Starting /dee2/code/volunteer_pipeline.sh SRR6127940 current disk space = 1526200643584 free memory = 1556012184 SRR6127940 SRAfilesize 6428f9493680a66a257459be848b29ea SRR6127940.sra SRR6127940.sra file validated SRR6127940 is paired end SRR6127940 is conventional basespace SRR6127940 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6127940_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.28925 33.0 33.0 33.0 33.0 33.0 2 32.4795 33.0 33.0 33.0 33.0 33.0 3 32.71175 33.0 33.0 33.0 33.0 33.0 4 36.755 37.0 37.0 37.0 37.0 37.0 5 36.74275 37.0 37.0 37.0 37.0 37.0 6 36.6605 37.0 37.0 37.0 37.0 37.0 7 36.63525 37.0 37.0 37.0 37.0 37.0 8 36.682 37.0 37.0 37.0 37.0 37.0 9 36.68675 37.0 37.0 37.0 37.0 37.0 10-11 36.682249999999996 37.0 37.0 37.0 37.0 37.0 12-13 36.637375 37.0 37.0 37.0 37.0 37.0 14-15 38.92375 40.0 40.0 40.0 37.0 40.0 16-17 38.943124999999995 40.0 40.0 40.0 37.0 40.0 18-19 38.927375 40.0 40.0 40.0 37.0 40.0 20-21 38.876 40.0 40.0 40.0 37.0 40.0 22-23 38.74125 40.0 37.0 40.0 37.0 40.0 24-25 38.58125 40.0 37.0 40.0 37.0 40.0 26-27 38.54 40.0 37.0 40.0 37.0 40.0 28-29 38.4435 40.0 37.0 40.0 37.0 40.0 30-31 38.45725 40.0 37.0 40.0 37.0 40.0 32-33 38.392250000000004 40.0 37.0 40.0 37.0 40.0 34-35 38.30975 40.0 37.0 40.0 37.0 40.0 36-37 38.165125 40.0 37.0 40.0 37.0 40.0 38-39 37.995374999999996 40.0 37.0 40.0 35.0 40.0 40-41 37.81075 40.0 37.0 40.0 33.0 40.0 42-43 37.56275 40.0 37.0 40.0 33.0 40.0 44-45 37.411500000000004 40.0 37.0 40.0 33.0 40.0 46-47 37.179125 40.0 37.0 40.0 33.0 40.0 48-49 37.0075 40.0 37.0 40.0 33.0 40.0 50-51 36.861999999999995 37.0 37.0 40.0 33.0 40.0 52-53 36.577625 37.0 37.0 40.0 33.0 40.0 54-55 35.967749999999995 37.0 37.0 40.0 33.0 40.0 56-57 35.907875000000004 37.0 37.0 40.0 33.0 40.0 58-59 35.594750000000005 37.0 37.0 40.0 33.0 40.0 60-61 35.3985 37.0 37.0 38.5 33.0 40.0 62-63 35.064750000000004 37.0 35.0 37.0 33.0 40.0 64-65 34.804500000000004 37.0 33.0 37.0 30.0 40.0 66-67 34.399875 37.0 33.0 37.0 27.0 40.0 68-69 34.157125 37.0 33.0 37.0 27.0 40.0 70-71 33.975624999999994 37.0 33.0 37.0 27.0 38.5 72-73 33.626875 37.0 33.0 37.0 27.0 37.0 74-75 33.174499999999995 37.0 33.0 37.0 27.0 37.0 76-77 30.40975 33.0 30.0 35.0 22.0 37.0 78-79 32.28975 35.0 33.0 37.0 22.0 37.0 80-81 32.339625 37.0 33.0 37.0 22.0 37.0 82-83 32.397999999999996 37.0 33.0 37.0 22.0 37.0 84-85 32.367999999999995 37.0 33.0 37.0 22.0 37.0 86-87 32.344 37.0 33.0 37.0 22.0 37.0 88-89 32.060500000000005 37.0 33.0 37.0 22.0 37.0 90-91 32.015 37.0 33.0 37.0 22.0 37.0 92-93 31.743000000000002 37.0 33.0 37.0 18.5 37.0 94-95 31.564875 37.0 33.0 37.0 15.0 37.0 96-97 31.304499999999997 37.0 33.0 37.0 8.5 37.0 98-99 30.9565 37.0 33.0 37.0 2.0 37.0 100 27.341 33.0 27.0 33.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 4.0 10 6.0 11 4.0 12 7.0 13 4.0 14 14.0 15 9.0 16 10.0 17 11.0 18 16.0 19 14.0 20 15.0 21 20.0 22 17.0 23 17.0 24 31.0 25 24.0 26 27.0 27 30.0 28 32.0 29 52.0 30 63.0 31 85.0 32 105.0 33 151.0 34 179.0 35 290.0 36 628.0 37 1336.0 38 798.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.18465836931674 10.31242062484125 8.58521717043434 51.91770383540767 2 23.05 15.65 38.675 22.625 3 21.175 20.125 24.275 34.425 4 27.55 28.425 18.825 25.2 5 26.5 30.025000000000002 22.75 20.724999999999998 6 22.2 31.874999999999996 24.075 21.85 7 17.675 19.725 40.875 21.725 8 21.125 19.225 28.999999999999996 30.65 9 22.425 18.625 31.525 27.425 10-11 24.6875 28.262500000000003 20.575 26.474999999999998 12-13 24.025 20.525 26.325 29.125 14-15 23.2625 23.962500000000002 25.5375 27.237499999999997 16-17 24.3 22.8625 24.525 28.3125 18-19 24.8625 23.2125 25.324999999999996 26.6 20-21 25.775 23.75 24.75 25.724999999999998 22-23 25.0625 22.7625 25.6 26.575 24-25 24.2 23.0375 25.137500000000003 27.625 26-27 23.325000000000003 22.35 26.5375 27.787499999999998 28-29 25.275 23.200000000000003 25.7 25.825 30-31 23.775 22.237499999999997 26.3125 27.675 32-33 23.925 23.45 25.5125 27.1125 34-35 24.1125 23.599999999999998 24.4875 27.800000000000004 36-37 24.8625 23.575 25.25 26.3125 38-39 24.5125 22.45 25.362499999999997 27.675 40-41 25.362499999999997 23.425 23.7375 27.474999999999998 42-43 24.7875 22.650000000000002 25.6 26.9625 44-45 24.087500000000002 23.400000000000002 25.15 27.3625 46-47 24.887500000000003 23.45 24.837500000000002 26.825 48-49 24.175 22.6875 25.85 27.287499999999998 50-51 23.525 23.6125 24.9375 27.925 52-53 24.45 23.8375 24.6125 27.1 54-55 24.3875 22.875 25.1875 27.55 56-57 24.5375 22.075 26.3 27.0875 58-59 24.087500000000002 23.6625 24.525 27.725 60-61 24.837500000000002 22.7125 25.2 27.250000000000004 62-63 24.0375 22.787499999999998 25.724999999999998 27.450000000000003 64-65 24.25 23.1 25.162499999999998 27.487499999999997 66-67 24.6875 22.25 25.1 27.962500000000002 68-69 24.6125 23.35 24.65 27.3875 70-71 24.9875 22.8125 24.75 27.450000000000003 72-73 25.4625 23.025000000000002 23.95 27.5625 74-75 24.0375 22.7375 26.1125 27.1125 76-77 25.2 23.1625 24.2625 27.375 78-79 24.875 24.025 24.224999999999998 26.875 80-81 24.875 23.799999999999997 25.324999999999996 26.0 82-83 24.9 23.375 24.15 27.575 84-85 25.775 23.175 22.975 28.075 86-87 25.0375 22.6875 25.5375 26.737499999999997 88-89 25.8125 23.0875 24.2 26.900000000000002 90-91 25.25 22.7625 24.4875 27.500000000000004 92-93 25.1 23.175 25.074999999999996 26.650000000000002 94-95 24.675 24.25 23.8625 27.212500000000002 96-97 24.837500000000002 23.9875 23.7625 27.4125 98-99 25.587500000000002 23.200000000000003 24.425 26.787499999999998 100 26.375 22.825 21.975 28.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.0 26 0.5 27 1.0 28 1.0 29 4.5 30 11.0 31 11.5 32 9.5 33 13.0 34 21.0 35 29.0 36 46.0 37 49.0 38 52.0 39 65.5 40 69.5 41 81.5 42 99.0 43 115.5 44 117.0 45 114.0 46 127.5 47 143.5 48 152.0 49 165.5 50 176.0 51 171.5 52 166.5 53 180.5 54 178.5 55 173.0 56 166.0 57 165.5 58 158.5 59 132.5 60 127.5 61 111.0 62 84.0 63 66.0 64 63.5 65 60.5 66 46.5 67 43.5 68 43.0 69 31.0 70 30.5 71 30.5 72 21.0 73 17.0 74 14.5 75 10.5 76 9.0 77 6.5 78 4.5 79 2.5 80 0.5 81 1.0 82 2.0 83 2.0 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.075 #Duplication Level Percentage of deduplicated Percentage of total 1 91.58012910468706 81.575 2 5.893909626719057 10.5 3 1.655907942744878 4.425 4 0.6174571989896155 2.1999999999999997 5 0.16839741790625876 0.75 6 0.028066236317709797 0.15 7 0.028066236317709797 0.17500000000000002 8 0.0 0.0 9 0.028066236317709797 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCAGCTAGCT 9 0.22499999999999998 No Hit CAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACTAGG 7 0.17500000000000002 No Hit CCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCA 6 0.15 No Hit CTCATCTTGGGGTGGGCTTACTACTTATATGCTTTCAGCAGTTATCCTCT 5 0.125 No Hit CTTTCGGCTAACCTAGCCTCCTCCGTCCCTCCGTACCAACAAGGGGTAGT 5 0.125 No Hit CCGGAACCCAAAGACTTTGATTTCTCATAAGGTGCCGGCGGAGTCCTATA 5 0.125 No Hit CGGGGAACAGTCGCATGACGAGGCAGTTTCCAGAAACGTGTATCACATCT 5 0.125 No Hit CACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTT 5 0.125 No Hit CTCAAATTTCGCACTGACCATAATGTGATCCCTTCCGGCGGTCGGTATAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.45 0.0 0.0 0.0 0.0 80-81 0.7 0.0 0.0 0.0 0.0 82-83 0.925 0.0 0.0 0.0 0.0 84-85 1.2374999999999998 0.0 0.0 0.0 0.0 86-87 1.5750000000000002 0.0 0.0 0.0 0.0 88 1.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6127940 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6127940_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.08575 33.0 33.0 33.0 33.0 33.0 2 32.21425 33.0 33.0 33.0 33.0 33.0 3 32.27025 33.0 33.0 33.0 33.0 33.0 4 35.8085 37.0 37.0 37.0 33.0 37.0 5 35.78825 37.0 37.0 37.0 33.0 37.0 6 35.734 37.0 37.0 37.0 33.0 37.0 7 35.7765 37.0 37.0 37.0 33.0 37.0 8 35.90325 37.0 37.0 37.0 37.0 37.0 9 36.17225 37.0 37.0 37.0 37.0 37.0 10-11 36.196875000000006 37.0 37.0 37.0 37.0 37.0 12-13 36.149125 37.0 37.0 37.0 37.0 37.0 14-15 38.39375 40.0 37.0 40.0 37.0 40.0 16-17 38.367625000000004 40.0 37.0 40.0 37.0 40.0 18-19 38.387625 40.0 37.0 40.0 37.0 40.0 20-21 38.356375 40.0 37.0 40.0 37.0 40.0 22-23 37.599125 40.0 37.0 40.0 33.0 40.0 24-25 38.095749999999995 40.0 37.0 40.0 35.0 40.0 26-27 38.159875 40.0 37.0 40.0 37.0 40.0 28-29 38.147875 40.0 37.0 40.0 37.0 40.0 30-31 38.087 40.0 37.0 40.0 37.0 40.0 32-33 37.905249999999995 40.0 37.0 40.0 35.0 40.0 34-35 37.935 40.0 37.0 40.0 37.0 40.0 36-37 37.75275 40.0 37.0 40.0 33.0 40.0 38-39 37.610625 40.0 37.0 40.0 33.0 40.0 40-41 37.501625000000004 40.0 37.0 40.0 33.0 40.0 42-43 37.37175 40.0 37.0 40.0 33.0 40.0 44-45 37.107375000000005 40.0 37.0 40.0 33.0 40.0 46-47 36.976875 40.0 37.0 40.0 33.0 40.0 48-49 36.71975 37.0 37.0 40.0 33.0 40.0 50-51 34.93825 37.0 35.0 38.5 30.0 38.5 52-53 35.237625 37.0 35.0 38.5 30.0 40.0 54-55 35.943375 37.0 37.0 40.0 33.0 40.0 56-57 35.81575 37.0 37.0 40.0 33.0 40.0 58-59 35.625 37.0 37.0 40.0 33.0 40.0 60-61 35.28125 37.0 37.0 37.0 33.0 40.0 62-63 35.17175 37.0 37.0 37.0 33.0 40.0 64-65 34.933625 37.0 33.0 37.0 33.0 40.0 66-67 34.748125 37.0 33.0 37.0 33.0 40.0 68-69 34.429125 37.0 33.0 37.0 27.0 40.0 70-71 34.354749999999996 37.0 33.0 37.0 27.0 37.0 72-73 34.12425 37.0 33.0 37.0 27.0 37.0 74-75 33.941 37.0 33.0 37.0 27.0 37.0 76-77 33.692750000000004 37.0 33.0 37.0 27.0 37.0 78-79 33.33225 37.0 33.0 37.0 27.0 37.0 80-81 33.256625 37.0 33.0 37.0 27.0 37.0 82-83 33.18825 37.0 33.0 37.0 27.0 37.0 84-85 33.2695 37.0 33.0 37.0 27.0 37.0 86-87 33.1415 37.0 33.0 37.0 27.0 37.0 88-89 32.9775 37.0 33.0 37.0 27.0 37.0 90-91 32.943875000000006 37.0 33.0 37.0 27.0 37.0 92-93 32.7505 37.0 33.0 37.0 27.0 37.0 94-95 32.682249999999996 37.0 33.0 37.0 27.0 37.0 96-97 32.346000000000004 37.0 33.0 37.0 22.0 37.0 98-99 32.2505 37.0 33.0 37.0 22.0 37.0 100-101 30.513125 35.0 30.0 37.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 3.0 4 2.0 5 3.0 6 3.0 7 7.0 8 0.0 9 4.0 10 6.0 11 7.0 12 7.0 13 2.0 14 7.0 15 7.0 16 5.0 17 6.0 18 10.0 19 9.0 20 8.0 21 7.0 22 21.0 23 8.0 24 25.0 25 17.0 26 22.0 27 37.0 28 35.0 29 43.0 30 53.0 31 77.0 32 99.0 33 126.0 34 192.0 35 243.0 36 580.0 37 1556.0 38 737.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.775 13.900000000000002 9.725 44.6 2 30.0 19.825 31.075000000000003 19.1 3 23.799999999999997 25.224999999999998 25.15 25.825 4 28.849999999999998 29.525000000000002 18.2 23.425 5 30.099999999999998 32.225 18.025 19.650000000000002 6 23.225 35.675000000000004 18.275 22.825 7 22.5 16.175 34.525 26.8 8 23.425 21.525 24.55 30.5 9 26.424999999999997 21.349999999999998 25.3 26.924999999999997 10-11 28.3625 27.775 18.4375 25.424999999999997 12-13 28.3875 21.6875 21.9625 27.962500000000002 14-15 25.474999999999998 25.7875 23.9875 24.75 16-17 27.8875 24.099999999999998 22.6375 25.374999999999996 18-19 28.000000000000004 24.425 22.2 25.374999999999996 20-21 27.581895473868467 24.60615153788447 23.005751437859466 24.8062015503876 22-23 26.35 24.9 23.325000000000003 25.424999999999997 24-25 27.603450431303912 25.2281535191899 22.190273784223027 24.978122265283158 26-27 26.875 24.4375 23.025000000000002 25.662499999999998 28-29 27.474999999999998 25.624999999999996 22.35 24.55 30-31 27.0625 25.4 22.4625 25.074999999999996 32-33 27.05 25.8125 22.4625 24.675 34-35 27.474999999999998 25.5375 22.625 24.3625 36-37 27.237499999999997 25.4 22.275 25.087500000000002 38-39 27.3 24.4 23.45 24.85 40-41 28.299999999999997 24.6625 22.6 24.4375 42-43 27.1 25.0375 22.725 25.137500000000003 44-45 26.5 24.525 23.724999999999998 25.25 46-47 27.975 25.624999999999996 21.775 24.625 48-49 27.575 24.725 22.075 25.624999999999996 50-51 27.5625 24.5625 22.9625 24.9125 52-53 27.6375 24.95 23.075000000000003 24.337500000000002 54-55 28.325 24.7 22.412499999999998 24.5625 56-57 27.125 25.75 22.900000000000002 24.224999999999998 58-59 27.5125 24.7375 23.1625 24.587500000000002 60-61 27.8375 23.7875 23.2625 25.112499999999997 62-63 27.9375 24.125 23.5625 24.375 64-65 26.387500000000003 26.125 22.85 24.637500000000003 66-67 27.6875 24.95 22.5 24.8625 68-69 27.203400425053132 24.82810351293912 22.940367545943243 25.028128516064506 70-71 26.424999999999997 24.6625 23.4125 25.5 72-73 27.11588948618577 24.54056757094637 23.27790973871734 25.065633204150515 74-75 27.237499999999997 24.9 23.825 24.0375 76-77 28.0625 23.799999999999997 22.8875 25.25 78-79 27.981995498874717 23.918479619904975 23.36834208552138 24.731182795698924 80-81 26.9625 25.4 23.0875 24.55 82-83 27.981995498874717 25.49387346836709 22.005501375343837 24.518629657414355 84-85 27.301150575287643 24.537268634317158 22.67383691845923 25.48774387193597 86-87 27.815976997124643 25.103137892236532 22.977872234029252 24.103012876609576 88-89 27.825 24.962500000000002 22.2125 25.0 90-91 27.975 24.8625 22.875 24.2875 92-93 27.987499999999997 25.5625 22.5 23.95 94-95 28.1 25.9875 22.0 23.9125 96-97 28.349999999999998 25.624999999999996 22.3875 23.6375 98-99 27.474999999999998 25.5375 22.537499999999998 24.45 100-101 29.275000000000002 25.662499999999998 22.6125 22.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.0 27 0.5 28 2.5 29 3.5 30 4.0 31 8.5 32 14.0 33 18.5 34 22.0 35 28.5 36 34.0 37 42.5 38 52.5 39 68.5 40 76.0 41 70.0 42 84.0 43 100.0 44 106.5 45 114.0 46 131.5 47 152.0 48 148.0 49 147.5 50 144.5 51 148.5 52 159.0 53 156.5 54 183.5 55 201.0 56 187.0 57 173.5 58 157.0 59 144.0 60 128.0 61 109.0 62 103.5 63 89.0 64 73.5 65 55.5 66 47.0 67 60.0 68 58.0 69 43.0 70 37.0 71 34.0 72 24.0 73 15.0 74 11.0 75 8.0 76 5.0 77 4.0 78 3.0 79 2.0 80 1.5 81 1.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.025 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.0125 74-75 0.0 76-77 0.0 78-79 0.025 80-81 0.0 82-83 0.025 84-85 0.05 86-87 0.0125 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.2 #Duplication Level Percentage of deduplicated Percentage of total 1 92.79057017543859 84.625 2 5.509868421052631 10.05 3 1.2335526315789473 3.375 4 0.356359649122807 1.3 5 0.05482456140350877 0.25 6 0.027412280701754384 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027412280701754384 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 10 0.25 No Hit CGAATAGCTCGTAACCAAACATGCACAGCGGTCAAACAGTATGTCCCAAG 6 0.15 No Hit CTTGCGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGCAAGCG 5 0.125 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.6499999999999999 0.0 0.0 0.0 0.0 82-83 0.875 0.0 0.0 0.0 0.0 84-85 1.2 0.0 0.0 0.0 0.0 86-87 1.5375 0.0 0.0 0.0 0.0 88-89 2.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1879117 spots for SRR6127940.sra Written 1879117 spots for SRR6127940.sra Read 1879117 spots for SRR6127940.sra Written 1879117 spots for SRR6127940.sra Read 1879117 spots for SRR6127940.sra Written 1879117 spots for SRR6127940.sra Read 1879117 spots for SRR6127940.sra Written 1879117 spots for SRR6127940.sra Read 1879117 spots for SRR6127940.sra Written 1879117 spots for SRR6127940.sra Read 1879117 spots for SRR6127940.sra Written 1879117 spots for SRR6127940.sra Read 1879117 spots for SRR6127940.sra Written 1879117 spots for SRR6127940.sra Read 1879117 spots for SRR6127940.sra Written 1879117 spots for SRR6127940.sra Read 1879126 spots for SRR6127940.sra Written 1879126 spots for SRR6127940.sra Read 1879117 spots for SRR6127940.sra Written 1879117 spots for SRR6127940.sra Read 1879117 spots for SRR6127940.sra Written 1879117 spots for SRR6127940.sra Read 1879117 spots for SRR6127940.sra Written 1879117 spots for SRR6127940.sra Read 1879117 spots for SRR6127940.sra Written 1879117 spots for SRR6127940.sra Read 1879117 spots for SRR6127940.sra Written 1879117 spots for SRR6127940.sra Read 1879117 spots for SRR6127940.sra Written 1879117 spots for SRR6127940.sra Read 1879117 spots for SRR6127940.sra Written 1879117 spots for SRR6127940.sra Read 1879117 spots for SRR6127940.sra Written 1879117 spots for SRR6127940.sra Read 1879117 spots for SRR6127940.sra Written 1879117 spots for SRR6127940.sra Read 1879117 spots for SRR6127940.sra Written 1879117 spots for SRR6127940.sra Read 1879117 spots for SRR6127940.sra Written 1879117 spots for SRR6127940.sra SRR ids: ['SRR6127940.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rvq59okm SRR6127940.sra spots: 37582349 blocks: [[1, 1879117], [1879118, 3758234], [3758235, 5637351], [5637352, 7516468], [7516469, 9395585], [9395586, 11274702], [11274703, 13153819], [13153820, 15032936], [15032937, 16912053], [16912054, 18791170], [18791171, 20670287], [20670288, 22549404], [22549405, 24428521], [24428522, 26307638], [26307639, 28186755], [28186756, 30065872], [30065873, 31944989], [31944990, 33824106], [33824107, 35703223], [35703224, 37582349]] SRR6127940 file size 8970170 SRR6127940 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6127940 SRR6127940_1.fastq SRR6127940_2.fastq Input file: SRR6127940_1.fastq Paired file: SRR6127940_2.fastq trimmed: SRR6127940-trimmed-pair1.fastq, SRR6127940-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 04:31:12 2024 >> started Tue Dec 10 04:31:52 2024 >> done (40.166s) 37582349 read pairs processed; of these: 148752 ( 0.40%) short read pairs filtered out after trimming by size control 198545 ( 0.53%) empty read pairs filtered out after trimming by size control 37235052 (99.08%) read pairs available; of these: 7893601 (21.20%) trimmed read pairs available after processing 29341451 (78.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 31 0.00% 19 24 0.00% 20 56 0.00% 21 111 0.00% 22 180 0.00% 23 250 0.00% 24 339 0.00% 25 421 0.00% 26 500 0.00% 27 691 0.00% 28 799 0.00% 29 990 0.00% 30 1187 0.00% 31 1400 0.00% 32 1654 0.00% 33 1906 0.01% 34 2127 0.01% 35 2548 0.01% 36 2873 0.01% 37 3120 0.01% 38 3379 0.01% 39 3761 0.01% 40 4116 0.01% 41 4692 0.01% 42 5298 0.01% 43 5696 0.02% 44 6288 0.02% 45 6787 0.02% 46 7652 0.02% 47 8180 0.02% 48 8804 0.02% 49 9346 0.03% 50 10143 0.03% 51 10746 0.03% 52 11603 0.03% 53 12972 0.03% 54 13610 0.04% 55 15126 0.04% 56 16197 0.04% 57 17903 0.05% 58 19329 0.05% 59 34204 0.09% 60 35414 0.10% 61 37686 0.10% 62 45725 0.12% 63 46037 0.12% 64 51867 0.14% 65 56773 0.15% 66 54928 0.15% 67 56527 0.15% 68 60141 0.16% 69 71090 0.19% 70 70777 0.19% 71 73799 0.20% 72 78981 0.21% 73 77350 0.21% 74 83332 0.22% 75 80791 0.22% 76 81403 0.22% 77 83242 0.22% 78 90620 0.24% 79 95315 0.26% 80 105701 0.28% 81 110014 0.30% 82 120490 0.32% 83 126375 0.34% 84 139886 0.38% 85 159065 0.43% 86 178910 0.48% 87 178649 0.48% 88 182680 0.49% 89 183666 0.49% 90 215637 0.58% 91 217734 0.58% 92 239100 0.64% 93 267541 0.72% 94 293459 0.79% 95 338128 0.91% 96 402893 1.08% 97 495426 1.33% 98 620161 1.67% 99 777102 2.09% 100 30293598 81.36% 37235052 reads passed initial QC criterion=sequence-density sequence-density=1.00 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=29 prefix-density=0.98 prefix-fanout=2.0 sequence=TTCGCTATCGGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=24.78 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=1.1 sequence=CGCGTGAGCAGCTCGAGCAATCCGCCGACAGCCGACGGGTTTGGGGCCGGGACCCCCGAGCCCAGTCCTCAGAGCCAATCCTTTTCCCGAAGTTACGGATCCGTTTTGCCGACTTCCCTTGCCTACATTGTTCCATTGGCCAGAGGCTGTTCACCTTGGAGACCTGATGCGGTTATGAGTACGACCGGGCGTGAACGGTACTCGGTCCTCCGGATTTTCATGGGCCGCCGGGGGCGCACCGGACACCGCGCGACGTGCGGTGCTCTTCCGGCCACTGGACCCTACCTCCGGCTGAACCGATTCCAGGGTTGGCAGGCCGTTAAGCAGAAAAGATAACTCTTCCCGAGGCCCCCGCCGGCGTCTCCGGACTTCCTAACGTCGCCGTCAACCGCCACATCCCGGCTCGGGAAATCTTAACCCGATTCCCTTTCGGGGGATACGCGTGATCGCGCTATCTGCCGGGGTTACCCCGTCCCTTAGGATCGGCTTACCCATGTGCAAGTGCCGTTCA criterion=sequence-density sequence-density=1.18 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=18 prefix-density=1.18 prefix-fanout=2.1 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.19 sequence-density-rank=27 fanout-score=6.03 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=1.8 sequence=CTCCAAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGGAAGCCGGGTTACGGTGCCCAACTGCGCGCTAACCTAGAACCCACAAAGGGTGTTGGTCGATTAAGACAGCAGGACGGTGGTCATGGAAGTCGAAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCCGAAAATGGATGGCGCTAAAGCGCGCGACCCACACCCGGCCATCTGGGCGAGCGCCATGCCCCGATGAGTAGGAGGGCGCGGCGGCCGCTGCAAAACCCGGGGCGCGAGCCCGGGCGGAGCGGCCGTCGGTGCAGATCTTGGTGGTAGTAGCAAATATTCAAATGAGAACTTTGAAGGCCGAAGAGGAGAAAGGTTCCATGTGAACGGCACTTGCACATGGGTAAGCCGATCCTAAGGGACGGGGTAACCCCGGCAGATAGCGCGATCACGCGTATCCCCCGAAAGGGAATCGGGTTAAGATTTCCCGAGCCGGGATG SRR6127940 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 04:32:38 Started mapping on | Dec 10 04:32:38 Finished on | Dec 10 04:47:19 Mapping speed, Million of reads per hour | 152.15 Number of input reads | 37235052 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 19451153 Uniquely mapped reads % | 52.24% Average mapped length | 196.04 Number of splices: Total | 11339235 Number of splices: Annotated (sjdb) | 10784333 Number of splices: GT/AG | 11181745 Number of splices: GC/AG | 134089 Number of splices: AT/AC | 3462 Number of splices: Non-canonical | 19939 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.28 Insertion rate per base | 0.02% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 5372713 % of reads mapped to multiple loci | 14.43% Number of reads mapped to too many loci | 957023 % of reads mapped to too many loci | 2.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 18.34% % of reads unmapped: other | 12.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 12424585 12424585 12424585 N_multimapping 5372713 5372713 5372713 N_noFeature 2337600 18952468 2474781 N_ambiguous 431087 1668 72232 UnstrandedReadsAssigned:16682466 PositiveStrandReadsAssigned:497017 NegativeStrandReadsAssigned:16904140 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR6127940 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6127940-trimmed-pair1.fastq SRR6127940-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,235,052 reads, 17,911,397 reads pseudoaligned [quant] estimated average fragment length: 161.735 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52973 SRR6127940.ke.tsv 35125 SRR6127940.se.tsv 88098 total ==> SRR6127940.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 775.473 0 0 PNS24247 1044 883.265 24.3479 1.82324 PNS24249 1928 1767.26 52.814 1.9766 PNS24246 1044 883.265 24.3479 1.82324 PNS24248 1044 883.265 24.3479 1.82324 PNS24244 1471 1310.26 50.1422 2.53114 PNS24243 293 139.649 1 0.473626 KQK14069 1603 1442.26 2610.89 119.733 KQK14071 474 314.786 167.569 35.2086 ==> SRR6127940.se.tsv <== BRADI_1g14170v3 3198 BRADI_1g53295v3 406 BRADI_1g59795v3 108 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 282 BRADI_1g74790v3 76 BRADI_1g09890v3 3 BRADI_1g77505v3 229 BRADI_1g48960v3 0 SRR6127940 completed mapping pipeline successfully