Starting /dee2/code/volunteer_pipeline.sh SRR6127927 current disk space = 1526257528832 free memory = 1599181556 SRR6127927 SRAfilesize 37e02c6ee2a32839699303a0934b4106 SRR6127927.sra SRR6127927.sra file validated SRR6127927 is paired end SRR6127927 is conventional basespace SRR6127927 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6127927_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3685 33.0 33.0 33.0 33.0 33.0 2 32.5255 33.0 33.0 33.0 33.0 33.0 3 32.76075 33.0 33.0 33.0 33.0 33.0 4 36.736 37.0 37.0 37.0 37.0 37.0 5 36.69575 37.0 37.0 37.0 37.0 37.0 6 36.66025 37.0 37.0 37.0 37.0 37.0 7 36.6655 37.0 37.0 37.0 37.0 37.0 8 36.66025 37.0 37.0 37.0 37.0 37.0 9 36.68075 37.0 37.0 37.0 37.0 37.0 10-11 36.63175 37.0 37.0 37.0 37.0 37.0 12-13 36.615375 37.0 37.0 37.0 37.0 37.0 14-15 38.955124999999995 40.0 40.0 40.0 37.0 40.0 16-17 38.956625 40.0 40.0 40.0 37.0 40.0 18-19 38.911625 40.0 40.0 40.0 37.0 40.0 20-21 38.867374999999996 40.0 38.5 40.0 37.0 40.0 22-23 38.784125 40.0 37.0 40.0 37.0 40.0 24-25 38.693 40.0 37.0 40.0 37.0 40.0 26-27 38.663 40.0 37.0 40.0 37.0 40.0 28-29 38.692499999999995 40.0 37.0 40.0 37.0 40.0 30-31 38.550625 40.0 37.0 40.0 37.0 40.0 32-33 38.52975 40.0 37.0 40.0 37.0 40.0 34-35 38.422375 40.0 37.0 40.0 37.0 40.0 36-37 38.309125 40.0 37.0 40.0 37.0 40.0 38-39 38.205 40.0 37.0 40.0 37.0 40.0 40-41 38.02575 40.0 37.0 40.0 35.0 40.0 42-43 37.742875 40.0 37.0 40.0 33.0 40.0 44-45 37.622875 40.0 37.0 40.0 33.0 40.0 46-47 37.4035 40.0 37.0 40.0 33.0 40.0 48-49 37.375 40.0 37.0 40.0 33.0 40.0 50-51 37.18325 40.0 37.0 40.0 33.0 40.0 52-53 36.906625 38.5 37.0 40.0 33.0 40.0 54-55 36.3785 37.0 37.0 40.0 33.0 40.0 56-57 36.361000000000004 37.0 37.0 40.0 33.0 40.0 58-59 36.167249999999996 37.0 37.0 40.0 33.0 40.0 60-61 35.89 37.0 37.0 40.0 33.0 40.0 62-63 35.711875 37.0 37.0 40.0 33.0 40.0 64-65 35.473375000000004 37.0 37.0 38.5 33.0 40.0 66-67 35.054249999999996 37.0 33.0 37.0 30.0 40.0 68-69 34.8635 37.0 33.0 37.0 27.0 40.0 70-71 34.54425 37.0 33.0 37.0 27.0 40.0 72-73 34.246625 37.0 33.0 37.0 27.0 38.5 74-75 33.8505 37.0 33.0 37.0 27.0 37.0 76-77 31.080750000000002 33.0 30.0 35.0 22.0 37.0 78-79 32.877375 37.0 33.0 37.0 27.0 37.0 80-81 32.957375 37.0 33.0 37.0 27.0 37.0 82-83 33.056 37.0 33.0 37.0 27.0 37.0 84-85 33.09 37.0 33.0 37.0 27.0 37.0 86-87 33.024249999999995 37.0 33.0 37.0 27.0 37.0 88-89 32.773624999999996 37.0 33.0 37.0 27.0 37.0 90-91 32.757125 37.0 33.0 37.0 27.0 37.0 92-93 32.625625 37.0 33.0 37.0 27.0 37.0 94-95 32.442625 37.0 33.0 37.0 22.0 37.0 96-97 32.22325 37.0 33.0 37.0 22.0 37.0 98-99 31.8925 37.0 33.0 37.0 22.0 37.0 100 28.09525 33.0 27.0 33.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 2.0 10 2.0 11 2.0 12 4.0 13 8.0 14 4.0 15 7.0 16 7.0 17 15.0 18 7.0 19 11.0 20 11.0 21 11.0 22 8.0 23 26.0 24 14.0 25 21.0 26 23.0 27 41.0 28 35.0 29 40.0 30 65.0 31 83.0 32 90.0 33 154.0 34 194.0 35 276.0 36 524.0 37 1285.0 38 1029.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.585612968591693 11.60081053698075 7.9280648429584595 48.8855116514691 2 22.75 15.25 39.225 22.775000000000002 3 21.224999999999998 21.0 24.9 32.875 4 27.700000000000003 26.625 22.175 23.5 5 26.5 31.775 22.55 19.175 6 21.125 32.925 24.525 21.425 7 17.025000000000002 21.125 41.325 20.525 8 20.674999999999997 20.575 29.025000000000002 29.725 9 20.7 19.400000000000002 33.775 26.125 10-11 25.55 28.249999999999996 21.4 24.8 12-13 23.0875 21.587500000000002 26.887499999999996 28.4375 14-15 23.4625 24.5125 27.3625 24.6625 16-17 24.3125 25.5125 24.6875 25.4875 18-19 23.9125 25.5625 25.4 25.124999999999996 20-21 23.2875 24.4875 26.737499999999997 25.4875 22-23 23.275000000000002 24.3 26.0625 26.3625 24-25 22.8 24.3625 26.2625 26.575 26-27 23.9375 24.25 26.450000000000003 25.362499999999997 28-29 23.150000000000002 24.9 26.8625 25.087500000000002 30-31 23.175 24.637500000000003 26.1125 26.075 32-33 23.65 25.974999999999998 25.2625 25.112499999999997 34-35 24.3125 23.799999999999997 26.2875 25.6 36-37 23.9 24.25 25.2 26.650000000000002 38-39 24.0375 24.9 25.074999999999996 25.9875 40-41 24.9875 24.625 24.7 25.687500000000004 42-43 23.4625 24.474999999999998 25.8 26.2625 44-45 25.0625 23.775 25.8625 25.3 46-47 24.625 24.8625 25.224999999999998 25.2875 48-49 24.087500000000002 23.724999999999998 25.4375 26.75 50-51 23.962500000000002 24.474999999999998 25.0125 26.55 52-53 25.05 24.3125 25.9875 24.65 54-55 24.099999999999998 25.3125 24.5 26.087500000000002 56-57 23.3 24.95 25.5625 26.187500000000004 58-59 24.2 25.2125 25.387500000000003 25.2 60-61 23.6625 25.7125 25.337500000000002 25.2875 62-63 24.05 23.5375 26.125 26.2875 64-65 24.7375 25.4625 24.6625 25.137500000000003 66-67 24.3125 23.9375 25.2 26.55 68-69 23.925 25.137500000000003 25.2125 25.724999999999998 70-71 24.3875 24.3875 25.8125 25.412499999999998 72-73 25.224999999999998 23.8625 24.1625 26.75 74-75 24.712500000000002 24.375 25.137500000000003 25.775 76-77 25.5375 24.6875 24.625 25.15 78-79 24.875 24.5 24.962500000000002 25.662499999999998 80-81 24.837500000000002 24.275 25.05 25.837500000000002 82-83 24.587500000000002 24.925 24.4 26.087500000000002 84-85 24.1125 24.975 24.675 26.237500000000004 86-87 24.85 23.974999999999998 25.4625 25.7125 88-89 24.9375 24.275 24.4875 26.3 90-91 25.724999999999998 24.474999999999998 24.4125 25.387500000000003 92-93 24.7375 24.5125 24.637500000000003 26.1125 94-95 25.387500000000003 24.6 24.637500000000003 25.374999999999996 96-97 24.712500000000002 25.4625 24.325 25.5 98-99 26.387500000000003 24.887500000000003 24.075 24.65 100 26.200000000000003 24.8 22.95 26.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 1.0 27 5.0 28 6.0 29 5.0 30 9.0 31 12.5 32 16.0 33 25.0 34 33.0 35 40.0 36 52.0 37 66.5 38 83.5 39 88.5 40 94.5 41 115.0 42 122.0 43 143.5 44 173.0 45 167.5 46 177.5 47 189.0 48 176.0 49 173.0 50 165.0 51 154.0 52 159.5 53 157.0 54 130.5 55 121.5 56 108.0 57 92.0 58 98.5 59 97.0 60 89.5 61 83.5 62 75.0 63 64.0 64 56.0 65 63.0 66 57.5 67 44.5 68 42.0 69 32.5 70 27.5 71 23.0 72 21.5 73 18.0 74 10.0 75 8.0 76 7.0 77 5.0 78 4.5 79 3.0 80 1.5 81 0.5 82 0.5 83 0.5 84 0.5 85 1.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.925 #Duplication Level Percentage of deduplicated Percentage of total 1 95.71466595688048 89.9 2 2.741549108331115 5.1499999999999995 3 1.1179132286398723 3.15 4 0.2661698163428267 1.0 5 0.10646792653713069 0.5 6 0.053233963268565346 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCTCTCGTTCTCGCCCGCTTTGCAAAAATATCTAATATCAATTGCGTG 6 0.15 No Hit CTCAAATTTCGCACTGACCATAATGTGATCCCTTCCGGCGGTCGGTATAA 6 0.15 No Hit CTCAGACGCTGCCCTAACTGCGCAGTTAATAATTCTGGCAATTCGTCTCC 5 0.125 No Hit CTTCACTTCAATTGCTGTTGCCAATGACTTCAGCTGACTTGGCGACAGTT 5 0.125 No Hit CCGAGTTCAGTGCGACCGTACAGCTCTGGAACCCAAAGGTTCGTTTTTTT 5 0.125 No Hit GCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.07500000000000001 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.16249999999999998 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.2625 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.55 0.0 0.0 0.0 0.0 76-77 0.65 0.0 0.0 0.0 0.0 78-79 0.8 0.0 0.0 0.0 0.0 80-81 0.9375 0.0 0.0 0.0 0.0 82-83 1.225 0.0 0.0 0.0 0.0 84-85 1.475 0.0 0.0 0.0 0.0 86-87 1.7625000000000002 0.0 0.0 0.0 0.0 88 1.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6127927 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6127927_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.014 33.0 33.0 33.0 33.0 33.0 2 32.12525 33.0 33.0 33.0 33.0 33.0 3 32.25 33.0 33.0 33.0 33.0 33.0 4 35.75875 37.0 37.0 37.0 33.0 37.0 5 35.72575 37.0 37.0 37.0 33.0 37.0 6 35.6395 37.0 37.0 37.0 33.0 37.0 7 35.74025 37.0 37.0 37.0 33.0 37.0 8 35.9055 37.0 37.0 37.0 37.0 37.0 9 36.1555 37.0 37.0 37.0 37.0 37.0 10-11 36.201499999999996 37.0 37.0 37.0 37.0 37.0 12-13 36.180625000000006 37.0 37.0 37.0 37.0 37.0 14-15 38.35425 40.0 37.0 40.0 37.0 40.0 16-17 38.32325 40.0 37.0 40.0 37.0 40.0 18-19 38.38375 40.0 37.0 40.0 37.0 40.0 20-21 38.31725 40.0 37.0 40.0 37.0 40.0 22-23 37.536500000000004 40.0 37.0 40.0 33.0 40.0 24-25 38.046125 40.0 37.0 40.0 37.0 40.0 26-27 38.14275000000001 40.0 37.0 40.0 37.0 40.0 28-29 38.163875 40.0 37.0 40.0 37.0 40.0 30-31 38.078625 40.0 37.0 40.0 37.0 40.0 32-33 37.8715 40.0 37.0 40.0 33.0 40.0 34-35 37.909875 40.0 37.0 40.0 35.0 40.0 36-37 37.8455 40.0 37.0 40.0 33.0 40.0 38-39 37.664874999999995 40.0 37.0 40.0 33.0 40.0 40-41 37.544125 40.0 37.0 40.0 33.0 40.0 42-43 37.36987499999999 40.0 37.0 40.0 33.0 40.0 44-45 37.177 40.0 37.0 40.0 33.0 40.0 46-47 36.97325 40.0 37.0 40.0 33.0 40.0 48-49 36.850750000000005 40.0 37.0 40.0 33.0 40.0 50-51 35.21575 37.0 35.0 38.5 30.0 38.5 52-53 35.542 37.0 35.0 38.5 30.0 40.0 54-55 36.21125 37.0 37.0 40.0 33.0 40.0 56-57 36.177875 37.0 37.0 40.0 33.0 40.0 58-59 36.00775 37.0 37.0 40.0 33.0 40.0 60-61 35.657624999999996 37.0 37.0 40.0 33.0 40.0 62-63 35.554625 37.0 37.0 40.0 33.0 40.0 64-65 35.317375 37.0 37.0 38.5 33.0 40.0 66-67 35.124875 37.0 37.0 37.0 33.0 40.0 68-69 34.831125 37.0 33.0 37.0 30.0 40.0 70-71 34.608000000000004 37.0 33.0 37.0 30.0 40.0 72-73 34.357 37.0 33.0 37.0 27.0 38.5 74-75 34.21175 37.0 33.0 37.0 27.0 37.0 76-77 33.917874999999995 37.0 33.0 37.0 27.0 37.0 78-79 33.605875 37.0 33.0 37.0 27.0 37.0 80-81 33.58 37.0 33.0 37.0 27.0 37.0 82-83 33.410375 37.0 33.0 37.0 27.0 37.0 84-85 33.4455 37.0 33.0 37.0 27.0 37.0 86-87 33.402249999999995 37.0 33.0 37.0 27.0 37.0 88-89 33.23675 37.0 33.0 37.0 27.0 37.0 90-91 33.185125 37.0 33.0 37.0 27.0 37.0 92-93 32.98675 37.0 33.0 37.0 27.0 37.0 94-95 32.928250000000006 37.0 33.0 37.0 27.0 37.0 96-97 32.530125 37.0 33.0 37.0 24.5 37.0 98-99 32.420500000000004 37.0 33.0 37.0 22.0 37.0 100-101 30.872 35.0 30.0 37.0 18.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 28.0 3 3.0 4 5.0 5 3.0 6 1.0 7 5.0 8 5.0 9 3.0 10 3.0 11 4.0 12 7.0 13 14.0 14 5.0 15 5.0 16 5.0 17 10.0 18 12.0 19 5.0 20 8.0 21 6.0 22 13.0 23 10.0 24 17.0 25 16.0 26 27.0 27 29.0 28 32.0 29 48.0 30 45.0 31 74.0 32 89.0 33 118.0 34 163.0 35 229.0 36 505.0 37 1407.0 38 1041.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.8 15.299999999999999 10.85 43.05 2 29.125 21.575 32.15 17.150000000000002 3 23.05 26.825 25.45 24.675 4 26.3 31.55 18.275 23.875 5 27.125 34.599999999999994 19.1 19.175 6 23.175 35.0 19.275000000000002 22.55 7 21.325 15.625 38.05 25.0 8 22.5 21.349999999999998 25.5 30.65 9 24.15 21.775 27.275 26.8 10-11 26.950000000000003 27.462500000000002 20.150000000000002 25.4375 12-13 27.3 21.987499999999997 23.724999999999998 26.987499999999997 14-15 25.25 24.025 25.8625 24.8625 16-17 26.740842605325664 24.66558319789974 23.15289411176397 25.440680085010626 18-19 25.165645705713214 26.328291036379547 23.252906613326665 25.25315664458057 20-21 25.722145804676757 25.797173940227587 23.383768913342504 25.09691134175316 22-23 26.578322290286287 25.353169146143266 23.31541442680335 24.753094136767096 24-25 24.678084760595073 25.715714464308036 23.64045505688211 25.965745718214777 26-27 25.525 25.275 24.425 24.775 28-29 25.912499999999998 25.275 22.7375 26.075 30-31 24.5375 24.975 24.712500000000002 25.775 32-33 26.075 24.525 24.625 24.775 34-35 25.874999999999996 24.125 24.6875 25.3125 36-37 26.0 24.925 23.8625 25.2125 38-39 24.975 25.5375 23.75 25.7375 40-41 26.5375 24.275 24.2 24.9875 42-43 26.3625 25.7375 23.45 24.45 44-45 25.874999999999996 25.775 23.45 24.9 46-47 26.087500000000002 25.2 24.4375 24.275 48-49 25.415676959619955 24.840605075634453 24.290536317039628 25.453181647705964 50-51 26.4125 25.2375 24.325 24.025 52-53 26.424999999999997 24.9 24.224999999999998 24.45 54-55 25.528191023877984 24.778097262157768 24.253031628953618 25.440680085010626 56-57 25.19064883110389 25.478184773096636 24.36554569321165 24.965620702587824 58-59 26.825 24.775 24.5625 23.8375 60-61 25.087500000000002 25.8125 24.1375 24.962500000000002 62-63 26.6625 24.9875 24.15 24.2 64-65 25.26565820727591 25.828228528566072 23.990498812351543 24.915614451806476 66-67 26.075 24.375 23.9 25.650000000000002 68-69 26.35329416177022 25.50318789848731 24.6530816352044 23.49043630453807 70-71 25.8 23.825 24.325 26.05 72-73 25.331332833208304 25.71892973243311 24.418604651162788 24.5311327831958 74-75 26.174999999999997 25.324999999999996 24.025 24.474999999999998 76-77 25.2 25.924999999999997 24.4875 24.3875 78-79 26.78169542385596 25.681420355088775 23.36834208552138 24.168542135533883 80-81 25.074999999999996 26.5625 24.025 24.337500000000002 82-83 25.76288144072036 25.887943971985994 23.649324662331164 24.69984992496248 84-85 25.55055055055055 24.83733733733734 24.1991991991992 25.412912912912912 86-87 26.090761345168147 25.403175396924617 24.315539442430303 24.190523815476936 88-89 27.375 25.0 23.3625 24.2625 90-91 26.2625 25.8125 23.799999999999997 24.125 92-93 26.67833479184898 25.715714464308036 24.265533191648956 23.340417552194022 94-95 26.8625 25.2 23.7375 24.2 96-97 26.4125 26.0 24.575 23.0125 98-99 26.0625 27.037499999999998 23.7375 23.1625 100-101 27.3 26.400000000000002 23.425 22.875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.0 25 1.0 26 1.0 27 0.5 28 2.0 29 3.0 30 8.5 31 19.0 32 22.0 33 24.5 34 31.5 35 37.0 36 48.5 37 58.5 38 65.5 39 80.5 40 116.0 41 131.5 42 121.5 43 117.5 44 134.5 45 147.5 46 144.0 47 163.5 48 172.0 49 165.5 50 174.0 51 161.5 52 148.5 53 148.5 54 145.5 55 145.5 56 136.0 57 115.0 58 94.0 59 95.0 60 102.0 61 85.5 62 70.0 63 70.0 64 65.0 65 64.0 66 57.0 67 55.5 68 52.0 69 37.0 70 35.5 71 32.0 72 25.0 73 18.5 74 12.0 75 9.0 76 7.0 77 6.5 78 5.5 79 3.5 80 1.0 81 0.5 82 0.5 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0125 18-19 0.0125 20-21 0.0375 22-23 0.0125 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0125 50-51 0.0 52-53 0.0 54-55 0.0125 56-57 0.0125 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.025 74-75 0.0 76-77 0.0 78-79 0.025 80-81 0.0 82-83 0.05 84-85 0.1 86-87 0.0125 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.65 #Duplication Level Percentage of deduplicated Percentage of total 1 95.50977284733227 90.4 2 3.565768621236133 6.75 3 0.739566825145272 2.1 4 0.13206550449022716 0.5 5 0.05282620179609086 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCAATATAAGCCTTGGTAGGGATAGATAGCCACCTATATAGTATAGCT 5 0.125 No Hit CAAACATGCACAGCGGTCAAACAGTATGTCCCAAGGGGACTTAAGCGCGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.07500000000000001 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.16249999999999998 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.2625 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.55 0.0 0.0 0.0 0.0 76-77 0.65 0.0 0.0 0.0 0.0 78-79 0.8 0.0 0.0 0.0 0.0 80-81 0.9375 0.0 0.0 0.0 0.0 82-83 1.225 0.0 0.0 0.0 0.0 84-85 1.475 0.0 0.0 0.0 0.0 86-87 1.7625000000000002 0.0 0.0 0.0 0.0 88-89 2.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1590801 spots for SRR6127927.sra Written 1590801 spots for SRR6127927.sra Read 1590801 spots for SRR6127927.sra Written 1590801 spots for SRR6127927.sra Read 1590801 spots for SRR6127927.sra Written 1590801 spots for SRR6127927.sra Read 1590801 spots for SRR6127927.sra Written 1590801 spots for SRR6127927.sra Read 1590801 spots for SRR6127927.sra Written 1590801 spots for SRR6127927.sra Read 1590801 spots for SRR6127927.sra Written 1590801 spots for SRR6127927.sra Read 1590801 spots for SRR6127927.sra Written 1590801 spots for SRR6127927.sra Read 1590801 spots for SRR6127927.sra Written 1590801 spots for SRR6127927.sra Read 1590801 spots for SRR6127927.sra Written 1590801 spots for SRR6127927.sra Read 1590801 spots for SRR6127927.sra Written 1590801 spots for SRR6127927.sra Read 1590801 spots for SRR6127927.sra Written 1590801 spots for SRR6127927.sra Read 1590808 spots for SRR6127927.sra Written 1590808 spots for SRR6127927.sra Read 1590801 spots for SRR6127927.sra Written 1590801 spots for SRR6127927.sra Read 1590801 spots for SRR6127927.sra Written 1590801 spots for SRR6127927.sra Read 1590801 spots for SRR6127927.sra Written 1590801 spots for SRR6127927.sra Read 1590801 spots for SRR6127927.sra Written 1590801 spots for SRR6127927.sra Read 1590801 spots for SRR6127927.sra Written 1590801 spots for SRR6127927.sra Read 1590801 spots for SRR6127927.sra Written 1590801 spots for SRR6127927.sra Read 1590801 spots for SRR6127927.sra Written 1590801 spots for SRR6127927.sra Read 1590801 spots for SRR6127927.sra Written 1590801 spots for SRR6127927.sra SRR ids: ['SRR6127927.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zo50f3tz SRR6127927.sra spots: 31816027 blocks: [[1, 1590801], [1590802, 3181602], [3181603, 4772403], [4772404, 6363204], [6363205, 7954005], [7954006, 9544806], [9544807, 11135607], [11135608, 12726408], [12726409, 14317209], [14317210, 15908010], [15908011, 17498811], [17498812, 19089612], [19089613, 20680413], [20680414, 22271214], [22271215, 23862015], [23862016, 25452816], [25452817, 27043617], [27043618, 28634418], [28634419, 30225219], [30225220, 31816027]] SRR6127927 file size 7590532 SRR6127927 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6127927 SRR6127927_1.fastq SRR6127927_2.fastq Input file: SRR6127927_1.fastq Paired file: SRR6127927_2.fastq trimmed: SRR6127927-trimmed-pair1.fastq, SRR6127927-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 04:28:05 2024 >> started Tue Dec 10 04:28:33 2024 >> done (28.764s) 31816027 read pairs processed; of these: 114434 ( 0.36%) short read pairs filtered out after trimming by size control 216861 ( 0.68%) empty read pairs filtered out after trimming by size control 31484732 (98.96%) read pairs available; of these: 6175833 (19.62%) trimmed read pairs available after processing 25308899 (80.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 27 0.00% 19 40 0.00% 20 65 0.00% 21 103 0.00% 22 151 0.00% 23 183 0.00% 24 236 0.00% 25 325 0.00% 26 442 0.00% 27 542 0.00% 28 678 0.00% 29 775 0.00% 30 869 0.00% 31 1085 0.00% 32 1199 0.00% 33 1399 0.00% 34 1616 0.01% 35 1828 0.01% 36 1999 0.01% 37 2188 0.01% 38 2419 0.01% 39 2833 0.01% 40 2910 0.01% 41 3345 0.01% 42 3717 0.01% 43 4069 0.01% 44 4366 0.01% 45 4866 0.02% 46 5381 0.02% 47 5673 0.02% 48 6281 0.02% 49 6712 0.02% 50 7239 0.02% 51 7966 0.03% 52 8522 0.03% 53 9340 0.03% 54 9841 0.03% 55 10882 0.03% 56 11928 0.04% 57 12876 0.04% 58 14303 0.05% 59 24010 0.08% 60 25715 0.08% 61 27651 0.09% 62 30955 0.10% 63 32747 0.10% 64 35553 0.11% 65 38542 0.12% 66 38612 0.12% 67 40772 0.13% 68 42323 0.13% 69 45694 0.15% 70 47478 0.15% 71 50820 0.16% 72 53013 0.17% 73 55092 0.17% 74 57895 0.18% 75 55782 0.18% 76 56674 0.18% 77 61095 0.19% 78 65620 0.21% 79 69860 0.22% 80 75495 0.24% 81 83402 0.26% 82 90808 0.29% 83 98929 0.31% 84 110065 0.35% 85 123808 0.39% 86 141770 0.45% 87 145268 0.46% 88 144487 0.46% 89 147481 0.47% 90 162582 0.52% 91 176401 0.56% 92 193114 0.61% 93 213033 0.68% 94 243528 0.77% 95 280023 0.89% 96 329914 1.05% 97 402215 1.28% 98 499790 1.59% 99 625907 1.99% 100 26079590 82.83% 31484732 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=15 prefix-density=0.37 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=36.60 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=8.9 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGCGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGGTGTAGCTGGCGACTTGCTCAGGGGTGGCCCGCTCCTTGCACTCGGCGCCGGGTGTCACCATGCTGGGCTTGAGGAGGATGCCCTCGAACAAGACGTTGTTCTGGGCCATGTAGTAGAAAGTCTCCGCCCACACCTTCTGCGCCACCTCGAAGGTCCTGTCGATGCCGTGCTCGCCGTCCAGCAGGATCTCCGGCTCCACAATCGGCACCAGACCGTTG criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.76 fanout-score-rank=12 prefix-density=0.39 prefix-fanout=3.1 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=9.57 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=1.4 sequence=CGAGCTCGCATTTTGAAAATTCTATGGAAGAGCTAGCATCTCTGACGAAAACAGCAGACGGAAAAGTACTGACCAGCGTCACACAAAAACGGAACAGGGCTGACGCCGCTACATATATAGGAAAAGGGAAGGTAGAAGAGCTGAAGGCACTCGTGGAAGAGCTTGAAGCTGATCTCCTCATCTTTAATGATGAACTGTCGCCAAGTCAGCTGAAGTCATTGGCAACAGCAATTGAAGTGAAGATGATTGACCGCACGCAATTGATATTAGATATTTTTGCAAAGCGGGCGAGAACGAGAGAAGGCAAACTTCAAATTGAGCTGGCTCAGCTGCAATATGCACTGCCGCGTCTGACGGGACAAGGGATCAACCTTTCCCGGCAAGGCGGAGGAATTGGGGCAAGAGGTCCCGGGGAAACGAAACTGGAAACCGACCGCCGCCATATCAGAAATCGCATTCATGAAATCAACACACAGCTTTCCACTGTCATTCGCCATAGAAGCCGATACCG SRR6127927 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 04:29:22 Started mapping on | Dec 10 04:29:23 Finished on | Dec 10 04:43:53 Mapping speed, Million of reads per hour | 130.28 Number of input reads | 31484732 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 22563811 Uniquely mapped reads % | 71.67% Average mapped length | 196.03 Number of splices: Total | 15152385 Number of splices: Annotated (sjdb) | 14373217 Number of splices: GT/AG | 14939387 Number of splices: GC/AG | 181909 Number of splices: AT/AC | 4914 Number of splices: Non-canonical | 26175 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.38 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 588364 % of reads mapped to multiple loci | 1.87% Number of reads mapped to too many loci | 113673 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 24.37% % of reads unmapped: other | 1.73% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 8346362 8346362 8346362 N_multimapping 588364 588364 588364 N_noFeature 814572 21980682 960823 N_ambiguous 514136 1886 79815 UnstrandedReadsAssigned:21235103 PositiveStrandReadsAssigned:581243 NegativeStrandReadsAssigned:21523173 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR6127927 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6127927-trimmed-pair1.fastq SRR6127927-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,484,732 reads, 21,680,187 reads pseudoaligned [quant] estimated average fragment length: 160.681 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,148 rounds 52973 SRR6127927.ke.tsv 35125 SRR6127927.se.tsv 88098 total ==> SRR6127927.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 776.465 29.7909 2.48299 PNS24247 1044 884.319 21.8644 1.60008 PNS24249 1928 1768.32 82.301 3.01201 PNS24246 1044 884.319 21.8644 1.60008 PNS24248 1044 884.319 21.8644 1.60008 PNS24244 1471 1311.32 90.3148 4.45721 PNS24243 293 140.404 0 0 KQK14069 1603 1443.32 8559.36 383.788 KQK14071 474 315.988 427.053 87.4629 ==> SRR6127927.se.tsv <== BRADI_1g14170v3 10009 BRADI_1g53295v3 474 BRADI_1g59795v3 141 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 196 BRADI_1g74790v3 132 BRADI_1g09890v3 0 BRADI_1g77505v3 518 BRADI_1g48960v3 0 SRR6127927 completed mapping pipeline successfully