Starting /dee2/code/volunteer_pipeline.sh SRR6127943 current disk space = 1526161629184 free memory = 1458243952 SRR6127943 SRAfilesize ccb5b2f21eb22e7da2d5ebdfaa89da6c SRR6127943.sra SRR6127943.sra file validated SRR6127943 is paired end SRR6127943 is conventional basespace SRR6127943 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6127943_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.464 33.0 33.0 33.0 33.0 33.0 2 32.61025 33.0 33.0 33.0 33.0 33.0 3 32.769 33.0 33.0 33.0 33.0 33.0 4 36.74775 37.0 37.0 37.0 37.0 37.0 5 36.73225 37.0 37.0 37.0 37.0 37.0 6 36.711 37.0 37.0 37.0 37.0 37.0 7 36.651 37.0 37.0 37.0 37.0 37.0 8 36.6845 37.0 37.0 37.0 37.0 37.0 9 36.62875 37.0 37.0 37.0 37.0 37.0 10-11 36.622875 37.0 37.0 37.0 37.0 37.0 12-13 36.623875 37.0 37.0 37.0 37.0 37.0 14-15 38.93 40.0 40.0 40.0 37.0 40.0 16-17 39.007999999999996 40.0 40.0 40.0 37.0 40.0 18-19 38.973124999999996 40.0 40.0 40.0 37.0 40.0 20-21 38.932874999999996 40.0 40.0 40.0 37.0 40.0 22-23 38.761125 40.0 40.0 40.0 37.0 40.0 24-25 38.7195 40.0 37.0 40.0 37.0 40.0 26-27 38.636625 40.0 37.0 40.0 37.0 40.0 28-29 38.681125 40.0 37.0 40.0 37.0 40.0 30-31 38.665875 40.0 37.0 40.0 37.0 40.0 32-33 38.6305 40.0 37.0 40.0 37.0 40.0 34-35 38.620125 40.0 37.0 40.0 37.0 40.0 36-37 38.487125 40.0 37.0 40.0 37.0 40.0 38-39 38.338875 40.0 37.0 40.0 37.0 40.0 40-41 38.178125 40.0 37.0 40.0 37.0 40.0 42-43 37.913250000000005 40.0 37.0 40.0 33.0 40.0 44-45 37.866125 40.0 37.0 40.0 33.0 40.0 46-47 37.6355 40.0 37.0 40.0 33.0 40.0 48-49 37.54375 40.0 37.0 40.0 33.0 40.0 50-51 37.316625 40.0 37.0 40.0 33.0 40.0 52-53 37.16125 38.5 37.0 40.0 33.0 40.0 54-55 36.621750000000006 37.0 37.0 40.0 33.0 40.0 56-57 36.651624999999996 37.0 37.0 40.0 33.0 40.0 58-59 36.447125 37.0 37.0 40.0 33.0 40.0 60-61 36.156875 37.0 37.0 40.0 33.0 40.0 62-63 35.900375 37.0 37.0 40.0 33.0 40.0 64-65 35.663250000000005 37.0 37.0 40.0 33.0 40.0 66-67 35.34325 37.0 37.0 37.0 33.0 40.0 68-69 35.102875 37.0 33.0 37.0 33.0 40.0 70-71 34.8645 37.0 33.0 37.0 30.0 40.0 72-73 34.568625 37.0 33.0 37.0 27.0 38.5 74-75 34.091625 37.0 33.0 37.0 27.0 37.0 76-77 31.456375 33.0 30.0 35.0 24.5 37.0 78-79 33.236625000000004 37.0 33.0 37.0 27.0 37.0 80-81 33.357625 37.0 33.0 37.0 27.0 37.0 82-83 33.410125 37.0 33.0 37.0 27.0 37.0 84-85 33.420500000000004 37.0 33.0 37.0 27.0 37.0 86-87 33.38275 37.0 33.0 37.0 27.0 37.0 88-89 33.189750000000004 37.0 33.0 37.0 27.0 37.0 90-91 33.197375 37.0 33.0 37.0 27.0 37.0 92-93 32.890249999999995 37.0 33.0 37.0 27.0 37.0 94-95 32.79775 37.0 33.0 37.0 27.0 37.0 96-97 32.601749999999996 37.0 33.0 37.0 27.0 37.0 98-99 32.161874999999995 37.0 33.0 37.0 22.0 37.0 100 28.5495 33.0 27.0 33.0 15.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 3.0 10 2.0 11 1.0 12 1.0 13 4.0 14 4.0 15 5.0 16 9.0 17 2.0 18 8.0 19 8.0 20 7.0 21 16.0 22 13.0 23 13.0 24 22.0 25 20.0 26 27.0 27 38.0 28 27.0 29 41.0 30 60.0 31 67.0 32 104.0 33 123.0 34 165.0 35 287.0 36 567.0 37 1286.0 38 1070.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.676767676767675 12.97979797979798 9.267676767676768 40.07575757575758 2 23.625 17.375 36.725 22.275 3 22.525000000000002 22.575 24.425 30.475 4 25.624999999999996 30.599999999999998 22.05 21.725 5 26.025 32.25 23.425 18.3 6 21.975 32.425 24.175 21.425 7 15.6 22.3 42.6 19.5 8 21.725 21.25 28.275 28.749999999999996 9 21.425 19.475 32.05 27.05 10-11 24.224999999999998 30.5125 21.3125 23.95 12-13 23.825 22.5 26.3 27.375 14-15 22.25 25.85 27.0125 24.887500000000003 16-17 24.175 26.2625 24.5625 25.0 18-19 22.825 26.075 25.4875 25.6125 20-21 23.2375 25.362499999999997 26.150000000000002 25.25 22-23 23.674999999999997 25.8625 25.624999999999996 24.837500000000002 24-25 23.549999999999997 25.775 26.0 24.675 26-27 24.125 26.275 25.724999999999998 23.875 28-29 23.775 25.337500000000002 26.0625 24.825 30-31 23.9125 25.0125 26.55 24.525 32-33 22.5625 26.5625 26.25 24.625 34-35 22.925 24.9875 26.174999999999997 25.912499999999998 36-37 23.7625 25.275 25.275 25.687500000000004 38-39 24.2 24.45 26.25 25.1 40-41 23.8375 25.8125 25.6125 24.7375 42-43 23.7625 25.8 25.525 24.9125 44-45 24.337500000000002 25.3 25.95 24.4125 46-47 24.0375 25.687500000000004 25.224999999999998 25.05 48-49 23.962500000000002 24.8125 25.7875 25.4375 50-51 24.2875 25.0625 25.724999999999998 24.925 52-53 23.9875 24.9375 25.35 25.724999999999998 54-55 23.974999999999998 24.962500000000002 26.3125 24.75 56-57 23.45 25.137500000000003 26.1625 25.25 58-59 23.8625 25.0125 25.8 25.324999999999996 60-61 23.3 25.9625 25.775 24.962500000000002 62-63 23.3875 25.5125 25.974999999999998 25.124999999999996 64-65 23.925 25.724999999999998 25.15 25.2 66-67 23.3625 24.825 25.575 26.237500000000004 68-69 23.674999999999997 25.275 25.087500000000002 25.9625 70-71 23.875 25.5625 25.85 24.712500000000002 72-73 24.625 24.7 24.6875 25.9875 74-75 23.3625 25.5625 25.0125 26.0625 76-77 24.0125 24.65 25.4875 25.85 78-79 23.3 25.9625 25.0125 25.724999999999998 80-81 24.575 24.55 25.8625 25.0125 82-83 24.4875 24.75 25.525 25.2375 84-85 23.674999999999997 25.0375 25.587500000000002 25.7 86-87 25.2375 25.087500000000002 24.8 24.875 88-89 24.712500000000002 24.762500000000003 25.137500000000003 25.387500000000003 90-91 25.2875 24.95 25.2125 24.55 92-93 23.3 25.5125 25.387500000000003 25.8 94-95 23.3125 26.237500000000004 25.4625 24.9875 96-97 24.75 25.4875 24.875 24.887500000000003 98-99 24.2 25.2125 25.0625 25.525 100 26.85 24.65 23.825 24.675 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 2.0 27 3.0 28 3.5 29 7.5 30 15.5 31 23.5 32 24.0 33 25.5 34 40.5 35 50.5 36 57.0 37 70.0 38 88.5 39 92.0 40 104.0 41 125.5 42 142.5 43 152.5 44 143.5 45 163.0 46 186.5 47 193.5 48 196.5 49 183.0 50 158.5 51 155.5 52 171.5 53 175.5 54 143.5 55 115.5 56 116.5 57 108.5 58 99.0 59 94.0 60 90.5 61 79.5 62 59.0 63 50.5 64 51.5 65 42.0 66 31.0 67 30.5 68 29.0 69 24.0 70 21.5 71 17.0 72 12.0 73 8.5 74 6.0 75 5.0 76 2.5 77 1.0 78 2.0 79 1.5 80 1.5 81 1.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.10825892857143 83.42500000000001 2 4.575892857142857 8.200000000000001 3 1.171875 3.15 4 0.6138392857142857 2.1999999999999997 5 0.25111607142857145 1.125 6 0.13950892857142858 0.75 7 0.027901785714285712 0.17500000000000002 8 0.027901785714285712 0.2 9 0.027901785714285712 0.22499999999999998 >10 0.055803571428571425 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAAGATCCTGAATAAATCCTACTGTATCTGAAAGAAGAACACTGTAGCC 12 0.3 No Hit GCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGA 10 0.25 No Hit CCGGGATCGGGCAAAGGGGCAACTCGAGCTAATCTCCCCAGCGGCTAGCA 9 0.22499999999999998 No Hit GTCGGTTTCCAGTTTCGTTTCCCCGGGACCTCTTGCCCCAATTCCTCCGC 8 0.2 No Hit GGCAGGTTCATTTTAAACGCGGTGACTAGGATGCTCATTTGAATGTCCCC 7 0.17500000000000002 No Hit GGGAACAGTCGCATGACGAGGCAGTTTCCAGAAACGTGTATCACATCTAG 6 0.15 No Hit CAATCATCTTCACTTCAATTGCTGTTGCCAATGACTTCAGCTGACTTGGC 6 0.15 No Hit GCAAGTTGTAGGTCGGGGGCACCACACCACGCTCGCTTGGCAGTAACGCG 6 0.15 No Hit GTTGATACCGTCTGCGATAGGCTAGTTCATAAACGAGGGGCGATGCCCGG 6 0.15 No Hit CCGCATAATCCTCATTTGAAGAATCAATTAAATGCAGAATTAAATCCGCT 6 0.15 No Hit GTTGATTTCATGAATGCGATTTCTGATATGGCGGCGGTCGGTTTCCAGTT 5 0.125 No Hit GTTTGTATAGCCGACAAGCGCAATTTGAAGCACACCGTTTTTCTTTCTTC 5 0.125 No Hit ATCGGGTCCAGCGTGGCAAACAGGAGGTCTTCTTCATAGCTGTCAGCACT 5 0.125 No Hit GTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGA 5 0.125 No Hit CTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAAACCA 5 0.125 No Hit CCAGAATTCAAGACGTTAACAGTTCTTGGCGCAAATAGCGCTGAATCGCT 5 0.125 No Hit CTGACCCCGGGGAACAGTCGCATGACGAGGCAGTTTCCAGAAACGTGTAT 5 0.125 No Hit GTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGGGAA 5 0.125 No Hit CTCAAATTTCGCACTGACCATAATGTGATCCCTTCCGGCGGTCGGTATAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.3125 0.0 0.0 0.0 0.0 74-75 0.3875 0.0 0.0 0.0 0.0 76-77 0.5375 0.0 0.0 0.0 0.0 78-79 0.675 0.0 0.0 0.0 0.0 80-81 0.9875 0.0 0.0 0.0 0.0 82-83 1.225 0.0 0.0 0.0 0.0 84-85 1.5125000000000002 0.0 0.0 0.0 0.0 86-87 1.8625 0.0 0.0 0.0 0.0 88 2.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6127943 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6127943_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.71025 33.0 33.0 33.0 33.0 33.0 2 31.87675 33.0 33.0 33.0 33.0 33.0 3 31.9395 33.0 33.0 33.0 33.0 33.0 4 35.477 37.0 37.0 37.0 33.0 37.0 5 35.4665 37.0 37.0 37.0 33.0 37.0 6 35.37275 37.0 37.0 37.0 33.0 37.0 7 35.44275 37.0 37.0 37.0 33.0 37.0 8 35.4755 37.0 37.0 37.0 33.0 37.0 9 35.72325 37.0 37.0 37.0 33.0 37.0 10-11 35.852000000000004 37.0 37.0 37.0 37.0 37.0 12-13 35.854625 37.0 37.0 37.0 37.0 37.0 14-15 38.05825 40.0 37.0 40.0 37.0 40.0 16-17 38.0985 40.0 37.0 40.0 37.0 40.0 18-19 38.108125 40.0 40.0 40.0 37.0 40.0 20-21 37.98325 40.0 38.5 40.0 37.0 40.0 22-23 37.326625 40.0 37.0 40.0 33.0 40.0 24-25 37.765 40.0 37.0 40.0 37.0 40.0 26-27 37.8755 40.0 37.0 40.0 37.0 40.0 28-29 37.869 40.0 37.0 40.0 37.0 40.0 30-31 37.795 40.0 37.0 40.0 37.0 40.0 32-33 37.6665 40.0 37.0 40.0 33.0 40.0 34-35 37.684875000000005 40.0 37.0 40.0 35.0 40.0 36-37 37.6235 40.0 37.0 40.0 35.0 40.0 38-39 37.4975 40.0 37.0 40.0 33.0 40.0 40-41 37.392375 40.0 37.0 40.0 33.0 40.0 42-43 37.255375 40.0 37.0 40.0 33.0 40.0 44-45 37.07825 40.0 37.0 40.0 33.0 40.0 46-47 36.963625 40.0 37.0 40.0 33.0 40.0 48-49 36.838125 40.0 37.0 40.0 33.0 40.0 50-51 35.216375 38.5 35.0 38.5 30.0 40.0 52-53 35.4825 37.0 35.0 38.5 33.0 40.0 54-55 36.170625 37.0 37.0 40.0 33.0 40.0 56-57 36.1495 37.0 37.0 40.0 33.0 40.0 58-59 35.985625 37.0 37.0 40.0 33.0 40.0 60-61 35.661375 37.0 37.0 40.0 33.0 40.0 62-63 35.41875 37.0 37.0 40.0 33.0 40.0 64-65 35.281875 37.0 37.0 37.0 33.0 40.0 66-67 35.125249999999994 37.0 37.0 37.0 33.0 40.0 68-69 34.864999999999995 37.0 37.0 37.0 33.0 40.0 70-71 34.752375 37.0 37.0 37.0 33.0 40.0 72-73 34.47525 37.0 33.0 37.0 33.0 38.5 74-75 34.2945 37.0 33.0 37.0 27.0 37.0 76-77 34.045249999999996 37.0 33.0 37.0 27.0 37.0 78-79 33.68175 37.0 33.0 37.0 27.0 37.0 80-81 33.581999999999994 37.0 33.0 37.0 27.0 37.0 82-83 33.532125 37.0 33.0 37.0 27.0 37.0 84-85 33.482124999999996 37.0 33.0 37.0 27.0 37.0 86-87 33.439750000000004 37.0 33.0 37.0 27.0 37.0 88-89 33.244125 37.0 33.0 37.0 27.0 37.0 90-91 33.27975 37.0 33.0 37.0 27.0 37.0 92-93 33.14575000000001 37.0 33.0 37.0 27.0 37.0 94-95 33.0415 37.0 33.0 37.0 27.0 37.0 96-97 32.812250000000006 37.0 33.0 37.0 27.0 37.0 98-99 32.676625 37.0 33.0 37.0 27.0 37.0 100-101 31.126375000000003 35.0 30.0 37.0 18.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 64.0 3 8.0 4 1.0 5 6.0 6 2.0 7 6.0 8 3.0 9 3.0 10 3.0 11 4.0 12 7.0 13 7.0 14 3.0 15 4.0 16 5.0 17 5.0 18 3.0 19 9.0 20 10.0 21 10.0 22 3.0 23 14.0 24 15.0 25 22.0 26 10.0 27 24.0 28 30.0 29 51.0 30 33.0 31 43.0 32 85.0 33 100.0 34 137.0 35 231.0 36 502.0 37 1481.0 38 1056.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.35 16.875 10.825 34.949999999999996 2 27.950000000000003 23.150000000000002 31.424999999999997 17.474999999999998 3 22.775000000000002 26.125 27.075 24.025 4 25.7 33.75 20.05 20.5 5 26.674999999999997 34.575 18.9 19.85 6 22.675 35.825 21.0 20.5 7 21.6 18.575 36.8 23.025000000000002 8 23.225 21.825 24.875 30.075000000000003 9 23.9 22.8 26.375 26.924999999999997 10-11 26.737499999999997 28.65 19.9375 24.675 12-13 25.45 22.825 25.3125 26.4125 14-15 23.425 25.9625 26.3125 24.3 16-17 25.2625 25.3125 24.712500000000002 24.712500000000002 18-19 25.912499999999998 26.200000000000003 23.7875 24.099999999999998 20-21 25.506376594148538 25.731432858214554 25.068767191797946 23.69342335583896 22-23 26.187500000000004 25.9625 24.4875 23.3625 24-25 25.30316289536192 25.603200400050007 24.82810351293912 24.265533191648956 26-27 25.874999999999996 25.7875 24.762500000000003 23.575 28-29 25.2125 26.0625 24.1625 24.5625 30-31 26.0625 25.0125 24.6 24.325 32-33 25.887500000000003 25.775 24.55 23.7875 34-35 26.325 26.025 24.0 23.65 36-37 24.6 26.474999999999998 24.65 24.275 38-39 26.1625 25.837500000000002 24.1875 23.8125 40-41 25.687500000000004 25.8125 24.0625 24.4375 42-43 25.324999999999996 26.487500000000004 24.462500000000002 23.724999999999998 44-45 25.674999999999997 24.875 25.45 24.0 46-47 26.337500000000002 26.025 24.587500000000002 23.05 48-49 26.450000000000003 24.099999999999998 24.675 24.775 50-51 25.337500000000002 25.937500000000004 25.775 22.95 52-53 25.387500000000003 25.6125 24.087500000000002 24.9125 54-55 25.25 25.874999999999996 25.575 23.3 56-57 24.3875 25.95 25.85 23.8125 58-59 25.424999999999997 26.1125 24.1125 24.349999999999998 60-61 25.124999999999996 26.0625 25.0 23.8125 62-63 25.174999999999997 26.174999999999997 25.15 23.5 64-65 24.775 26.25 24.962500000000002 24.0125 66-67 25.162499999999998 25.3 25.3125 24.224999999999998 68-69 25.315664458057256 25.828228528566072 24.72809101137642 24.128016002000248 70-71 25.687500000000004 24.75 25.6 23.962500000000002 72-73 25.278159769971246 24.8906113264158 25.403175396924617 24.428053506688336 74-75 25.0625 25.387500000000003 25.087500000000002 24.462500000000002 76-77 25.4 25.9625 24.0 24.637500000000003 78-79 25.331332833208304 25.918979744936234 25.056264066016503 23.69342335583896 80-81 25.324999999999996 26.7625 24.637500000000003 23.275000000000002 82-83 26.19404851212803 26.219054763690924 23.93098274568642 23.655913978494624 84-85 25.331498623967974 26.782586940205157 25.03127345509132 22.854640980735553 86-87 24.953119139892486 26.015751968996128 25.715714464308036 23.31541442680335 88-89 25.474999999999998 26.2875 24.85 23.3875 90-91 25.3 26.3125 25.0375 23.35 92-93 26.187500000000004 25.45 24.8625 23.5 94-95 25.7375 26.387500000000003 24.85 23.025000000000002 96-97 26.087500000000002 26.400000000000002 24.825 22.6875 98-99 25.8625 26.7125 24.725 22.7 100-101 27.05 26.4125 23.925 22.6125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 0.0 24 1.5 25 1.5 26 1.0 27 1.5 28 4.5 29 9.0 30 12.0 31 19.5 32 28.0 33 29.0 34 30.5 35 35.0 36 55.5 37 75.5 38 93.5 39 101.0 40 105.5 41 110.0 42 108.5 43 127.5 44 157.0 45 168.5 46 167.0 47 189.5 48 198.5 49 183.0 50 167.5 51 159.0 52 152.0 53 149.5 54 147.5 55 146.5 56 130.5 57 113.5 58 112.0 59 102.5 60 91.0 61 78.5 62 61.0 63 54.5 64 51.5 65 46.5 66 43.5 67 36.5 68 31.5 69 26.0 70 21.0 71 17.0 72 13.0 73 5.5 74 6.0 75 6.0 76 2.5 77 3.0 78 1.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.025 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.0125 74-75 0.0 76-77 0.0 78-79 0.025 80-81 0.0 82-83 0.025 84-85 0.075 86-87 0.0125 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.2 #Duplication Level Percentage of deduplicated Percentage of total 1 93.39364035087719 85.175 2 4.7423245614035086 8.649999999999999 3 1.151315789473684 3.15 4 0.4934210526315789 1.7999999999999998 5 0.10964912280701754 0.5 6 0.027412280701754384 0.15 7 0.027412280701754384 0.17500000000000002 8 0.05482456140350877 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCAATATAAGCCTTGGTAGGGATAGATAGCCACCTATATAGTATAGCT 8 0.2 No Hit CTCGTAACCAAACATGCACAGCGGTCAAACAGTATGTCCCAAGGGGACTT 8 0.2 No Hit CTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGGTT 7 0.17500000000000002 No Hit GTTTATTGGAAGCATCAACCTGCGCCGTCTTGTTAACTTGTCATATCGCG 6 0.15 No Hit GTCAAACAGTATGTCCCAAGGGGACTTAAGCGCGGTGGCCTCCCCTATCC 5 0.125 No Hit CGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGA 5 0.125 No Hit CTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCT 5 0.125 No Hit CCTGAAACGGGCATCGTCGCTCTTCGTTGTTCGTCGACTTCTAGTGTGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.3125 0.0 0.0 0.0 0.0 74-75 0.3875 0.0 0.0 0.0 0.0 76-77 0.5625 0.0 0.0 0.0 0.0 78-79 0.7 0.0 0.0 0.0 0.0 80-81 1.0125 0.0 0.0 0.0 0.0 82-83 1.2625000000000002 0.0 0.0 0.0 0.0 84-85 1.5625 0.0 0.0 0.0 0.0 86-87 1.9249999999999998 0.0 0.0 0.0 0.0 88-89 2.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1436859 spots for SRR6127943.sra Written 1436859 spots for SRR6127943.sra Read 1436859 spots for SRR6127943.sra Written 1436859 spots for SRR6127943.sra Read 1436859 spots for SRR6127943.sra Written 1436859 spots for SRR6127943.sra Read 1436859 spots for SRR6127943.sra Written 1436859 spots for SRR6127943.sra Read 1436859 spots for SRR6127943.sra Written 1436859 spots for SRR6127943.sra Read 1436859 spots for SRR6127943.sra Written 1436859 spots for SRR6127943.sra Read 1436859 spots for SRR6127943.sra Written 1436859 spots for SRR6127943.sra Read 1436859 spots for SRR6127943.sra Written 1436859 spots for SRR6127943.sra Read 1436859 spots for SRR6127943.sra Written 1436859 spots for SRR6127943.sra Read 1436859 spots for SRR6127943.sra Written 1436859 spots for SRR6127943.sra Read 1436865 spots for SRR6127943.sra Written 1436865 spots for SRR6127943.sra Read 1436859 spots for SRR6127943.sra Written 1436859 spots for SRR6127943.sra Read 1436859 spots for SRR6127943.sra Written 1436859 spots for SRR6127943.sra Read 1436859 spots for SRR6127943.sra Written 1436859 spots for SRR6127943.sra Read 1436859 spots for SRR6127943.sra Written 1436859 spots for SRR6127943.sra Read 1436859 spots for SRR6127943.sra Written 1436859 spots for SRR6127943.sra Read 1436859 spots for SRR6127943.sra Written 1436859 spots for SRR6127943.sra Read 1436859 spots for SRR6127943.sra Written 1436859 spots for SRR6127943.sra Read 1436859 spots for SRR6127943.sra Written 1436859 spots for SRR6127943.sra Read 1436859 spots for SRR6127943.sra Written 1436859 spots for SRR6127943.sra SRR ids: ['SRR6127943.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o1uq4m9r SRR6127943.sra spots: 28737186 blocks: [[1, 1436859], [1436860, 2873718], [2873719, 4310577], [4310578, 5747436], [5747437, 7184295], [7184296, 8621154], [8621155, 10058013], [10058014, 11494872], [11494873, 12931731], [12931732, 14368590], [14368591, 15805449], [15805450, 17242308], [17242309, 18679167], [18679168, 20116026], [20116027, 21552885], [21552886, 22989744], [22989745, 24426603], [24426604, 25863462], [25863463, 27300321], [27300322, 28737186]] SRR6127943 file size 6853895 SRR6127943 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6127943 SRR6127943_1.fastq SRR6127943_2.fastq Input file: SRR6127943_1.fastq Paired file: SRR6127943_2.fastq trimmed: SRR6127943-trimmed-pair1.fastq, SRR6127943-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 04:36:31 2024 >> started Tue Dec 10 04:37:01 2024 >> done (29.475s) 28737186 read pairs processed; of these: 112087 ( 0.39%) short read pairs filtered out after trimming by size control 392320 ( 1.37%) empty read pairs filtered out after trimming by size control 28232779 (98.24%) read pairs available; of these: 5261001 (18.63%) trimmed read pairs available after processing 22971778 (81.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 17 0.00% 20 26 0.00% 21 55 0.00% 22 81 0.00% 23 119 0.00% 24 177 0.00% 25 214 0.00% 26 275 0.00% 27 400 0.00% 28 439 0.00% 29 539 0.00% 30 614 0.00% 31 751 0.00% 32 887 0.00% 33 1028 0.00% 34 1151 0.00% 35 1393 0.00% 36 1503 0.01% 37 1714 0.01% 38 1866 0.01% 39 1984 0.01% 40 2405 0.01% 41 2619 0.01% 42 2900 0.01% 43 3091 0.01% 44 3509 0.01% 45 3865 0.01% 46 4204 0.01% 47 4585 0.02% 48 4975 0.02% 49 5381 0.02% 50 5897 0.02% 51 6400 0.02% 52 7032 0.02% 53 7580 0.03% 54 8201 0.03% 55 8712 0.03% 56 9655 0.03% 57 10595 0.04% 58 11778 0.04% 59 20552 0.07% 60 21817 0.08% 61 23514 0.08% 62 26155 0.09% 63 27663 0.10% 64 29996 0.11% 65 32596 0.12% 66 32582 0.12% 67 33974 0.12% 68 35697 0.13% 69 39104 0.14% 70 40413 0.14% 71 43273 0.15% 72 46307 0.16% 73 46935 0.17% 74 49470 0.18% 75 47906 0.17% 76 48240 0.17% 77 52673 0.19% 78 56281 0.20% 79 60346 0.21% 80 66568 0.24% 81 72645 0.26% 82 77558 0.27% 83 85421 0.30% 84 94911 0.34% 85 105793 0.37% 86 121394 0.43% 87 123139 0.44% 88 122975 0.44% 89 123306 0.44% 90 137479 0.49% 91 148384 0.53% 92 166033 0.59% 93 183367 0.65% 94 210449 0.75% 95 239418 0.85% 96 284323 1.01% 97 342819 1.21% 98 423925 1.50% 99 531817 1.88% 100 23626933 83.69% 28232779 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.53 fanout-score-rank=5 prefix-density=0.49 prefix-fanout=2.9 sequence=ACCTCCTCCAGCTCCTT criterion=fanout-score sequence-density=0.14 sequence-density-rank=16 fanout-score=23.84 fanout-score-rank=1 prefix-density=1.63 prefix-fanout=2.0 sequence=TTCGTTTTTTTTCTTG criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=13 prefix-density=0.46 prefix-fanout=2.6 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=10.46 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.7 sequence=CGAGCTCGCATTTTGAAAATTCTATGGAAGAGCTAGCATCTCTGACGAAAACAGCAGACGGAAAAGTACTGACCAGCGTCACACAAAAACGGAACAGGGCTGACGCCGCTACATATATAGGAAAAGGGAAGGTAGAAGAGCTGAAGGCACTCGTGGAAGAGCTTGAAGCTGATCTCCTCATCTTTAATGATGAACTGTCGCCAAGTCAGCTGAAGTCATTGGCAACAGCAATTGAAGTGAAGATGATTGACCGCACGCAATTGATATTAGATATTTTTGCAAAGCGGGCGAGAACGAGAGAAGGCAAACTTCAAATTGAGCTGGCTCAGCTGCAATATGCACTGCCGCGTCTGACGGGACAAGGGATCAACCTTTCCCGGCAAGGCGGAGGAATTGGGGCAAGAGGTCCCGGGGAAACGAAACTGGAAACCGACCGCCGCCATATCAGAAATCGCATTCATGAAATCAACACACAGCTTTCCACTGTCATTCGCCATAGAAGCCGATACCG SRR6127943 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 04:38:13 Started mapping on | Dec 10 04:38:13 Finished on | Dec 10 04:56:47 Mapping speed, Million of reads per hour | 91.24 Number of input reads | 28232779 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 16498491 Uniquely mapped reads % | 58.44% Average mapped length | 196.33 Number of splices: Total | 10239466 Number of splices: Annotated (sjdb) | 9694190 Number of splices: GT/AG | 10104821 Number of splices: GC/AG | 113375 Number of splices: AT/AC | 3153 Number of splices: Non-canonical | 18117 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.16 Insertion rate per base | 0.02% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 797049 % of reads mapped to multiple loci | 2.82% Number of reads mapped to too many loci | 146427 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 35.56% % of reads unmapped: other | 2.66% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 10949505 10949505 10949505 N_multimapping 797049 797049 797049 N_noFeature 869232 16069252 993913 N_ambiguous 352943 1946 49809 UnstrandedReadsAssigned:15276316 PositiveStrandReadsAssigned:427293 NegativeStrandReadsAssigned:15454769 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR6127943 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6127943-trimmed-pair1.fastq SRR6127943-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,232,779 reads, 15,634,607 reads pseudoaligned [quant] estimated average fragment length: 157.085 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52973 SRR6127943.ke.tsv 35125 SRR6127943.se.tsv 88098 total ==> SRR6127943.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 780.097 0 0 PNS24247 1044 887.915 60.7239 6.30438 PNS24249 1928 1771.92 54.8483 2.85347 PNS24246 1044 887.915 60.7239 6.30438 PNS24248 1044 887.915 60.7239 6.30438 PNS24244 1471 1314.92 168.98 11.8465 PNS24243 293 142.519 0 0 KQK14069 1603 1446.92 16882.5 1075.59 KQK14071 474 319.393 120.443 34.7624 ==> SRR6127943.se.tsv <== BRADI_1g14170v3 18020 BRADI_1g53295v3 178 BRADI_1g59795v3 57 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 141 BRADI_1g74790v3 239 BRADI_1g09890v3 0 BRADI_1g77505v3 172 BRADI_1g48960v3 0 SRR6127943 completed mapping pipeline successfully