Starting /dee2/code/volunteer_pipeline.sh SRR6127942 current disk space = 1526191644672 free memory = 1427342248 SRR6127942 SRAfilesize 86dd2ba9027eab0eb732198feb67c9ce SRR6127942.sra SRR6127942.sra file validated SRR6127942 is paired end SRR6127942 is conventional basespace SRR6127942 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6127942_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.46575 33.0 33.0 33.0 33.0 33.0 2 32.546 33.0 33.0 33.0 33.0 33.0 3 32.77125 33.0 33.0 33.0 33.0 33.0 4 36.71575 37.0 37.0 37.0 37.0 37.0 5 36.68325 37.0 37.0 37.0 37.0 37.0 6 36.66075 37.0 37.0 37.0 37.0 37.0 7 36.60875 37.0 37.0 37.0 37.0 37.0 8 36.66975 37.0 37.0 37.0 37.0 37.0 9 36.706 37.0 37.0 37.0 37.0 37.0 10-11 36.67975 37.0 37.0 37.0 37.0 37.0 12-13 36.622625 37.0 37.0 37.0 37.0 37.0 14-15 38.92475 40.0 40.0 40.0 37.0 40.0 16-17 38.979749999999996 40.0 40.0 40.0 37.0 40.0 18-19 38.92675 40.0 40.0 40.0 37.0 40.0 20-21 38.903875 40.0 40.0 40.0 37.0 40.0 22-23 38.768 40.0 40.0 40.0 37.0 40.0 24-25 38.726875 40.0 37.0 40.0 37.0 40.0 26-27 38.637 40.0 37.0 40.0 37.0 40.0 28-29 38.664874999999995 40.0 37.0 40.0 37.0 40.0 30-31 38.59125 40.0 37.0 40.0 37.0 40.0 32-33 38.53212499999999 40.0 37.0 40.0 37.0 40.0 34-35 38.388000000000005 40.0 37.0 40.0 37.0 40.0 36-37 38.391125 40.0 37.0 40.0 37.0 40.0 38-39 38.09975 40.0 37.0 40.0 37.0 40.0 40-41 37.9975 40.0 37.0 40.0 35.0 40.0 42-43 37.74025 40.0 37.0 40.0 33.0 40.0 44-45 37.667874999999995 40.0 37.0 40.0 33.0 40.0 46-47 37.434 40.0 37.0 40.0 33.0 40.0 48-49 37.394375 40.0 37.0 40.0 33.0 40.0 50-51 37.17575 40.0 37.0 40.0 33.0 40.0 52-53 36.9905 38.5 37.0 40.0 33.0 40.0 54-55 36.51925 37.0 37.0 40.0 33.0 40.0 56-57 36.424875 37.0 37.0 40.0 33.0 40.0 58-59 36.152 37.0 37.0 40.0 33.0 40.0 60-61 35.877875 37.0 37.0 40.0 33.0 40.0 62-63 35.653125 37.0 37.0 40.0 33.0 40.0 64-65 35.434375 37.0 37.0 38.5 33.0 40.0 66-67 35.00775 37.0 33.0 37.0 27.0 40.0 68-69 34.865624999999994 37.0 33.0 37.0 30.0 40.0 70-71 34.655875 37.0 33.0 37.0 30.0 40.0 72-73 34.443124999999995 37.0 33.0 37.0 27.0 38.5 74-75 33.996875 37.0 33.0 37.0 27.0 37.0 76-77 31.1505 33.0 30.0 35.0 24.5 37.0 78-79 33.06225 37.0 33.0 37.0 27.0 37.0 80-81 33.245125 37.0 33.0 37.0 27.0 37.0 82-83 33.34887500000001 37.0 33.0 37.0 27.0 37.0 84-85 33.288125 37.0 33.0 37.0 27.0 37.0 86-87 33.20325 37.0 33.0 37.0 27.0 37.0 88-89 32.937 37.0 33.0 37.0 27.0 37.0 90-91 32.874125 37.0 33.0 37.0 27.0 37.0 92-93 32.588625 37.0 33.0 37.0 24.5 37.0 94-95 32.5865 37.0 33.0 37.0 24.5 37.0 96-97 32.337875 37.0 33.0 37.0 24.5 37.0 98-99 31.87875 37.0 33.0 37.0 22.0 37.0 100 28.2245 33.0 27.0 33.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 3.0 10 5.0 11 2.0 12 4.0 13 5.0 14 9.0 15 7.0 16 6.0 17 6.0 18 5.0 19 3.0 20 8.0 21 13.0 22 20.0 23 16.0 24 13.0 25 19.0 26 28.0 27 32.0 28 37.0 29 40.0 30 67.0 31 90.0 32 107.0 33 138.0 34 171.0 35 260.0 36 561.0 37 1337.0 38 987.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.82828282828283 12.272727272727273 8.358585858585858 41.54040404040404 2 25.3 16.425 35.699999999999996 22.575 3 21.875 20.95 24.525 32.65 4 26.6 29.175 21.075 23.150000000000002 5 27.0 31.474999999999998 22.7 18.825 6 21.925 32.85 24.425 20.8 7 17.424999999999997 19.925 41.625 21.025 8 20.95 21.125 28.475 29.45 9 21.275 20.575 32.975 25.174999999999997 10-11 25.424999999999997 29.049999999999997 21.0375 24.4875 12-13 23.7125 22.7125 26.424999999999997 27.150000000000002 14-15 23.2125 25.387500000000003 26.0625 25.337500000000002 16-17 24.025 23.775 25.5375 26.6625 18-19 24.4875 24.425 25.112499999999997 25.974999999999998 20-21 24.099999999999998 24.075 26.0375 25.7875 22-23 24.75 24.4125 25.324999999999996 25.5125 24-25 24.5 24.4 25.2125 25.887500000000003 26-27 24.087500000000002 25.0625 25.637500000000003 25.2125 28-29 24.224999999999998 24.712500000000002 26.075 24.9875 30-31 23.625 24.5125 25.6125 26.25 32-33 24.2625 24.675 25.3 25.7625 34-35 23.9375 23.75 25.837500000000002 26.474999999999998 36-37 23.5625 24.9375 25.5625 25.937500000000004 38-39 24.4875 24.224999999999998 25.4625 25.825 40-41 25.387500000000003 24.2 24.837500000000002 25.575 42-43 24.3 25.587500000000002 25.6 24.5125 44-45 24.462500000000002 24.325 25.124999999999996 26.087500000000002 46-47 25.3 25.687500000000004 24.375 24.637500000000003 48-49 25.674999999999997 24.2375 24.9375 25.15 50-51 24.5 24.6875 25.35 25.4625 52-53 25.05 24.4375 24.7875 25.724999999999998 54-55 24.6625 24.4875 25.2625 25.587500000000002 56-57 24.375 25.2125 24.4875 25.924999999999997 58-59 24.9375 25.162499999999998 24.25 25.650000000000002 60-61 24.3875 23.9125 25.2375 26.4625 62-63 24.5625 24.587500000000002 25.412499999999998 25.4375 64-65 24.125 24.975 24.9875 25.912499999999998 66-67 24.275 24.025 25.387500000000003 26.3125 68-69 24.1125 24.45 24.975 26.4625 70-71 25.7125 24.3875 24.7 25.2 72-73 24.8 24.4125 24.3 26.487500000000004 74-75 25.2625 24.212500000000002 24.762500000000003 25.7625 76-77 24.75 24.3625 25.4 25.4875 78-79 23.9125 24.3125 25.2 26.575 80-81 24.6 24.7375 25.224999999999998 25.4375 82-83 24.7375 24.025 24.625 26.6125 84-85 24.9 24.0125 24.712500000000002 26.375 86-87 25.2 24.4 25.087500000000002 25.3125 88-89 25.525 25.0625 24.3125 25.1 90-91 25.387500000000003 24.4125 24.125 26.075 92-93 24.1375 25.424999999999997 25.4875 24.95 94-95 24.825 24.2375 24.9375 26.0 96-97 25.2 24.9875 23.849999999999998 25.9625 98-99 25.4625 24.1375 24.5125 25.887500000000003 100 25.575 25.775 22.325 26.325 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.5 26 2.5 27 4.0 28 4.0 29 5.0 30 8.0 31 11.5 32 18.0 33 30.0 34 37.5 35 40.5 36 55.5 37 70.5 38 74.5 39 87.0 40 100.5 41 104.5 42 126.5 43 139.5 44 148.0 45 161.5 46 170.0 47 178.5 48 177.5 49 166.5 50 146.0 51 142.0 52 155.5 53 155.5 54 120.0 55 114.5 56 118.5 57 111.0 58 114.5 59 108.5 60 108.5 61 93.5 62 74.5 63 68.5 64 72.0 65 69.0 66 57.0 67 48.0 68 40.0 69 37.0 70 29.0 71 21.0 72 18.0 73 13.0 74 11.5 75 10.5 76 7.5 77 3.0 78 1.5 79 1.5 80 0.5 81 1.0 82 2.5 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.425 #Duplication Level Percentage of deduplicated Percentage of total 1 93.82007109652722 85.775 2 4.238446814328685 7.75 3 1.1211375444353295 3.075 4 0.5195515449822259 1.9 5 0.2461033634126333 1.125 6 0.027344818156959255 0.15 7 0.0 0.0 8 0.0 0.0 9 0.027344818156959255 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGATTTCATGAATGCGATTTCTGATATGGCGGCGGTCGGTTTCCAGTT 9 0.22499999999999998 No Hit CCGGGATCGGGCAAAGGGGCAACTCGAGCTAATCTCCCCAGCGGCTAGCA 6 0.15 No Hit ATCACATCTAGGCATGGAATCTTATGCCAGCTAACGGAACAAGCTTTGTG 5 0.125 No Hit GTTTGTATAGCCGACAAGCGCAATTTGAAGCACACCGTTTTTCTTTCTTC 5 0.125 No Hit GTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGA 5 0.125 No Hit CTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGT 5 0.125 No Hit GAAAAAGGTAAATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAATC 5 0.125 No Hit GCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGA 5 0.125 No Hit CTTTGGTATAGTTGGGATTTTAATATCATTAATAGCATGATGGTGATTGT 5 0.125 No Hit GGGGAACAGTCGCATGACGAGGCAGTTTCCAGAAACGTGTATCACATCTA 5 0.125 No Hit GCGGGACCTCTGAGAATTGGGATACAGGACCCAAAAGGCTGAAAGGGGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.23750000000000002 0.0 0.0 0.0 0.0 70-71 0.3125 0.0 0.0 0.0 0.0 72-73 0.3625 0.0 0.0 0.0 0.0 74-75 0.4125 0.0 0.0 0.0 0.0 76-77 0.5375000000000001 0.0 0.0 0.0 0.0 78-79 0.6 0.0 0.0 0.0 0.0 80-81 0.8 0.0 0.0 0.0 0.0 82-83 1.0 0.0 0.0 0.0 0.0 84-85 1.2625000000000002 0.0 0.0 0.0 0.0 86-87 1.45 0.0 0.0 0.0 0.0 88 1.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6127942 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6127942_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.85225 33.0 33.0 33.0 33.0 33.0 2 32.0475 33.0 33.0 33.0 33.0 33.0 3 32.04375 33.0 33.0 33.0 33.0 33.0 4 35.585 37.0 37.0 37.0 33.0 37.0 5 35.61925 37.0 37.0 37.0 33.0 37.0 6 35.48825 37.0 37.0 37.0 33.0 37.0 7 35.56375 37.0 37.0 37.0 33.0 37.0 8 35.70875 37.0 37.0 37.0 33.0 37.0 9 35.98025 37.0 37.0 37.0 37.0 37.0 10-11 36.036625 37.0 37.0 37.0 37.0 37.0 12-13 35.985125 37.0 37.0 37.0 37.0 37.0 14-15 38.21425 40.0 38.5 40.0 37.0 40.0 16-17 38.171375 40.0 37.0 40.0 37.0 40.0 18-19 38.183875 40.0 38.5 40.0 37.0 40.0 20-21 38.174625 40.0 37.0 40.0 37.0 40.0 22-23 37.445750000000004 40.0 37.0 40.0 33.0 40.0 24-25 37.8975 40.0 37.0 40.0 37.0 40.0 26-27 38.08425 40.0 37.0 40.0 37.0 40.0 28-29 37.995875 40.0 37.0 40.0 37.0 40.0 30-31 37.918875 40.0 37.0 40.0 37.0 40.0 32-33 37.768125 40.0 37.0 40.0 35.0 40.0 34-35 37.764624999999995 40.0 37.0 40.0 37.0 40.0 36-37 37.682625 40.0 37.0 40.0 33.0 40.0 38-39 37.518125 40.0 37.0 40.0 33.0 40.0 40-41 37.41175 40.0 37.0 40.0 33.0 40.0 42-43 37.318875 40.0 37.0 40.0 33.0 40.0 44-45 37.101124999999996 40.0 37.0 40.0 33.0 40.0 46-47 36.87025 40.0 37.0 40.0 33.0 40.0 48-49 36.762625 40.0 37.0 40.0 33.0 40.0 50-51 35.089 37.0 35.0 38.5 30.0 38.5 52-53 35.406625 37.0 35.0 38.5 33.0 40.0 54-55 36.085625 37.0 37.0 40.0 33.0 40.0 56-57 36.033625 37.0 37.0 40.0 33.0 40.0 58-59 35.893625 37.0 37.0 40.0 33.0 40.0 60-61 35.478875 37.0 37.0 40.0 33.0 40.0 62-63 35.33525 37.0 37.0 37.0 33.0 40.0 64-65 35.179500000000004 37.0 37.0 37.0 33.0 40.0 66-67 34.955625 37.0 37.0 37.0 33.0 40.0 68-69 34.71775 37.0 33.0 37.0 30.0 40.0 70-71 34.567 37.0 33.0 37.0 30.0 40.0 72-73 34.397999999999996 37.0 33.0 37.0 27.0 38.5 74-75 34.198499999999996 37.0 33.0 37.0 27.0 37.0 76-77 33.81975 37.0 33.0 37.0 27.0 37.0 78-79 33.458375000000004 37.0 33.0 37.0 27.0 37.0 80-81 33.363125 37.0 33.0 37.0 27.0 37.0 82-83 33.377 37.0 33.0 37.0 27.0 37.0 84-85 33.420874999999995 37.0 33.0 37.0 27.0 37.0 86-87 33.312 37.0 33.0 37.0 27.0 37.0 88-89 33.2295 37.0 33.0 37.0 27.0 37.0 90-91 33.170500000000004 37.0 33.0 37.0 27.0 37.0 92-93 32.977000000000004 37.0 33.0 37.0 27.0 37.0 94-95 32.80575 37.0 33.0 37.0 27.0 37.0 96-97 32.498000000000005 37.0 33.0 37.0 22.0 37.0 98-99 32.45975 37.0 33.0 37.0 22.0 37.0 100-101 30.72775 35.0 30.0 37.0 18.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 49.0 3 2.0 4 3.0 5 7.0 6 3.0 7 6.0 8 2.0 9 3.0 10 2.0 11 2.0 12 6.0 13 6.0 14 5.0 15 5.0 16 2.0 17 8.0 18 8.0 19 8.0 20 14.0 21 11.0 22 7.0 23 12.0 24 15.0 25 16.0 26 24.0 27 26.0 28 34.0 29 35.0 30 54.0 31 86.0 32 94.0 33 94.0 34 152.0 35 238.0 36 541.0 37 1467.0 38 952.0 39 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.775 16.225 10.625 37.375 2 30.225 22.35 28.95 18.475 3 22.2 25.45 25.45 26.900000000000002 4 26.575 33.775 17.675 21.975 5 27.625 31.924999999999997 18.775 21.675 6 22.175 35.025 19.8 23.0 7 21.075 17.0 36.325 25.6 8 23.025000000000002 22.0 23.025000000000002 31.95 9 24.075 21.275 26.224999999999998 28.425 10-11 25.924999999999997 26.937499999999996 20.25 26.887499999999996 12-13 25.55 22.9875 23.35 28.1125 14-15 24.9375 24.9875 24.3125 25.7625 16-17 26.62248343128673 25.75965987245217 23.17118919594848 24.446667500312618 18-19 26.103262907863485 25.84073009126141 22.890361295161895 25.165645705713214 20-21 26.21310655327664 24.487243621810904 23.799399699849925 25.50025012506253 22-23 25.5375 26.125 23.375 24.962500000000002 24-25 24.749874937468736 25.78789394697349 23.411705852926463 26.050525262631314 26-27 26.687499999999996 24.5375 23.2375 25.5375 28-29 27.325 24.762500000000003 23.4375 24.474999999999998 30-31 26.200000000000003 25.0375 23.974999999999998 24.7875 32-33 26.224999999999998 24.4125 24.462500000000002 24.9 34-35 25.825 25.4875 23.3125 25.374999999999996 36-37 25.162499999999998 25.2375 23.3375 26.2625 38-39 25.224999999999998 25.775 23.849999999999998 25.15 40-41 26.337500000000002 25.2125 23.674999999999997 24.775 42-43 26.8 24.4 23.8375 24.962500000000002 44-45 26.224999999999998 25.124999999999996 24.525 24.125 46-47 27.0 24.087500000000002 23.825 25.087500000000002 48-49 26.26578322290286 24.34054256782098 24.440555069383674 24.953119139892486 50-51 26.137500000000003 25.45 23.575 24.837500000000002 52-53 25.112499999999997 25.85 23.4625 25.575 54-55 25.678209776222026 25.55319414926866 24.66558319789974 24.103012876609576 56-57 25.25315664458057 25.378172271533945 24.30303787973497 25.065633204150515 58-59 25.7625 25.874999999999996 23.7375 24.625 60-61 26.1 25.3 23.45 25.15 62-63 25.687500000000004 24.125 25.387500000000003 24.8 64-65 25.724999999999998 25.2375 23.5625 25.474999999999998 66-67 25.887500000000003 24.5375 24.95 24.625 68-69 25.200100050025014 25.937968984492244 24.149574787393696 24.712356178089045 70-71 25.0125 24.587500000000002 24.975 25.424999999999997 72-73 25.850425212606304 24.362181090545274 24.099549774887443 25.68784392196098 74-75 25.4375 25.674999999999997 24.6625 24.224999999999998 76-77 26.637499999999996 24.65 23.575 25.137500000000003 78-79 25.60030015007504 24.749874937468736 24.449724862431214 25.200100050025014 80-81 25.674999999999997 24.7 25.2625 24.3625 82-83 27.24202626641651 24.577861163227016 23.214509068167605 24.96560350218887 84-85 25.57906598222111 24.715162138475023 24.502316263928883 25.20345561537499 86-87 25.78789394697349 24.749874937468736 24.374687343671837 25.087543771885944 88-89 26.5625 25.324999999999996 24.2 23.9125 90-91 26.474999999999998 25.224999999999998 24.474999999999998 23.825 92-93 26.140767595949495 25.62820352544068 24.615576947118388 23.615451931491435 94-95 26.8125 25.55 23.8625 23.775 96-97 27.3875 25.6125 23.275000000000002 23.724999999999998 98-99 26.1625 27.250000000000004 23.2375 23.35 100-101 26.974999999999998 25.85 23.5625 23.6125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 0.5 26 1.0 27 2.5 28 4.0 29 10.0 30 16.5 31 17.5 32 17.5 33 20.5 34 28.0 35 40.5 36 50.5 37 58.0 38 71.5 39 81.0 40 96.0 41 106.5 42 107.5 43 116.5 44 136.0 45 145.0 46 152.5 47 166.5 48 166.0 49 162.5 50 150.0 51 145.5 52 144.0 53 145.5 54 143.0 55 134.5 56 133.0 57 127.5 58 121.0 59 116.5 60 107.0 61 90.5 62 88.5 63 86.5 64 79.5 65 68.5 66 56.5 67 55.0 68 47.0 69 39.0 70 34.0 71 25.0 72 21.5 73 19.5 74 14.0 75 9.0 76 6.0 77 4.5 78 2.0 79 0.5 80 2.0 81 2.5 82 1.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0375 18-19 0.0125 20-21 0.05 22-23 0.0 24-25 0.05 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0125 50-51 0.0 52-53 0.0 54-55 0.0125 56-57 0.0125 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.05 70-71 0.0 72-73 0.05 74-75 0.0 76-77 0.0 78-79 0.05 80-81 0.0 82-83 0.0625 84-85 0.1625 86-87 0.05 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.325 #Duplication Level Percentage of deduplicated Percentage of total 1 94.58880257165818 88.275 2 4.205732654701313 7.85 3 0.8572193945888027 2.4 4 0.21430484864720067 0.8 5 0.08036431824270024 0.375 6 0.05357621216180017 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTC 6 0.15 No Hit CAATTATCCATAAAACTGTAACTAAGTGAGGCTCTCTCATTGGTTTATAC 6 0.15 No Hit GAAAATTCTATGGAAGAGCTAGCATCTCTGACGAAAACAGCAGACGGAAA 5 0.125 No Hit CGTAACCAAACATGCACAGCGGTCAAACAGTATGTCCCAAGGGGACTTAA 5 0.125 No Hit GGAAGAGCTAGCATCTCTGACGAAAACAGCAGACGGAAAAGTACTGACCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.23750000000000002 0.0 0.0 0.0 0.0 70-71 0.3125 0.0 0.0 0.0 0.0 72-73 0.3625 0.0 0.0 0.0 0.0 74-75 0.4125 0.0 0.0 0.0 0.0 76-77 0.5375000000000001 0.0 0.0 0.0 0.0 78-79 0.6125 0.0 0.0 0.0 0.0 80-81 0.8625 0.0 0.0 0.0 0.0 82-83 1.0750000000000002 0.0 0.0 0.0 0.0 84-85 1.3375 0.0 0.0 0.0 0.0 86-87 1.525 0.0 0.0 0.0 0.0 88-89 1.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGCCTC 15 0.009957196 47.5 36-37 >>END_MODULE Read 1342252 spots for SRR6127942.sra Written 1342252 spots for SRR6127942.sra Read 1342252 spots for SRR6127942.sra Written 1342252 spots for SRR6127942.sra Read 1342252 spots for SRR6127942.sra Written 1342252 spots for SRR6127942.sra Read 1342252 spots for SRR6127942.sra Written 1342252 spots for SRR6127942.sra Read 1342252 spots for SRR6127942.sra Written 1342252 spots for SRR6127942.sra Read 1342252 spots for SRR6127942.sra Written 1342252 spots for SRR6127942.sra Read 1342252 spots for SRR6127942.sra Written 1342252 spots for SRR6127942.sra Read 1342252 spots for SRR6127942.sra Written 1342252 spots for SRR6127942.sra Read 1342252 spots for SRR6127942.sra Written 1342252 spots for SRR6127942.sra Read 1342252 spots for SRR6127942.sra Written 1342252 spots for SRR6127942.sra Read 1342252 spots for SRR6127942.sra Written 1342252 spots for SRR6127942.sra Read 1342252 spots for SRR6127942.sra Written 1342252 spots for SRR6127942.sra Read 1342266 spots for SRR6127942.sra Written 1342266 spots for SRR6127942.sra Read 1342252 spots for SRR6127942.sra Written 1342252 spots for SRR6127942.sra Read 1342252 spots for SRR6127942.sra Written 1342252 spots for SRR6127942.sra Read 1342252 spots for SRR6127942.sra Written 1342252 spots for SRR6127942.sra Read 1342252 spots for SRR6127942.sra Written 1342252 spots for SRR6127942.sra Read 1342252 spots for SRR6127942.sra Written 1342252 spots for SRR6127942.sra Read 1342252 spots for SRR6127942.sra Written 1342252 spots for SRR6127942.sra Read 1342252 spots for SRR6127942.sra Written 1342252 spots for SRR6127942.sra SRR ids: ['SRR6127942.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xfn262q_ SRR6127942.sra spots: 26845054 blocks: [[1, 1342252], [1342253, 2684504], [2684505, 4026756], [4026757, 5369008], [5369009, 6711260], [6711261, 8053512], [8053513, 9395764], [9395765, 10738016], [10738017, 12080268], [12080269, 13422520], [13422521, 14764772], [14764773, 16107024], [16107025, 17449276], [17449277, 18791528], [18791529, 20133780], [20133781, 21476032], [21476033, 22818284], [22818285, 24160536], [24160537, 25502788], [25502789, 26845054]] SRR6127942 file size 6401188 SRR6127942 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6127942 SRR6127942_1.fastq SRR6127942_2.fastq Input file: SRR6127942_1.fastq Paired file: SRR6127942_2.fastq trimmed: SRR6127942-trimmed-pair1.fastq, SRR6127942-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 04:38:48 2024 >> started Tue Dec 10 04:39:24 2024 >> done (35.811s) 26845054 read pairs processed; of these: 113220 ( 0.42%) short read pairs filtered out after trimming by size control 352462 ( 1.31%) empty read pairs filtered out after trimming by size control 26379372 (98.27%) read pairs available; of these: 4935682 (18.71%) trimmed read pairs available after processing 21443690 (81.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 15 0.00% 20 39 0.00% 21 82 0.00% 22 104 0.00% 23 174 0.00% 24 211 0.00% 25 291 0.00% 26 330 0.00% 27 461 0.00% 28 533 0.00% 29 653 0.00% 30 774 0.00% 31 903 0.00% 32 1096 0.00% 33 1223 0.00% 34 1367 0.01% 35 1498 0.01% 36 1762 0.01% 37 1920 0.01% 38 2179 0.01% 39 2295 0.01% 40 2559 0.01% 41 2803 0.01% 42 3190 0.01% 43 3557 0.01% 44 3750 0.01% 45 4145 0.02% 46 4558 0.02% 47 4849 0.02% 48 5270 0.02% 49 5683 0.02% 50 6155 0.02% 51 6584 0.02% 52 7150 0.03% 53 7693 0.03% 54 8155 0.03% 55 9121 0.03% 56 9661 0.04% 57 10908 0.04% 58 11801 0.04% 59 20944 0.08% 60 22035 0.08% 61 23627 0.09% 62 25761 0.10% 63 27551 0.10% 64 29776 0.11% 65 32150 0.12% 66 31512 0.12% 67 33253 0.13% 68 34460 0.13% 69 36729 0.14% 70 38735 0.15% 71 40703 0.15% 72 42481 0.16% 73 44115 0.17% 74 45440 0.17% 75 43342 0.16% 76 43755 0.17% 77 47561 0.18% 78 51292 0.19% 79 53848 0.20% 80 58630 0.22% 81 63893 0.24% 82 68807 0.26% 83 75218 0.29% 84 84569 0.32% 85 92487 0.35% 86 109473 0.41% 87 112063 0.42% 88 108241 0.41% 89 110418 0.42% 90 122663 0.46% 91 134582 0.51% 92 148808 0.56% 93 163734 0.62% 94 189552 0.72% 95 218994 0.83% 96 262503 1.00% 97 325184 1.23% 98 408912 1.55% 99 519454 1.97% 100 22096602 83.76% 26379372 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=3.40 fanout-score-rank=9 prefix-density=0.67 prefix-fanout=3.3 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.19 sequence-density-rank=28 fanout-score=8.67 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=2.3 sequence=CCGAACATGGGAAGCTTCCACAT criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=3.79 fanout-score-rank=8 prefix-density=0.65 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=40.51 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=1.9 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGCTCCTTTCCA SRR6127942 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 04:40:28 Started mapping on | Dec 10 04:40:29 Finished on | Dec 10 04:56:18 Mapping speed, Million of reads per hour | 100.07 Number of input reads | 26379372 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 17664676 Uniquely mapped reads % | 66.96% Average mapped length | 196.19 Number of splices: Total | 11383499 Number of splices: Annotated (sjdb) | 10828672 Number of splices: GT/AG | 11228806 Number of splices: GC/AG | 133320 Number of splices: AT/AC | 3201 Number of splices: Non-canonical | 18172 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.30 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 468220 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 66230 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 29.76% % of reads unmapped: other | 1.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 8259404 8259404 8259404 N_multimapping 468220 468220 468220 N_noFeature 602797 17201310 711112 N_ambiguous 413230 1444 59833 UnstrandedReadsAssigned:16648649 PositiveStrandReadsAssigned:461922 NegativeStrandReadsAssigned:16893731 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR6127942 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6127942-trimmed-pair1.fastq SRR6127942-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,379,372 reads, 16,973,985 reads pseudoaligned [quant] estimated average fragment length: 158.233 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52973 SRR6127942.ke.tsv 35125 SRR6127942.se.tsv 88098 total ==> SRR6127942.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 778.936 0 0 PNS24247 1044 886.767 20.1939 1.85684 PNS24249 1928 1770.77 30.7804 1.41735 PNS24246 1044 886.767 20.1939 1.85684 PNS24248 1044 886.767 20.1939 1.85684 PNS24244 1471 1313.77 66.638 4.13589 PNS24243 293 140.825 2 1.15802 KQK14069 1603 1445.77 1979.8 111.657 KQK14071 474 318.04 92.981 23.8384 ==> SRR6127942.se.tsv <== BRADI_1g14170v3 2419 BRADI_1g53295v3 344 BRADI_1g59795v3 123 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 181 BRADI_1g74790v3 81 BRADI_1g09890v3 0 BRADI_1g77505v3 266 BRADI_1g48960v3 0 SRR6127942 completed mapping pipeline successfully