Starting /dee2/code/volunteer_pipeline.sh SRR6127944 current disk space = 1526064947200 free memory = 1552603964 SRR6127944 SRAfilesize cb311276a7c237f01f27d5541ab95209 SRR6127944.sra SRR6127944.sra file validated SRR6127944 is paired end SRR6127944 is conventional basespace SRR6127944 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6127944_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.35225 33.0 33.0 33.0 33.0 33.0 2 32.53025 33.0 33.0 33.0 33.0 33.0 3 32.743 33.0 33.0 33.0 33.0 33.0 4 36.7415 37.0 37.0 37.0 37.0 37.0 5 36.69425 37.0 37.0 37.0 37.0 37.0 6 36.6465 37.0 37.0 37.0 37.0 37.0 7 36.61575 37.0 37.0 37.0 37.0 37.0 8 36.64075 37.0 37.0 37.0 37.0 37.0 9 36.64 37.0 37.0 37.0 37.0 37.0 10-11 36.626375 37.0 37.0 37.0 37.0 37.0 12-13 36.59575 37.0 37.0 37.0 37.0 37.0 14-15 38.958749999999995 40.0 40.0 40.0 37.0 40.0 16-17 39.000375000000005 40.0 40.0 40.0 37.0 40.0 18-19 38.931625 40.0 40.0 40.0 37.0 40.0 20-21 38.911625 40.0 40.0 40.0 37.0 40.0 22-23 38.802625 40.0 40.0 40.0 37.0 40.0 24-25 38.763999999999996 40.0 38.5 40.0 37.0 40.0 26-27 38.65975 40.0 37.0 40.0 37.0 40.0 28-29 38.64875 40.0 38.5 40.0 37.0 40.0 30-31 38.605000000000004 40.0 37.0 40.0 37.0 40.0 32-33 38.582 40.0 37.0 40.0 37.0 40.0 34-35 38.519875 40.0 37.0 40.0 37.0 40.0 36-37 38.391875 40.0 37.0 40.0 37.0 40.0 38-39 38.22725 40.0 37.0 40.0 37.0 40.0 40-41 38.1115 40.0 37.0 40.0 37.0 40.0 42-43 37.87525 40.0 37.0 40.0 35.0 40.0 44-45 37.744 40.0 37.0 40.0 33.0 40.0 46-47 37.5765 40.0 37.0 40.0 33.0 40.0 48-49 37.473 40.0 37.0 40.0 33.0 40.0 50-51 37.369 40.0 37.0 40.0 33.0 40.0 52-53 37.109125 40.0 37.0 40.0 33.0 40.0 54-55 36.61625 37.0 37.0 40.0 33.0 40.0 56-57 36.64175 37.0 37.0 40.0 33.0 40.0 58-59 36.315875 37.0 37.0 40.0 33.0 40.0 60-61 36.116 37.0 37.0 40.0 33.0 40.0 62-63 35.840500000000006 37.0 37.0 40.0 33.0 40.0 64-65 35.636624999999995 37.0 37.0 40.0 33.0 40.0 66-67 35.300875000000005 37.0 37.0 37.0 33.0 40.0 68-69 35.0705 37.0 33.0 37.0 30.0 40.0 70-71 34.730000000000004 37.0 33.0 37.0 27.0 40.0 72-73 34.47125 37.0 33.0 37.0 27.0 40.0 74-75 34.167375 37.0 33.0 37.0 27.0 37.0 76-77 31.47575 33.0 30.0 35.0 24.5 37.0 78-79 33.252875 37.0 33.0 37.0 27.0 37.0 80-81 33.34125 37.0 33.0 37.0 27.0 37.0 82-83 33.43925 37.0 33.0 37.0 27.0 37.0 84-85 33.381249999999994 37.0 33.0 37.0 27.0 37.0 86-87 33.35875 37.0 33.0 37.0 27.0 37.0 88-89 33.05825 37.0 33.0 37.0 27.0 37.0 90-91 33.00375 37.0 33.0 37.0 27.0 37.0 92-93 32.793625 37.0 33.0 37.0 27.0 37.0 94-95 32.659625000000005 37.0 33.0 37.0 27.0 37.0 96-97 32.406125 37.0 33.0 37.0 22.0 37.0 98-99 32.014375 37.0 33.0 37.0 22.0 37.0 100 28.482 33.0 27.0 37.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 2.0 10 4.0 11 5.0 12 5.0 13 5.0 14 6.0 15 3.0 16 11.0 17 7.0 18 4.0 19 8.0 20 10.0 21 8.0 22 13.0 23 13.0 24 17.0 25 23.0 26 21.0 27 33.0 28 42.0 29 52.0 30 41.0 31 93.0 32 96.0 33 130.0 34 178.0 35 243.0 36 494.0 37 1337.0 38 1095.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.46814964610718 13.119312436804853 9.605662285136502 43.80687563195146 2 22.75 15.625 37.45 24.175 3 21.9 21.2 24.4 32.5 4 26.150000000000002 30.15 20.625 23.075000000000003 5 26.75 32.0 24.025 17.224999999999998 6 20.25 32.375 26.025 21.349999999999998 7 15.925 21.375 43.824999999999996 18.875 8 20.200000000000003 19.775000000000002 29.799999999999997 30.225 9 20.424999999999997 20.05 31.324999999999996 28.199999999999996 10-11 23.65 30.162499999999998 22.2625 23.925 12-13 22.400000000000002 22.3 27.825 27.474999999999998 14-15 22.425 25.1875 26.900000000000002 25.4875 16-17 23.200000000000003 25.6 25.474999999999998 25.724999999999998 18-19 23.1 24.887500000000003 27.075 24.9375 20-21 22.7625 25.5625 26.187500000000004 25.4875 22-23 22.75 25.275 25.974999999999998 26.0 24-25 23.3125 24.4 26.987499999999997 25.3 26-27 21.825 26.337500000000002 26.9625 24.875 28-29 21.825 25.7 26.8125 25.662499999999998 30-31 22.8625 24.9125 25.912499999999998 26.3125 32-33 22.3375 25.775 26.450000000000003 25.4375 34-35 23.8125 25.0625 25.8625 25.2625 36-37 22.425 26.487500000000004 24.962500000000002 26.125 38-39 23.4125 25.2125 25.8125 25.5625 40-41 23.775 25.3125 25.7125 25.2 42-43 23.05 25.337500000000002 26.400000000000002 25.2125 44-45 22.6375 25.5375 26.137500000000003 25.687500000000004 46-47 24.425 25.1 25.724999999999998 24.75 48-49 24.0125 24.45 26.025 25.5125 50-51 23.025000000000002 25.0625 26.400000000000002 25.5125 52-53 23.9 24.7375 26.0625 25.3 54-55 23.05 24.462500000000002 26.337500000000002 26.150000000000002 56-57 23.6625 23.9 25.624999999999996 26.8125 58-59 23.2875 25.587500000000002 26.0125 25.112499999999997 60-61 23.5375 25.0375 26.0 25.424999999999997 62-63 24.0 24.875 26.087500000000002 25.0375 64-65 23.225 25.137500000000003 25.825 25.8125 66-67 23.425 25.2125 26.0 25.362499999999997 68-69 23.525 25.0375 25.900000000000002 25.5375 70-71 24.0625 25.3125 26.2625 24.3625 72-73 23.9875 24.1625 25.75 26.1 74-75 23.0375 24.5375 26.6 25.825 76-77 23.674999999999997 24.8 26.0625 25.4625 78-79 23.2625 24.887500000000003 26.8125 25.0375 80-81 22.8625 24.7 26.974999999999998 25.4625 82-83 24.6125 24.637500000000003 25.6 25.15 84-85 23.35 24.925 26.1 25.624999999999996 86-87 24.4 24.1375 25.374999999999996 26.087500000000002 88-89 24.15 24.1125 26.4125 25.324999999999996 90-91 24.087500000000002 23.6875 25.525 26.700000000000003 92-93 24.099999999999998 24.474999999999998 25.6125 25.8125 94-95 23.875 24.65 25.587500000000002 25.887500000000003 96-97 23.7375 24.4875 25.937500000000004 25.837500000000002 98-99 23.925 24.325 25.724999999999998 26.025 100 24.375 24.7 24.675 26.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 2.5 29 11.5 30 19.5 31 19.5 32 22.0 33 31.5 34 43.5 35 49.0 36 56.5 37 79.0 38 97.5 39 93.0 40 96.0 41 113.0 42 124.0 43 141.5 44 164.5 45 177.0 46 184.0 47 182.0 48 188.5 49 183.0 50 161.0 51 160.5 52 161.5 53 165.5 54 163.0 55 154.5 56 136.0 57 109.0 58 95.0 59 94.0 60 86.0 61 65.5 62 59.5 63 51.5 64 41.0 65 37.5 66 32.5 67 27.5 68 24.5 69 23.0 70 18.0 71 13.5 72 7.5 73 5.0 74 5.0 75 6.5 76 7.0 77 2.0 78 0.0 79 1.5 80 2.0 81 1.0 82 0.5 83 0.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.95 #Duplication Level Percentage of deduplicated Percentage of total 1 93.15557998900495 84.725 2 4.8927982407916435 8.9 3 1.3468938977460143 3.675 4 0.32985156679494226 1.2 5 0.13743815283122596 0.625 6 0.08246289169873557 0.44999999999999996 7 0.0 0.0 8 0.027487630566245192 0.2 9 0.027487630566245192 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGATTTCATGAATGCGATTTCTGATATGGCGGCGGTCGGTTTCCAGTT 9 0.22499999999999998 No Hit GGAAGATCCTGAATAAATCCTACTGTATCTGAAAGAAGAACACTGTAGCC 8 0.2 No Hit CGGCTGTCGAGTTGTACGGCCGTTCAGCCACGAGTCACGGGGTCTAACGC 6 0.15 No Hit CTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGT 6 0.15 No Hit CTTTGGTATAGTTGGGATTTTAATATCATTAATAGCATGATGGTGATTGT 6 0.15 No Hit CTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAGTT 5 0.125 No Hit GCCATTCGGACCTACCGTAAGCCTATATTTCGTTTTTCTGAGACCTATCC 5 0.125 No Hit GCTATCTATCCCTACCAAGGCTTATATTGAAGTATAAACCAATGAGAGAG 5 0.125 No Hit GCCTTCTCTCGTTCTCGCCCGCTTTGCAAAAATATCTAATATCAATTGCG 5 0.125 No Hit CCGGGATCGGGCAAAGGGGCAACTCGAGCTAATCTCCCCAGCGGCTAGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.35 0.0 0.0 0.0 0.0 74-75 0.38749999999999996 0.0 0.0 0.0 0.0 76-77 0.525 0.0 0.0 0.0 0.0 78-79 0.55 0.0 0.0 0.0 0.0 80-81 0.6875 0.0 0.0 0.0 0.0 82-83 0.8875 0.0 0.0 0.0 0.0 84-85 1.025 0.0 0.0 0.0 0.0 86-87 1.275 0.0 0.0 0.0 0.0 88 1.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6127944 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6127944_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.71975 33.0 33.0 33.0 33.0 33.0 2 31.86525 33.0 33.0 33.0 33.0 33.0 3 31.94525 33.0 33.0 33.0 33.0 33.0 4 35.4645 37.0 37.0 37.0 33.0 37.0 5 35.44625 37.0 37.0 37.0 33.0 37.0 6 35.408 37.0 37.0 37.0 33.0 37.0 7 35.48575 37.0 37.0 37.0 33.0 37.0 8 35.60225 37.0 37.0 37.0 33.0 37.0 9 35.82475 37.0 37.0 37.0 37.0 37.0 10-11 35.883375 37.0 37.0 37.0 37.0 37.0 12-13 35.873625000000004 37.0 37.0 37.0 37.0 37.0 14-15 38.144875 40.0 37.0 40.0 37.0 40.0 16-17 38.087625 40.0 37.0 40.0 37.0 40.0 18-19 38.116875 40.0 37.0 40.0 37.0 40.0 20-21 38.10525 40.0 37.0 40.0 37.0 40.0 22-23 37.37625 40.0 37.0 40.0 33.0 40.0 24-25 37.823875 40.0 37.0 40.0 35.0 40.0 26-27 37.899125 40.0 37.0 40.0 37.0 40.0 28-29 37.906375 40.0 37.0 40.0 37.0 40.0 30-31 37.816874999999996 40.0 37.0 40.0 37.0 40.0 32-33 37.71625 40.0 37.0 40.0 35.0 40.0 34-35 37.746875 40.0 37.0 40.0 37.0 40.0 36-37 37.65775 40.0 37.0 40.0 35.0 40.0 38-39 37.509125 40.0 37.0 40.0 33.0 40.0 40-41 37.444 40.0 37.0 40.0 33.0 40.0 42-43 37.29975 40.0 37.0 40.0 33.0 40.0 44-45 37.150625000000005 40.0 37.0 40.0 33.0 40.0 46-47 36.973625 40.0 37.0 40.0 33.0 40.0 48-49 36.8345 40.0 37.0 40.0 33.0 40.0 50-51 35.135125 38.5 35.0 38.5 30.0 40.0 52-53 35.462875 37.0 35.0 38.5 33.0 40.0 54-55 36.1405 37.0 37.0 40.0 33.0 40.0 56-57 36.091750000000005 37.0 37.0 40.0 33.0 40.0 58-59 35.950375 37.0 37.0 40.0 33.0 40.0 60-61 35.611000000000004 37.0 37.0 40.0 33.0 40.0 62-63 35.440875000000005 37.0 37.0 40.0 33.0 40.0 64-65 35.278375 37.0 37.0 37.0 33.0 40.0 66-67 35.101625 37.0 37.0 37.0 33.0 40.0 68-69 34.80325 37.0 35.0 37.0 30.0 40.0 70-71 34.662125 37.0 33.0 37.0 33.0 40.0 72-73 34.464124999999996 37.0 33.0 37.0 30.0 38.5 74-75 34.24675 37.0 33.0 37.0 27.0 37.0 76-77 33.903375 37.0 33.0 37.0 27.0 37.0 78-79 33.536 37.0 33.0 37.0 27.0 37.0 80-81 33.46025 37.0 33.0 37.0 27.0 37.0 82-83 33.432874999999996 37.0 33.0 37.0 27.0 37.0 84-85 33.413 37.0 33.0 37.0 27.0 37.0 86-87 33.358374999999995 37.0 33.0 37.0 27.0 37.0 88-89 33.222625 37.0 33.0 37.0 27.0 37.0 90-91 33.18675 37.0 33.0 37.0 27.0 37.0 92-93 33.0135 37.0 33.0 37.0 27.0 37.0 94-95 32.884125 37.0 33.0 37.0 27.0 37.0 96-97 32.55825 37.0 33.0 37.0 24.5 37.0 98-99 32.56375 37.0 33.0 37.0 27.0 37.0 100-101 30.973374999999997 35.0 30.0 37.0 18.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 63.0 3 2.0 4 2.0 5 4.0 6 2.0 7 3.0 8 2.0 9 7.0 10 4.0 11 5.0 12 7.0 13 6.0 14 4.0 15 5.0 16 9.0 17 6.0 18 3.0 19 8.0 20 5.0 21 6.0 22 12.0 23 13.0 24 16.0 25 13.0 26 17.0 27 29.0 28 46.0 29 25.0 30 40.0 31 57.0 32 87.0 33 104.0 34 167.0 35 229.0 36 500.0 37 1472.0 38 1018.0 39 2.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.3 16.900000000000002 11.200000000000001 36.6 2 27.950000000000003 23.125 30.4 18.525 3 24.25 25.650000000000002 25.650000000000002 24.45 4 26.0 33.375 19.775000000000002 20.849999999999998 5 27.650000000000002 34.449999999999996 19.275000000000002 18.625 6 21.5 36.55 20.349999999999998 21.6 7 21.2 17.150000000000002 36.8 24.85 8 22.575 22.400000000000002 25.85 29.175 9 24.875 21.125 28.075 25.924999999999997 10-11 26.6625 29.2375 19.5875 24.5125 12-13 26.450000000000003 23.3375 25.137500000000003 25.074999999999996 14-15 25.275 26.775 23.825 24.125 16-17 26.674999999999997 25.837500000000002 23.125 24.3625 18-19 26.137500000000003 25.887500000000003 23.9 24.075 20-21 25.424999999999997 25.7375 24.462500000000002 24.375 22-23 25.8625 25.95 24.2375 23.95 24-25 25.5 26.325 23.724999999999998 24.45 26-27 25.775 27.125 24.625 22.475 28-29 26.674999999999997 25.637500000000003 24.675 23.0125 30-31 26.4625 25.624999999999996 23.6125 24.3 32-33 26.0375 26.487500000000004 24.5 22.975 34-35 26.125 25.624999999999996 24.887500000000003 23.3625 36-37 26.174999999999997 25.7 24.125 24.0 38-39 26.3 26.7125 23.625 23.3625 40-41 25.95 25.4875 24.825 23.7375 42-43 25.0125 26.575 24.099999999999998 24.3125 44-45 26.125 26.150000000000002 24.1125 23.6125 46-47 26.3625 25.85 24.8 22.9875 48-49 26.25 25.0625 24.887500000000003 23.799999999999997 50-51 26.35 26.5625 24.099999999999998 22.9875 52-53 26.275 25.55 25.0125 23.1625 54-55 26.025 25.775 23.925 24.275 56-57 24.762500000000003 26.5125 25.224999999999998 23.5 58-59 26.575 25.825 24.15 23.45 60-61 26.275 26.4625 23.3875 23.875 62-63 25.275 26.3 25.15 23.275000000000002 64-65 26.3125 26.137500000000003 23.9375 23.6125 66-67 25.387500000000003 26.1 24.625 23.8875 68-69 25.0 26.3625 25.4375 23.200000000000003 70-71 25.587500000000002 25.174999999999997 25.074999999999996 24.1625 72-73 25.124999999999996 25.7125 25.112499999999997 24.05 74-75 25.087500000000002 26.325 24.375 24.212500000000002 76-77 25.7125 26.2625 24.3875 23.6375 78-79 25.7125 26.35 24.9 23.0375 80-81 25.424999999999997 27.3375 24.625 22.6125 82-83 26.337500000000002 26.187500000000004 24.4375 23.0375 84-85 25.209453545079402 26.710016256096036 24.434162811054144 23.646367387770415 86-87 25.0125 26.275 24.637500000000003 24.075 88-89 26.575 26.187500000000004 24.1875 23.05 90-91 25.7 27.474999999999998 24.075 22.75 92-93 26.25 25.5125 25.0375 23.200000000000003 94-95 26.9125 26.187500000000004 24.0375 22.8625 96-97 26.400000000000002 25.874999999999996 25.112499999999997 22.6125 98-99 25.637500000000003 27.474999999999998 24.125 22.7625 100-101 26.724999999999998 26.325 24.25 22.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 1.0 27 1.5 28 2.0 29 6.0 30 11.0 31 16.0 32 22.0 33 26.0 34 34.5 35 42.0 36 59.0 37 81.0 38 90.5 39 102.0 40 107.0 41 104.5 42 109.0 43 118.0 44 137.5 45 166.0 46 184.5 47 188.5 48 181.0 49 171.0 50 157.5 51 149.5 52 159.5 53 173.0 54 163.5 55 158.5 56 158.0 57 126.5 58 111.5 59 107.0 60 95.5 61 81.5 62 58.5 63 51.5 64 46.0 65 39.0 66 31.5 67 26.0 68 29.5 69 24.0 70 14.5 71 12.5 72 14.0 73 13.0 74 9.5 75 5.0 76 3.5 77 3.5 78 3.5 79 2.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0375 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.375 #Duplication Level Percentage of deduplicated Percentage of total 1 94.37077131258458 87.175 2 4.059539918809202 7.5 3 0.9472259810554804 2.625 4 0.43301759133964823 1.6 5 0.027063599458728015 0.125 6 0.08119079837618402 0.44999999999999996 7 0.08119079837618402 0.525 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 7 0.17500000000000002 No Hit GAAAATTCTATGGAAGAGCTAGCATCTCTGACGAAAACAGCAGACGGAAA 7 0.17500000000000002 No Hit CTCGTAACCAAACATGCACAGCGGTCAAACAGTATGTCCCAAGGGGACTT 7 0.17500000000000002 No Hit CTGTCATTCGCCATAGAAGCCGATACCGTGAAAGAAGAAAGAAAAACGGT 6 0.15 No Hit CAGAAATCGCATTCATGAAATCAACACACAGCTTTCCACTGTCATTCGCC 6 0.15 No Hit CTCTCATTGGTTTATACTTCAATATAAGCCTTGGTAGGGATAGATAGCCA 6 0.15 No Hit GGCAAACTTCAAATTGAGCTGGCTCAGCTGCAATATGCACTGCCGCGTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.11249999999999999 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.325 0.0 0.0 0.0 0.0 74-75 0.36250000000000004 0.0 0.0 0.0 0.0 76-77 0.5 0.0 0.0 0.0 0.0 78-79 0.55 0.0 0.0 0.0 0.0 80-81 0.6875 0.0 0.0 0.0 0.0 82-83 0.8999999999999999 0.0 0.0 0.0 0.0 84-85 1.0750000000000002 0.0 0.0 0.0 0.0 86-87 1.3375 0.0 0.0 0.0 0.0 88-89 1.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1466533 spots for SRR6127944.sra Written 1466533 spots for SRR6127944.sra Read 1466533 spots for SRR6127944.sra Written 1466533 spots for SRR6127944.sra Read 1466533 spots for SRR6127944.sra Written 1466533 spots for SRR6127944.sra Read 1466533 spots for SRR6127944.sra Written 1466533 spots for SRR6127944.sra Read 1466533 spots for SRR6127944.sra Written 1466533 spots for SRR6127944.sra Read 1466533 spots for SRR6127944.sra Written 1466533 spots for SRR6127944.sra Read 1466533 spots for SRR6127944.sra Written 1466533 spots for SRR6127944.sra Read 1466533 spots for SRR6127944.sra Written 1466533 spots for SRR6127944.sra Read 1466533 spots for SRR6127944.sra Written 1466533 spots for SRR6127944.sra Read 1466533 spots for SRR6127944.sra Written 1466533 spots for SRR6127944.sra Read 1466533 spots for SRR6127944.sra Written 1466533 spots for SRR6127944.sra Read 1466533 spots for SRR6127944.sra Written 1466533 spots for SRR6127944.sra Read 1466533 spots for SRR6127944.sra Written 1466533 spots for SRR6127944.sra Read 1466533 spots for SRR6127944.sra Written 1466533 spots for SRR6127944.sra Read 1466533 spots for SRR6127944.sra Written 1466533 spots for SRR6127944.sra Read 1466533 spots for SRR6127944.sra Written 1466533 spots for SRR6127944.sra Read 1466533 spots for SRR6127944.sra Written 1466533 spots for SRR6127944.sra Read 1466542 spots for SRR6127944.sra Written 1466542 spots for SRR6127944.sra Read 1466533 spots for SRR6127944.sra Written 1466533 spots for SRR6127944.sra Read 1466533 spots for SRR6127944.sra Written 1466533 spots for SRR6127944.sra SRR ids: ['SRR6127944.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ejt4jzsm SRR6127944.sra spots: 29330669 blocks: [[1, 1466533], [1466534, 2933066], [2933067, 4399599], [4399600, 5866132], [5866133, 7332665], [7332666, 8799198], [8799199, 10265731], [10265732, 11732264], [11732265, 13198797], [13198798, 14665330], [14665331, 16131863], [16131864, 17598396], [17598397, 19064929], [19064930, 20531462], [20531463, 21997995], [21997996, 23464528], [23464529, 24931061], [24931062, 26397594], [26397595, 27864127], [27864128, 29330669]] SRR6127944 file size 6995891 SRR6127944 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6127944 SRR6127944_1.fastq SRR6127944_2.fastq Input file: SRR6127944_1.fastq Paired file: SRR6127944_2.fastq trimmed: SRR6127944-trimmed-pair1.fastq, SRR6127944-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 04:45:16 2024 >> started Tue Dec 10 04:45:47 2024 >> done (30.217s) 29330669 read pairs processed; of these: 118422 ( 0.40%) short read pairs filtered out after trimming by size control 374698 ( 1.28%) empty read pairs filtered out after trimming by size control 28837549 (98.32%) read pairs available; of these: 5072171 (17.59%) trimmed read pairs available after processing 23765378 (82.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 17 0.00% 20 30 0.00% 21 54 0.00% 22 97 0.00% 23 99 0.00% 24 167 0.00% 25 221 0.00% 26 264 0.00% 27 333 0.00% 28 415 0.00% 29 511 0.00% 30 594 0.00% 31 737 0.00% 32 835 0.00% 33 1010 0.00% 34 1203 0.00% 35 1320 0.00% 36 1464 0.01% 37 1664 0.01% 38 1901 0.01% 39 2092 0.01% 40 2317 0.01% 41 2583 0.01% 42 2888 0.01% 43 3274 0.01% 44 3512 0.01% 45 3834 0.01% 46 4202 0.01% 47 4543 0.02% 48 4971 0.02% 49 5246 0.02% 50 5982 0.02% 51 6274 0.02% 52 6860 0.02% 53 7360 0.03% 54 7998 0.03% 55 8832 0.03% 56 9426 0.03% 57 10486 0.04% 58 11294 0.04% 59 20908 0.07% 60 22121 0.08% 61 23243 0.08% 62 27103 0.09% 63 28026 0.10% 64 30705 0.11% 65 33115 0.11% 66 32905 0.11% 67 33980 0.12% 68 35736 0.12% 69 39879 0.14% 70 40653 0.14% 71 42852 0.15% 72 46007 0.16% 73 46201 0.16% 74 48662 0.17% 75 47348 0.16% 76 47486 0.16% 77 51285 0.18% 78 54306 0.19% 79 58058 0.20% 80 61121 0.21% 81 67162 0.23% 82 73195 0.25% 83 80334 0.28% 84 88685 0.31% 85 98093 0.34% 86 112884 0.39% 87 113874 0.39% 88 113430 0.39% 89 113394 0.39% 90 129046 0.45% 91 137429 0.48% 92 153595 0.53% 93 169314 0.59% 94 193812 0.67% 95 224204 0.78% 96 270157 0.94% 97 332678 1.15% 98 418282 1.45% 99 529133 1.83% 100 24420225 84.68% 28837549 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=30 prefix-density=0.40 prefix-fanout=2.0 sequence=TTCGCTATCGGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=6.32 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=3.0 sequence=CTCGAGCAATCCGCCGACAGCCGACGGGTTTGGGGCCGGGACCCCCGAGCCCAGTCCTCAGAGCCAATCCTTTTCCCGAAGTTACGGATCCGTTTTGCCGACTTCCCTTGCCTACATTGTTCCATTGGCCAGAGGCTGTTCACCTTGGAGACCTGATGCGGTTATGAGTACGACCGGGCGTGAACGGTACTCGGTCCTCCGGATTTTCATGGGCCGCCGGGGGCGCACCGGACACCGCGCGACGTGCGGTGCTCTTCCGGCCACTGGACCCTACCTCCGGCTGAACCGATTCCAGGGTTGGCAGGCCGTTAAGCAGAAAAGATAACTCTTCCCGAGGCCCCCGCCGGCGTCTCCGGACTTCCTAACGTCGCCGTCAACCGCCACATCCCGGCTCGGGAAATCTTAACCCGATTCCCTTTCGGGGGATACGCGTGATCGCGCTATCTGCCGGGGTTACCCCGTCCCTTAGGATCGGCTTACCCATGTGCAAGTGCCGTTCACATGGAACCTT criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=21 prefix-density=0.45 prefix-fanout=2.1 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.26 sequence-density-rank=11 fanout-score=9.46 fanout-score-rank=1 prefix-density=1.05 prefix-fanout=2.3 sequence=TGAAGCAGATCGAGTA SRR6127944 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 04:46:41 Started mapping on | Dec 10 04:46:41 Finished on | Dec 10 05:03:51 Mapping speed, Million of reads per hour | 100.79 Number of input reads | 28837549 Average input read length | 197 UNIQUE READS: Uniquely mapped reads number | 16517739 Uniquely mapped reads % | 57.28% Average mapped length | 196.78 Number of splices: Total | 10337574 Number of splices: Annotated (sjdb) | 9802135 Number of splices: GT/AG | 10197033 Number of splices: GC/AG | 119240 Number of splices: AT/AC | 3063 Number of splices: Non-canonical | 18238 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.12 Insertion rate per base | 0.02% Insertion average length | 2.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2075070 % of reads mapped to multiple loci | 7.20% Number of reads mapped to too many loci | 287409 % of reads mapped to too many loci | 1.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 29.70% % of reads unmapped: other | 4.83% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 10256399 10256399 10256399 N_multimapping 2075070 2075070 2075070 N_noFeature 1285838 16092456 1407872 N_ambiguous 355054 1828 53280 UnstrandedReadsAssigned:14876847 PositiveStrandReadsAssigned:423455 NegativeStrandReadsAssigned:15056587 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR6127944 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6127944-trimmed-pair1.fastq SRR6127944-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,837,549 reads, 15,425,078 reads pseudoaligned [quant] estimated average fragment length: 161.766 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52973 SRR6127944.ke.tsv 35125 SRR6127944.se.tsv 88098 total ==> SRR6127944.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 775.408 0 0 PNS24247 1044 883.234 40.9956 4.15032 PNS24249 1928 1767.23 69.3551 3.50917 PNS24246 1044 883.234 40.9956 4.15032 PNS24248 1044 883.234 40.9956 4.15032 PNS24244 1471 1310.23 100.658 6.86942 PNS24243 293 138.452 0 0 KQK14069 1603 1442.23 7937.92 492.143 KQK14071 474 314.661 46.751 13.2852 ==> SRR6127944.se.tsv <== BRADI_1g14170v3 8448 BRADI_1g53295v3 183 BRADI_1g59795v3 56 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 164 BRADI_1g74790v3 191 BRADI_1g09890v3 0 BRADI_1g77505v3 195 BRADI_1g48960v3 0 SRR6127944 completed mapping pipeline successfully