-density=5.96 sequence-density-rank=1 fanout-score=53.23 fanout-score-rank=1 prefix-density=7.23 prefix-fanout=43.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=5.96 sequence-density-rank=1 fanout-score=53.23 fanout-score-rank=1 prefix-density=7.23 prefix-fanout=43.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG -o SRR6126823 - Input file: STDIN trimmed: SRR6126823-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Tue Dec 10 05:13:17 2024 >> started Tue Dec 10 05:13:27 2024 >> done (9.633s) 6999282 reads processed; of these: 2 ( 0.00%) short reads filtered out after trimming by size control 500 ( 0.01%) empty reads filtered out after trimming by size control 6998780 (99.99%) reads available; of these: 900105 (12.86%) trimmed reads available after processing 6098675 (87.14%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 11 0.00% 20 13 0.00% 21 16 0.00% 22 12 0.00% 23 7 0.00% 24 19 0.00% 25 20 0.00% 26 30 0.00% 27 19 0.00% 28 30 0.00% 29 26 0.00% 30 31 0.00% 31 56 0.00% 32 66 0.00% 33 73 0.00% 34 90 0.00% 35 94 0.00% 36 104 0.00% 37 124 0.00% 38 176 0.00% 39 212 0.00% 40 300 0.00% 41 337 0.00% 42 418 0.01% 43 497 0.01% 44 532 0.01% 45 631 0.01% 46 743 0.01% 47 955 0.01% 48 1123 0.02% 49 1337 0.02% 50 1715 0.02% 51 2026 0.03% 52 2475 0.04% 53 2634 0.04% 54 2953 0.04% 55 3268 0.05% 56 3719 0.05% 57 4193 0.06% 58 5041 0.07% 59 5605 0.08% 60 6537 0.09% 61 7528 0.11% 62 8550 0.12% 63 9410 0.13% 64 10065 0.14% 65 10844 0.15% 66 10925 0.16% 67 11668 0.17% 68 12368 0.18% 69 12718 0.18% 70 14296 0.20% 71 15151 0.22% 72 16640 0.24% 73 18400 0.26% 74 19033 0.27% 75 19699 0.28% 76 20037 0.29% 77 20467 0.29% 78 20360 0.29% 79 22043 0.31% 80 22782 0.33% 81 23556 0.34% 82 25132 0.36% 83 26179 0.37% 84 27440 0.39% 85 28642 0.41% 86 29199 0.42% 87 29398 0.42% 88 30085 0.43% 89 30011 0.43% 90 30358 0.43% 91 31559 0.45% 92 32869 0.47% 93 34078 0.49% 94 35526 0.51% 95 38233 0.55% 96 45051 0.64% 97 63662 0.91% 98 141781 2.03% 99 6611 0.09% 100 74020 1.06% 101 5864124 83.79% criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=17 prefix-density=0.56 prefix-fanout=2.1 sequence=AGTACAGGAATATT criterion=fanout-score sequence-density=0.09 sequence-density-rank=29 fanout-score=9.81 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=3.9 sequence=TCTTGGAGAGGATCTCCGGGAACACGCACCCGAGCGCGCCAAGCATCGCCCAACGAGAGTGGATCACCTCGAGCTCCCTGTTCTTGGCGAACGTCTCTGGGTCAGCTGACAACCCCGCGGTGTCCCAGCCGTAGTCACCGGGGAACTCGCCGGTCAGGTACGACGGCGTCTGCTCGGAGAACGGGCCCAGGTACTTGGGACGGTCAGGGCCGTACCAGATGCTCTGGGGTGCGCTCTTGACAGTCCGGCGCATGGTGA Started job on | Dec 10 05:13:49 Started mapping on | Dec 10 05:13:50 Finished on | Dec 10 05:14:07 Mapping speed, Million of reads per hour | 2223.20 Number of input reads | 10498421 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 8871214 Uniquely mapped reads % | 84.50% Average mapped length | 98.39 Number of splices: Total | 2805236 Number of splices: Annotated (sjdb) | 2656279 Number of splices: GT/AG | 2765442 Number of splices: GC/AG | 33690 Number of splices: AT/AC | 946 Number of splices: Non-canonical | 5158 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.83 Insertion rate per base | 0.01% Insertion average length | 1.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 974581 % of reads mapped to multiple loci | 9.28% Number of reads mapped to too many loci | 369112 % of reads mapped to too many loci | 3.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.54% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 652626 652626 652626 N_multimapping 974581 974581 974581 N_noFeature 325249 8641928 386963 N_ambiguous 185873 570 18563 UnstrandedReadsAssigned:8360092 PositiveStrandReadsAssigned:228716 NegativeStrandReadsAssigned:8465688 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR6126823 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6126823-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,498,421 reads, 8,615,986 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52973 SRR6126823.ke.tsv 35125 SRR6126823.se.tsv 88098 total ==> SRR6126823.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 13.2393 2.84502 PNS24247 1044 945 26.905 5.12088 PNS24249 1928 1829 7.36089 0.723871 PNS24246 1044 945 26.905 5.12088 PNS24248 1044 945 26.905 5.12088 PNS24244 1471 1372 68.6849 9.00432 PNS24243 293 194 0 0 KQK14069 1603 1504 10795.1 1290.99 KQK14071 474 375 1002.01 480.601 ==> SRR6126823.se.tsv <== BRADI_1g14170v3 13349 BRADI_1g53295v3 17 BRADI_1g59795v3 185 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 110 BRADI_1g74790v3 33 BRADI_1g09890v3 0 BRADI_1g77505v3 105 BRADI_1g48960v3 0 SRR6126823 completed mapping pipeline successfully