Starting /dee2/code/volunteer_pipeline.sh SRR6127946 current disk space = 1526089625600 free memory = 1552485736 SRR6127946 SRAfilesize 5b2b96424c18f94e60cae435bb8cdee1 SRR6127946.sra SRR6127946.sra file validated SRR6127946 is paired end SRR6127946 is conventional basespace SRR6127946 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6127946_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.376 33.0 33.0 33.0 33.0 33.0 2 32.5385 33.0 33.0 33.0 33.0 33.0 3 32.768 33.0 33.0 33.0 33.0 33.0 4 36.71725 37.0 37.0 37.0 37.0 37.0 5 36.696 37.0 37.0 37.0 37.0 37.0 6 36.7095 37.0 37.0 37.0 37.0 37.0 7 36.64675 37.0 37.0 37.0 37.0 37.0 8 36.69575 37.0 37.0 37.0 37.0 37.0 9 36.65225 37.0 37.0 37.0 37.0 37.0 10-11 36.6915 37.0 37.0 37.0 37.0 37.0 12-13 36.630875 37.0 37.0 37.0 37.0 37.0 14-15 38.980000000000004 40.0 40.0 40.0 37.0 40.0 16-17 38.9845 40.0 40.0 40.0 37.0 40.0 18-19 39.00725 40.0 40.0 40.0 37.0 40.0 20-21 38.945375 40.0 40.0 40.0 37.0 40.0 22-23 38.827875000000006 40.0 40.0 40.0 37.0 40.0 24-25 38.842124999999996 40.0 40.0 40.0 37.0 40.0 26-27 38.744749999999996 40.0 37.0 40.0 37.0 40.0 28-29 38.676125 40.0 38.5 40.0 37.0 40.0 30-31 38.65175 40.0 37.0 40.0 37.0 40.0 32-33 38.580749999999995 40.0 38.5 40.0 37.0 40.0 34-35 38.473124999999996 40.0 37.0 40.0 37.0 40.0 36-37 38.4125 40.0 37.0 40.0 37.0 40.0 38-39 38.258250000000004 40.0 37.0 40.0 37.0 40.0 40-41 38.187250000000006 40.0 37.0 40.0 37.0 40.0 42-43 37.991125 40.0 37.0 40.0 35.0 40.0 44-45 37.869 40.0 37.0 40.0 33.0 40.0 46-47 37.63175 40.0 37.0 40.0 33.0 40.0 48-49 37.612375 40.0 37.0 40.0 33.0 40.0 50-51 37.516875 40.0 37.0 40.0 33.0 40.0 52-53 37.248875 40.0 37.0 40.0 33.0 40.0 54-55 36.83925 37.0 37.0 40.0 33.0 40.0 56-57 36.762375000000006 37.0 37.0 40.0 33.0 40.0 58-59 36.591375 37.0 37.0 40.0 33.0 40.0 60-61 36.329 37.0 37.0 40.0 33.0 40.0 62-63 36.079375 37.0 37.0 40.0 33.0 40.0 64-65 35.926375 37.0 37.0 40.0 33.0 40.0 66-67 35.52475 37.0 37.0 38.5 33.0 40.0 68-69 35.3125 37.0 37.0 37.0 33.0 40.0 70-71 34.996624999999995 37.0 33.0 37.0 33.0 40.0 72-73 34.78325 37.0 33.0 37.0 33.0 40.0 74-75 34.335375 37.0 33.0 37.0 27.0 37.0 76-77 31.785875 33.0 30.0 35.0 24.5 37.0 78-79 33.474374999999995 37.0 33.0 37.0 27.0 37.0 80-81 33.646874999999994 37.0 33.0 37.0 27.0 37.0 82-83 33.705625 37.0 33.0 37.0 27.0 37.0 84-85 33.60275 37.0 33.0 37.0 27.0 37.0 86-87 33.474000000000004 37.0 33.0 37.0 27.0 37.0 88-89 33.2875 37.0 33.0 37.0 27.0 37.0 90-91 33.215375 37.0 33.0 37.0 27.0 37.0 92-93 33.06925 37.0 33.0 37.0 27.0 37.0 94-95 32.827 37.0 33.0 37.0 27.0 37.0 96-97 32.678625 37.0 33.0 37.0 27.0 37.0 98-99 32.229749999999996 37.0 33.0 37.0 22.0 37.0 100 28.57925 33.0 27.0 37.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 3.0 10 4.0 11 3.0 12 7.0 13 2.0 14 5.0 15 6.0 16 5.0 17 7.0 18 8.0 19 4.0 20 13.0 21 10.0 22 8.0 23 13.0 24 19.0 25 18.0 26 27.0 27 23.0 28 30.0 29 41.0 30 49.0 31 86.0 32 75.0 33 122.0 34 167.0 35 237.0 36 543.0 37 1264.0 38 1199.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.984568682013666 13.837591702504426 7.361497596761953 41.81634201871996 2 23.799999999999997 17.075000000000003 36.325 22.8 3 20.65 23.225 24.85 31.275 4 26.125 29.5 21.25 23.125 5 25.825 32.175 23.325000000000003 18.675 6 20.05 33.825 24.825 21.3 7 15.925 20.3 42.25 21.525 8 20.375 22.35 28.95 28.325 9 20.1 20.200000000000003 32.75 26.950000000000003 10-11 24.099999999999998 29.9375 21.375 24.587500000000002 12-13 22.575 23.0125 27.212500000000002 27.200000000000003 14-15 22.900000000000002 25.7875 26.05 25.2625 16-17 23.1 25.424999999999997 25.5625 25.912499999999998 18-19 23.45 24.65 25.900000000000002 26.0 20-21 23.125 25.7375 25.55 25.587500000000002 22-23 23.1625 25.7125 24.9875 26.137500000000003 24-25 23.125 24.975 25.55 26.35 26-27 22.425 25.0625 27.525 24.9875 28-29 22.6125 25.1875 26.737499999999997 25.4625 30-31 23.275000000000002 26.075 25.7375 24.9125 32-33 23.45 26.200000000000003 24.8625 25.4875 34-35 22.95 25.687500000000004 26.174999999999997 25.1875 36-37 23.9875 25.85 25.5625 24.6 38-39 23.1 25.2125 25.337500000000002 26.35 40-41 22.825 26.25 25.637500000000003 25.2875 42-43 22.7125 25.9875 25.525 25.775 44-45 22.900000000000002 25.337500000000002 26.8125 24.95 46-47 23.375 26.0375 26.075 24.5125 48-49 23.8125 25.162499999999998 25.775 25.25 50-51 24.1375 25.45 25.9875 24.425 52-53 23.849999999999998 25.4625 25.0 25.687500000000004 54-55 23.2375 25.3125 25.5125 25.937500000000004 56-57 23.6375 25.275 25.6125 25.474999999999998 58-59 22.5875 26.150000000000002 25.575 25.687500000000004 60-61 23.225 24.975 25.7625 26.0375 62-63 24.2 25.662499999999998 25.7625 24.375 64-65 23.575 25.7125 25.9625 24.75 66-67 23.3375 25.6125 26.0125 25.0375 68-69 23.4125 25.124999999999996 26.625 24.837500000000002 70-71 24.5 24.5 25.7125 25.2875 72-73 23.799999999999997 24.8125 25.9625 25.424999999999997 74-75 22.925 25.174999999999997 26.075 25.825 76-77 23.674999999999997 25.650000000000002 25.362499999999997 25.3125 78-79 23.6375 24.6125 26.087500000000002 25.662499999999998 80-81 23.599999999999998 25.2625 26.474999999999998 24.6625 82-83 23.875 24.8625 25.275 25.9875 84-85 23.75 25.937500000000004 25.2375 25.074999999999996 86-87 23.8875 24.55 26.2875 25.275 88-89 23.9375 25.7875 25.362499999999997 24.9125 90-91 23.474999999999998 24.837500000000002 25.7625 25.924999999999997 92-93 23.6875 25.587500000000002 25.6125 25.112499999999997 94-95 23.3875 26.224999999999998 25.337500000000002 25.05 96-97 24.7 25.4375 24.925 24.9375 98-99 24.1875 25.974999999999998 25.575 24.2625 100 24.75 25.974999999999998 24.7 24.575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 2.5 28 2.5 29 5.5 30 8.5 31 14.0 32 23.5 33 27.0 34 34.5 35 51.5 36 64.0 37 81.0 38 103.0 39 106.0 40 109.5 41 127.0 42 143.0 43 161.0 44 186.5 45 197.5 46 196.0 47 193.0 48 196.5 49 190.5 50 174.5 51 161.5 52 146.5 53 134.0 54 124.5 55 116.5 56 99.0 57 84.0 58 72.5 59 78.5 60 85.0 61 64.0 62 54.5 63 56.0 64 49.0 65 41.0 66 38.0 67 36.5 68 35.5 69 29.5 70 20.0 71 18.5 72 13.5 73 9.0 74 8.0 75 7.5 76 5.5 77 3.0 78 3.0 79 2.5 80 2.5 81 1.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.625 #Duplication Level Percentage of deduplicated Percentage of total 1 96.75816993464052 92.525 2 2.3529411764705883 4.5 3 0.6797385620915033 1.95 4 0.130718954248366 0.5 5 0.052287581699346414 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026143790849673207 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAAGATCCTGAATAAATCCTACTGTATCTGAAAGAAGAACACTGTAGCC 11 0.27499999999999997 No Hit GTCAATCATCTTCACTTCAATTGCTGTTGCCAATGACTTCAGCTGACTTG 5 0.125 No Hit GCCTTCTCTCGTTCTCGCCCGCTTTGCAAAAATATCTAATATCAATTGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0875 0.0 0.0 0.0 0.0 56-57 0.1375 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.2625 0.0 0.0 0.0 0.0 72-73 0.325 0.0 0.0 0.0 0.0 74-75 0.44999999999999996 0.0 0.0 0.0 0.0 76-77 0.6125 0.0 0.0 0.0 0.0 78-79 0.8500000000000001 0.0 0.0 0.0 0.0 80-81 0.975 0.0 0.0 0.0 0.0 82-83 1.1875 0.0 0.0 0.0 0.0 84-85 1.3125 0.0 0.0 0.0 0.0 86-87 1.5750000000000002 0.0 0.0 0.0 0.0 88 1.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6127946 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6127946_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9875 33.0 33.0 33.0 33.0 33.0 2 32.0575 33.0 33.0 33.0 33.0 33.0 3 32.154 33.0 33.0 33.0 33.0 33.0 4 35.74725 37.0 37.0 37.0 33.0 37.0 5 35.665 37.0 37.0 37.0 33.0 37.0 6 35.5955 37.0 37.0 37.0 33.0 37.0 7 35.6535 37.0 37.0 37.0 33.0 37.0 8 35.79325 37.0 37.0 37.0 37.0 37.0 9 35.9875 37.0 37.0 37.0 37.0 37.0 10-11 36.0745 37.0 37.0 37.0 37.0 37.0 12-13 36.044875000000005 37.0 37.0 37.0 37.0 37.0 14-15 38.298874999999995 40.0 40.0 40.0 37.0 40.0 16-17 38.342625 40.0 38.5 40.0 37.0 40.0 18-19 38.338875 40.0 40.0 40.0 37.0 40.0 20-21 38.269 40.0 38.5 40.0 37.0 40.0 22-23 37.710499999999996 40.0 37.0 40.0 33.0 40.0 24-25 38.062375 40.0 37.0 40.0 37.0 40.0 26-27 38.0985 40.0 37.0 40.0 37.0 40.0 28-29 38.167375 40.0 37.0 40.0 37.0 40.0 30-31 38.078374999999994 40.0 37.0 40.0 37.0 40.0 32-33 37.956 40.0 37.0 40.0 37.0 40.0 34-35 37.957499999999996 40.0 37.0 40.0 37.0 40.0 36-37 37.912000000000006 40.0 37.0 40.0 37.0 40.0 38-39 37.789249999999996 40.0 37.0 40.0 37.0 40.0 40-41 37.609875 40.0 37.0 40.0 33.0 40.0 42-43 37.623875 40.0 37.0 40.0 35.0 40.0 44-45 37.489 40.0 37.0 40.0 33.0 40.0 46-47 37.346125 40.0 37.0 40.0 33.0 40.0 48-49 37.22324999999999 40.0 37.0 40.0 33.0 40.0 50-51 35.649125 38.5 35.0 38.5 30.0 40.0 52-53 35.886625 37.0 37.0 38.5 33.0 40.0 54-55 36.620875 37.0 37.0 40.0 33.0 40.0 56-57 36.5445 37.0 37.0 40.0 33.0 40.0 58-59 36.395125 37.0 37.0 40.0 33.0 40.0 60-61 36.091375 37.0 37.0 40.0 33.0 40.0 62-63 35.881 37.0 37.0 40.0 33.0 40.0 64-65 35.764375 37.0 37.0 40.0 33.0 40.0 66-67 35.618750000000006 37.0 37.0 38.5 33.0 40.0 68-69 35.293 37.0 37.0 37.0 33.0 40.0 70-71 35.1315 37.0 37.0 37.0 33.0 40.0 72-73 34.8555 37.0 37.0 37.0 33.0 40.0 74-75 34.6135 37.0 35.0 37.0 33.0 37.0 76-77 34.33375 37.0 33.0 37.0 33.0 37.0 78-79 34.011125 37.0 33.0 37.0 30.0 37.0 80-81 33.8975 37.0 33.0 37.0 27.0 37.0 82-83 33.778125 37.0 33.0 37.0 27.0 37.0 84-85 33.81675 37.0 33.0 37.0 27.0 37.0 86-87 33.801874999999995 37.0 33.0 37.0 27.0 37.0 88-89 33.6555 37.0 33.0 37.0 27.0 37.0 90-91 33.568375 37.0 33.0 37.0 27.0 37.0 92-93 33.416 37.0 33.0 37.0 27.0 37.0 94-95 33.335 37.0 33.0 37.0 27.0 37.0 96-97 33.2285 37.0 33.0 37.0 27.0 37.0 98-99 33.200125 37.0 33.0 37.0 27.0 37.0 100-101 31.620125 35.0 30.0 37.0 21.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 42.0 3 1.0 4 4.0 5 3.0 6 3.0 7 4.0 8 2.0 9 5.0 10 5.0 11 6.0 12 5.0 13 5.0 14 8.0 15 4.0 16 6.0 17 7.0 18 8.0 19 7.0 20 6.0 21 4.0 22 8.0 23 12.0 24 11.0 25 21.0 26 11.0 27 20.0 28 25.0 29 27.0 30 39.0 31 53.0 32 73.0 33 93.0 34 151.0 35 214.0 36 433.0 37 1511.0 38 1162.0 39 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.75 17.875 10.174999999999999 35.199999999999996 2 26.474999999999998 25.4 31.95 16.175 3 23.425 26.85 26.275 23.45 4 26.224999999999998 32.65 19.675 21.45 5 25.900000000000002 34.949999999999996 19.825 19.325 6 20.7 36.325 21.25 21.725 7 21.349999999999998 17.8 35.949999999999996 24.9 8 21.9 21.4 26.05 30.65 9 24.4 21.45 27.175 26.974999999999998 10-11 26.2625 28.725 20.4 24.6125 12-13 26.0 22.85 25.05 26.1 14-15 23.825 26.1 25.85 24.224999999999998 16-17 25.6 25.637500000000003 25.0375 23.724999999999998 18-19 26.9125 25.162499999999998 24.45 23.474999999999998 20-21 25.55638909727432 24.781195298824706 25.006251562890725 24.656164041010253 22-23 25.1 25.25 25.05 24.6 24-25 24.962500000000002 26.0125 24.975 24.05 26-27 25.15 25.674999999999997 25.1 24.075 28-29 25.5625 26.0 24.6625 23.775 30-31 25.650000000000002 25.8625 24.712500000000002 23.775 32-33 25.074999999999996 26.125 24.7375 24.0625 34-35 24.962500000000002 26.625 25.4 23.0125 36-37 25.374999999999996 24.962500000000002 24.9 24.762500000000003 38-39 25.650000000000002 24.8125 25.687500000000004 23.849999999999998 40-41 24.7 25.4 25.025 24.875 42-43 24.7 25.974999999999998 25.9875 23.3375 44-45 24.325 26.337500000000002 25.362499999999997 23.974999999999998 46-47 25.95 25.374999999999996 24.8125 23.8625 48-49 25.7375 24.587500000000002 25.174999999999997 24.5 50-51 24.25 26.375 25.162499999999998 24.212500000000002 52-53 25.525 25.424999999999997 25.724999999999998 23.325000000000003 54-55 26.150000000000002 26.424999999999997 24.4 23.025000000000002 56-57 24.712500000000002 26.437500000000004 24.8 24.05 58-59 26.137500000000003 25.224999999999998 25.137500000000003 23.5 60-61 25.8125 26.137500000000003 24.25 23.799999999999997 62-63 25.05 27.1125 24.1875 23.65 64-65 24.887500000000003 26.125 25.4875 23.5 66-67 24.962500000000002 26.200000000000003 24.712500000000002 24.125 68-69 25.387500000000003 27.037499999999998 24.4 23.175 70-71 25.7375 24.887500000000003 24.8625 24.5125 72-73 24.95 25.3 25.174999999999997 24.575 74-75 26.0 25.662499999999998 25.5 22.8375 76-77 25.9625 25.525 24.675 23.8375 78-79 25.340667583447928 25.91573946743343 25.66570821352669 23.07788473559195 80-81 24.625 26.1125 25.7375 23.525 82-83 25.593898474618655 26.994248562140534 24.36859214803701 23.0432608152038 84-85 25.94445834375782 25.431573680260193 25.494120590442833 23.129847385539154 86-87 25.1875 25.5125 25.825 23.474999999999998 88-89 25.8 26.775 24.1875 23.2375 90-91 25.7125 26.8 24.7 22.787499999999998 92-93 25.724999999999998 25.974999999999998 25.412499999999998 22.8875 94-95 26.325 25.85 24.425 23.400000000000002 96-97 25.1 27.474999999999998 24.7875 22.6375 98-99 26.275 27.1125 24.099999999999998 22.5125 100-101 26.9625 26.6 24.712500000000002 21.725 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.0 26 3.0 27 4.0 28 2.5 29 3.5 30 11.0 31 21.5 32 24.5 33 21.0 34 29.0 35 45.5 36 59.0 37 67.5 38 84.0 39 113.5 40 120.5 41 125.5 42 142.0 43 154.5 44 166.0 45 178.0 46 190.0 47 195.5 48 198.0 49 192.5 50 166.0 51 146.5 52 143.0 53 134.0 54 122.5 55 113.0 56 105.5 57 102.5 58 94.0 59 89.0 60 93.0 61 75.0 62 56.5 63 54.5 64 57.0 65 55.5 66 48.0 67 41.5 68 34.0 69 24.5 70 20.5 71 17.5 72 12.0 73 10.0 74 7.5 75 5.5 76 4.0 77 1.0 78 0.5 79 0.5 80 0.5 81 1.5 82 1.5 83 1.0 84 0.5 85 1.0 86 1.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.025 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0125 80-81 0.0 82-83 0.025 84-85 0.075 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.775 #Duplication Level Percentage of deduplicated Percentage of total 1 96.97206995562516 92.875 2 2.1665361524406164 4.15 3 0.4437483685721744 1.275 4 0.33933698773166276 1.3 5 0.05220569042025581 0.25 6 0.026102845210127904 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGCATTTTGAAAATTCTATGGAAGAGCTAGCATCTCTGACGAAAACAGCA 6 0.15 No Hit CTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGGTT 5 0.125 No Hit CGAATAGCTCGTAACCAAACATGCACAGCGGTCAAACAGTATGTCCCAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0875 0.0 0.0 0.0 0.0 56-57 0.1375 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.2625 0.0 0.0 0.0 0.0 72-73 0.325 0.0 0.0 0.0 0.0 74-75 0.475 0.0 0.0 0.0 0.0 76-77 0.6375 0.0 0.0 0.0 0.0 78-79 0.8999999999999999 0.0 0.0 0.0 0.0 80-81 1.025 0.0 0.0 0.0 0.0 82-83 1.2625 0.0 0.0 0.0 0.0 84-85 1.3875 0.0 0.0 0.0 0.0 86-87 1.6625 0.0 0.0 0.0 0.0 88-89 2.0875000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1318358 spots for SRR6127946.sra Written 1318358 spots for SRR6127946.sra Read 1318358 spots for SRR6127946.sra Written 1318358 spots for SRR6127946.sra Read 1318358 spots for SRR6127946.sra Written 1318358 spots for SRR6127946.sra Read 1318358 spots for SRR6127946.sra Written 1318358 spots for SRR6127946.sra Read 1318358 spots for SRR6127946.sra Written 1318358 spots for SRR6127946.sra Read 1318377 spots for SRR6127946.sra Written 1318377 spots for SRR6127946.sra Read 1318358 spots for SRR6127946.sra Written 1318358 spots for SRR6127946.sra Read 1318358 spots for SRR6127946.sra Written 1318358 spots for SRR6127946.sra Read 1318358 spots for SRR6127946.sra Written 1318358 spots for SRR6127946.sra Read 1318358 spots for SRR6127946.sra Written 1318358 spots for SRR6127946.sra Read 1318358 spots for SRR6127946.sra Written 1318358 spots for SRR6127946.sra Read 1318358 spots for SRR6127946.sra Written 1318358 spots for SRR6127946.sra Read 1318358 spots for SRR6127946.sra Written 1318358 spots for SRR6127946.sra Read 1318358 spots for SRR6127946.sra Written 1318358 spots for SRR6127946.sra Read 1318358 spots for SRR6127946.sra Written 1318358 spots for SRR6127946.sra Read 1318358 spots for SRR6127946.sra Written 1318358 spots for SRR6127946.sra Read 1318358 spots for SRR6127946.sra Written 1318358 spots for SRR6127946.sra Read 1318358 spots for SRR6127946.sra Written 1318358 spots for SRR6127946.sra Read 1318358 spots for SRR6127946.sra Written 1318358 spots for SRR6127946.sra Read 1318358 spots for SRR6127946.sra Written 1318358 spots for SRR6127946.sra SRR ids: ['SRR6127946.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9y9o5llj SRR6127946.sra spots: 26367179 blocks: [[1, 1318358], [1318359, 2636716], [2636717, 3955074], [3955075, 5273432], [5273433, 6591790], [6591791, 7910148], [7910149, 9228506], [9228507, 10546864], [10546865, 11865222], [11865223, 13183580], [13183581, 14501938], [14501939, 15820296], [15820297, 17138654], [17138655, 18457012], [18457013, 19775370], [19775371, 21093728], [21093729, 22412086], [22412087, 23730444], [23730445, 25048802], [25048803, 26367179]] SRR6127946 file size 6286853 SRR6127946 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6127946 SRR6127946_1.fastq SRR6127946_2.fastq Input file: SRR6127946_1.fastq Paired file: SRR6127946_2.fastq trimmed: SRR6127946-trimmed-pair1.fastq, SRR6127946-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 04:52:27 2024 >> started Tue Dec 10 04:52:55 2024 >> done (27.766s) 26367179 read pairs processed; of these: 97351 ( 0.37%) short read pairs filtered out after trimming by size control 289294 ( 1.10%) empty read pairs filtered out after trimming by size control 25980534 (98.53%) read pairs available; of these: 4525929 (17.42%) trimmed read pairs available after processing 21454605 (82.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 28 0.00% 19 18 0.00% 20 38 0.00% 21 52 0.00% 22 87 0.00% 23 101 0.00% 24 156 0.00% 25 221 0.00% 26 270 0.00% 27 341 0.00% 28 337 0.00% 29 509 0.00% 30 544 0.00% 31 619 0.00% 32 806 0.00% 33 892 0.00% 34 997 0.00% 35 1159 0.00% 36 1305 0.01% 37 1352 0.01% 38 1568 0.01% 39 1730 0.01% 40 2002 0.01% 41 2324 0.01% 42 2379 0.01% 43 2714 0.01% 44 2857 0.01% 45 3278 0.01% 46 3616 0.01% 47 3974 0.02% 48 4210 0.02% 49 4611 0.02% 50 5223 0.02% 51 5645 0.02% 52 5958 0.02% 53 6508 0.03% 54 7120 0.03% 55 7794 0.03% 56 8385 0.03% 57 9136 0.04% 58 10410 0.04% 59 18287 0.07% 60 19084 0.07% 61 20369 0.08% 62 22823 0.09% 63 24168 0.09% 64 26515 0.10% 65 28695 0.11% 66 28585 0.11% 67 30229 0.12% 68 31763 0.12% 69 34096 0.13% 70 35282 0.14% 71 37722 0.15% 72 39752 0.15% 73 41591 0.16% 74 43344 0.17% 75 41427 0.16% 76 41121 0.16% 77 45876 0.18% 78 49132 0.19% 79 52469 0.20% 80 55472 0.21% 81 62395 0.24% 82 67386 0.26% 83 75250 0.29% 84 82160 0.32% 85 90049 0.35% 86 103086 0.40% 87 105104 0.40% 88 103437 0.40% 89 104806 0.40% 90 116122 0.45% 91 126187 0.49% 92 138903 0.53% 93 153517 0.59% 94 176114 0.68% 95 201258 0.77% 96 238290 0.92% 97 293570 1.13% 98 368330 1.42% 99 466237 1.79% 100 22029257 84.79% 25980534 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=7.11 fanout-score-rank=8 prefix-density=0.21 prefix-fanout=4.8 sequence=AGGTTCTCGAGGGGACCCTTGCCGGTGACAATGGCCTGGACGAAGAACCCAAACATG criterion=fanout-score sequence-density=0.08 sequence-density-rank=14 fanout-score=23.82 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=2.0 sequence=TTCGTTTTTTTTCTTG criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=5.70 fanout-score-rank=4 prefix-density=0.68 prefix-fanout=1.8 sequence=TTGAAGCAGATCGAGTATCTCATCCGCTCCAAGTGGGTTCCTTGCCTCGAGTTCAGCAAGGTCGGTTTCGTCTTCCGTGAGCACGGCAACTCTCCCGGGTACTACGACGGCAGGTACTGGACAATGTGGAAGCTTCCCATGTTCGGGTGCACCGACGCCACGCAGGTGCTAAAGGAGCTGGAGGAGGTGAAGAAGGAGTACCCTGACGCCTATGTCCGCATCATCGGCTTCGACAACACCAGGCAAGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGGCAAGGCCTAAGCAAGTTGATTTCTTATAATACAAGAACGGGTCACACCGATTTTATTTACCTTTTTCACACGTTTGTTTCATGTTGTATTTATGCATGTGATCTCTCCCAACAACCCGGATTAACTGTATTCATGAGTACTACTATTATAAGAGTACTACAACTATCGTTGGGAGAGGGGCATGTAATATAAACTCCGGTTATACATATTAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=9.34 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=4.3 sequence=CAGAGCATCCTCGCCATCTGGGCTTGCCAGGTCGT SRR6127946 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 04:53:44 Started mapping on | Dec 10 04:53:44 Finished on | Dec 10 05:05:55 Mapping speed, Million of reads per hour | 127.95 Number of input reads | 25980534 Average input read length | 197 UNIQUE READS: Uniquely mapped reads number | 19204666 Uniquely mapped reads % | 73.92% Average mapped length | 196.61 Number of splices: Total | 12996712 Number of splices: Annotated (sjdb) | 12302565 Number of splices: GT/AG | 12809214 Number of splices: GC/AG | 157277 Number of splices: AT/AC | 5450 Number of splices: Non-canonical | 24771 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.02% Deletion average length | 2.31 Insertion rate per base | 0.02% Insertion average length | 1.96 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 469950 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 74413 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 22.54% % of reads unmapped: other | 1.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6318564 6318564 6318564 N_multimapping 469950 469950 469950 N_noFeature 946178 18674243 1118322 N_ambiguous 414517 2303 57589 UnstrandedReadsAssigned:17843971 PositiveStrandReadsAssigned:528120 NegativeStrandReadsAssigned:18028755 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR6127946 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6127946-trimmed-pair1.fastq SRR6127946-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,980,534 reads, 18,163,262 reads pseudoaligned [quant] estimated average fragment length: 166.436 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52973 SRR6127946.ke.tsv 35125 SRR6127946.se.tsv 88098 total ==> SRR6127946.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 770.735 0 0 PNS24247 1044 878.564 74.9672 7.12314 PNS24249 1928 1762.56 51.2725 2.42836 PNS24246 1044 878.564 74.9672 7.12314 PNS24248 1044 878.564 74.9672 7.12314 PNS24244 1471 1305.56 209.826 13.4164 PNS24243 293 136.234 0 0 KQK14069 1603 1437.56 7701.11 447.198 KQK14071 474 310.309 51.7306 13.9164 ==> SRR6127946.se.tsv <== BRADI_1g14170v3 8242 BRADI_1g53295v3 683 BRADI_1g59795v3 125 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 425 BRADI_1g74790v3 63 BRADI_1g09890v3 0 BRADI_1g77505v3 322 BRADI_1g48960v3 0 SRR6127946 completed mapping pipeline successfully