Starting /dee2/code/volunteer_pipeline.sh SRR6127947 current disk space = 1526191759360 free memory = 1555115296 SRR6127947 SRAfilesize db2b781af813b09fa4e5eaa5725b9407 SRR6127947.sra SRR6127947.sra file validated SRR6127947 is paired end SRR6127947 is conventional basespace SRR6127947 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6127947_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.26025 33.0 33.0 33.0 33.0 33.0 2 32.491 33.0 33.0 33.0 33.0 33.0 3 32.7165 33.0 33.0 33.0 33.0 33.0 4 36.74 37.0 37.0 37.0 37.0 37.0 5 36.7225 37.0 37.0 37.0 37.0 37.0 6 36.72225 37.0 37.0 37.0 37.0 37.0 7 36.65975 37.0 37.0 37.0 37.0 37.0 8 36.6415 37.0 37.0 37.0 37.0 37.0 9 36.6965 37.0 37.0 37.0 37.0 37.0 10-11 36.71325 37.0 37.0 37.0 37.0 37.0 12-13 36.665 37.0 37.0 37.0 37.0 37.0 14-15 38.991625 40.0 40.0 40.0 37.0 40.0 16-17 39.021375 40.0 40.0 40.0 37.0 40.0 18-19 38.981750000000005 40.0 40.0 40.0 37.0 40.0 20-21 38.965875 40.0 40.0 40.0 37.0 40.0 22-23 38.891 40.0 40.0 40.0 37.0 40.0 24-25 38.851 40.0 40.0 40.0 37.0 40.0 26-27 38.784125 40.0 40.0 40.0 37.0 40.0 28-29 38.785875 40.0 40.0 40.0 37.0 40.0 30-31 38.716375 40.0 40.0 40.0 37.0 40.0 32-33 38.689125000000004 40.0 40.0 40.0 37.0 40.0 34-35 38.57025 40.0 37.0 40.0 37.0 40.0 36-37 38.54275 40.0 37.0 40.0 37.0 40.0 38-39 38.361125 40.0 37.0 40.0 37.0 40.0 40-41 38.305875 40.0 37.0 40.0 37.0 40.0 42-43 38.12625 40.0 37.0 40.0 37.0 40.0 44-45 38.074375 40.0 37.0 40.0 37.0 40.0 46-47 37.939 40.0 37.0 40.0 35.0 40.0 48-49 37.864125 40.0 37.0 40.0 35.0 40.0 50-51 37.661625 40.0 37.0 40.0 33.0 40.0 52-53 37.43662500000001 40.0 37.0 40.0 33.0 40.0 54-55 37.03875 40.0 37.0 40.0 33.0 40.0 56-57 37.018249999999995 38.5 37.0 40.0 33.0 40.0 58-59 36.77175 37.0 37.0 40.0 33.0 40.0 60-61 36.540875 37.0 37.0 40.0 33.0 40.0 62-63 36.366875 37.0 37.0 40.0 33.0 40.0 64-65 36.16575 37.0 37.0 40.0 33.0 40.0 66-67 35.8125 37.0 37.0 40.0 33.0 40.0 68-69 35.504625000000004 37.0 37.0 37.0 33.0 40.0 70-71 35.301 37.0 37.0 37.0 33.0 40.0 72-73 35.065 37.0 33.0 37.0 33.0 40.0 74-75 34.695750000000004 37.0 33.0 37.0 30.0 38.5 76-77 32.126625 33.0 33.0 37.0 24.5 37.0 78-79 33.78175 37.0 33.0 37.0 27.0 37.0 80-81 33.935 37.0 33.0 37.0 27.0 37.0 82-83 34.027375 37.0 33.0 37.0 27.0 37.0 84-85 33.969875 37.0 33.0 37.0 27.0 37.0 86-87 33.952625 37.0 33.0 37.0 27.0 37.0 88-89 33.62475 37.0 33.0 37.0 27.0 37.0 90-91 33.697874999999996 37.0 33.0 37.0 27.0 37.0 92-93 33.564 37.0 33.0 37.0 27.0 37.0 94-95 33.377125 37.0 33.0 37.0 27.0 37.0 96-97 33.15825 37.0 33.0 37.0 27.0 37.0 98-99 32.731 37.0 33.0 37.0 27.0 37.0 100 29.39925 33.0 27.0 37.0 15.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 4.0 11 0.0 12 7.0 13 8.0 14 6.0 15 5.0 16 3.0 17 8.0 18 5.0 19 9.0 20 5.0 21 8.0 22 12.0 23 8.0 24 12.0 25 13.0 26 17.0 27 22.0 28 29.0 29 25.0 30 57.0 31 63.0 32 93.0 33 118.0 34 160.0 35 226.0 36 483.0 37 1292.0 38 1298.0 39 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.35198372329604 13.987792472024415 7.146490335707019 40.51373346897253 2 22.8 16.875 37.824999999999996 22.5 3 19.25 23.549999999999997 26.05 31.15 4 24.45 29.175 22.75 23.625 5 25.025 33.85 22.925 18.2 6 19.275000000000002 35.55 24.825 20.349999999999998 7 15.4 22.75 41.25 20.599999999999998 8 19.725 21.875 30.225 28.175 9 18.925 21.7 34.050000000000004 25.324999999999996 10-11 23.4375 30.5 22.0875 23.974999999999998 12-13 21.9 24.587500000000002 27.625 25.887500000000003 14-15 22.25 26.275 27.474999999999998 24.0 16-17 23.2625 26.325 25.8125 24.6 18-19 22.2 25.674999999999997 26.525 25.6 20-21 23.0125 25.4375 26.787499999999998 24.762500000000003 22-23 22.375 27.1625 25.3 25.162499999999998 24-25 21.7375 26.075 27.187499999999996 25.0 26-27 22.375 25.7875 27.3125 24.525 28-29 22.5 26.6625 26.0625 24.775 30-31 21.475 26.437500000000004 27.35 24.7375 32-33 22.025 26.637499999999996 26.875 24.462500000000002 34-35 21.8125 26.025 26.487500000000004 25.674999999999997 36-37 21.8125 26.224999999999998 26.825 25.137500000000003 38-39 22.650000000000002 25.5625 26.724999999999998 25.0625 40-41 23.1875 26.337500000000002 26.25 24.224999999999998 42-43 22.5 26.174999999999997 26.400000000000002 24.925 44-45 22.275 26.35 26.0 25.374999999999996 46-47 23.35 26.400000000000002 25.75 24.5 48-49 22.95 25.624999999999996 26.05 25.374999999999996 50-51 22.8625 25.8 26.5875 24.75 52-53 23.400000000000002 26.3 26.087500000000002 24.212500000000002 54-55 23.825 25.587500000000002 26.125 24.462500000000002 56-57 22.7375 26.437500000000004 25.924999999999997 24.9 58-59 22.475 26.75 26.25 24.525 60-61 22.287499999999998 26.1125 26.0625 25.5375 62-63 23.2875 26.5625 26.174999999999997 23.974999999999998 64-65 23.025000000000002 27.2625 25.7375 23.974999999999998 66-67 22.0875 26.375 26.4625 25.074999999999996 68-69 23.3625 25.9875 25.575 25.074999999999996 70-71 23.325000000000003 26.1 26.424999999999997 24.15 72-73 23.4375 25.224999999999998 26.6 24.7375 74-75 23.075000000000003 25.337500000000002 25.900000000000002 25.687500000000004 76-77 22.7125 26.375 26.150000000000002 24.762500000000003 78-79 22.575 25.7375 26.275 25.412499999999998 80-81 23.5125 25.7625 25.525 25.2 82-83 22.6875 26.3 25.75 25.2625 84-85 23.45 26.5875 25.1 24.8625 86-87 23.2625 25.900000000000002 26.2875 24.55 88-89 22.875 24.925 26.674999999999997 25.525 90-91 23.6125 25.2625 26.375 24.75 92-93 22.625 26.0 27.05 24.325 94-95 23.625 26.5625 25.8125 24.0 96-97 23.5125 25.387500000000003 25.662499999999998 25.4375 98-99 23.25 26.075 26.0625 24.6125 100 22.975 25.624999999999996 24.875 26.525 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 1.0 26 3.0 27 5.0 28 5.5 29 9.5 30 17.5 31 20.5 32 21.5 33 31.5 34 47.0 35 54.0 36 65.5 37 87.5 38 106.0 39 122.5 40 134.5 41 143.5 42 147.0 43 163.5 44 184.0 45 195.5 46 207.0 47 221.5 48 238.5 49 204.5 50 158.0 51 151.0 52 152.5 53 154.0 54 127.5 55 88.5 56 78.5 57 79.0 58 75.0 59 68.5 60 63.0 61 57.0 62 52.0 63 47.5 64 37.0 65 24.0 66 24.0 67 25.5 68 23.0 69 23.0 70 15.0 71 9.0 72 5.5 73 3.5 74 4.0 75 2.5 76 3.5 77 3.5 78 1.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.5 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7000000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.35 #Duplication Level Percentage of deduplicated Percentage of total 1 96.36989931107578 90.925 2 2.0932697403285636 3.95 3 1.0333863275039745 2.9250000000000003 4 0.2649708532061473 1.0 5 0.1589825119236884 0.75 6 0.0794912559618442 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCACTTCAATTGCTGTTGCCAATGACTTCAGCTGACTTGGCGACAGTT 6 0.15 No Hit GGAAGATCCTGAATAAATCCTACTGTATCTGAAAGAAGAACACTGTAGCC 6 0.15 No Hit GTTGATACCGTCTGCGATAGGCTAGTTCATAAACGAGGGGCGATGCCCGG 6 0.15 No Hit CAATCATCTTCACTTCAATTGCTGTTGCCAATGACTTCAGCTGACTTGGC 5 0.125 No Hit GTCCAGCGTGGCAAACAGGAGGTCTTCTTCATAGCTGTCAGCACTCGTCA 5 0.125 No Hit GCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGA 5 0.125 No Hit CGAGGATGTTCCTGTTGATACCGTCTGCGATAGGCTAGTTCATAAACGAG 5 0.125 No Hit GGTCAATCATCTTCACTTCAATTGCTGTTGCCAATGACTTCAGCTGACTT 5 0.125 No Hit GGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.7 0.0 0.0 0.0 0.0 88 0.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6127947 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6127947_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0145 33.0 33.0 33.0 33.0 33.0 2 32.108 33.0 33.0 33.0 33.0 33.0 3 32.18325 33.0 33.0 33.0 33.0 33.0 4 35.75875 37.0 37.0 37.0 33.0 37.0 5 35.65075 37.0 37.0 37.0 33.0 37.0 6 35.6125 37.0 37.0 37.0 33.0 37.0 7 35.66325 37.0 37.0 37.0 33.0 37.0 8 35.86475 37.0 37.0 37.0 37.0 37.0 9 36.115 37.0 37.0 37.0 37.0 37.0 10-11 36.170249999999996 37.0 37.0 37.0 37.0 37.0 12-13 36.187875000000005 37.0 37.0 37.0 37.0 37.0 14-15 38.4375 40.0 40.0 40.0 37.0 40.0 16-17 38.386624999999995 40.0 40.0 40.0 37.0 40.0 18-19 38.460375 40.0 40.0 40.0 37.0 40.0 20-21 38.40275 40.0 40.0 40.0 37.0 40.0 22-23 37.681875 40.0 37.0 40.0 33.0 40.0 24-25 38.15425 40.0 37.0 40.0 37.0 40.0 26-27 38.23475 40.0 37.0 40.0 37.0 40.0 28-29 38.242125 40.0 37.0 40.0 37.0 40.0 30-31 38.164375 40.0 37.0 40.0 37.0 40.0 32-33 38.0525 40.0 37.0 40.0 37.0 40.0 34-35 38.113 40.0 37.0 40.0 37.0 40.0 36-37 38.035375 40.0 37.0 40.0 37.0 40.0 38-39 37.877875 40.0 37.0 40.0 35.0 40.0 40-41 37.79475 40.0 37.0 40.0 35.0 40.0 42-43 37.711875 40.0 37.0 40.0 33.0 40.0 44-45 37.537625 40.0 37.0 40.0 33.0 40.0 46-47 37.448375 40.0 37.0 40.0 33.0 40.0 48-49 37.334125 40.0 37.0 40.0 33.0 40.0 50-51 35.65375 38.5 35.0 38.5 30.0 40.0 52-53 36.065 37.0 37.0 38.5 33.0 40.0 54-55 36.804500000000004 37.0 37.0 40.0 33.0 40.0 56-57 36.841875 37.0 37.0 40.0 33.0 40.0 58-59 36.633624999999995 37.0 37.0 40.0 33.0 40.0 60-61 36.27175 37.0 37.0 40.0 33.0 40.0 62-63 36.074250000000006 37.0 37.0 40.0 33.0 40.0 64-65 35.85175 37.0 37.0 40.0 33.0 40.0 66-67 35.679875 37.0 37.0 38.5 33.0 40.0 68-69 35.43875 37.0 37.0 37.0 33.0 40.0 70-71 35.205875 37.0 37.0 37.0 33.0 40.0 72-73 34.98125 37.0 37.0 37.0 33.0 40.0 74-75 34.811125000000004 37.0 37.0 37.0 33.0 37.0 76-77 34.439625 37.0 33.0 37.0 30.0 37.0 78-79 34.06375 37.0 33.0 37.0 30.0 37.0 80-81 34.0025 37.0 33.0 37.0 27.0 37.0 82-83 33.824375 37.0 33.0 37.0 27.0 37.0 84-85 33.858875 37.0 33.0 37.0 27.0 37.0 86-87 33.888875 37.0 33.0 37.0 27.0 37.0 88-89 33.835 37.0 33.0 37.0 27.0 37.0 90-91 33.74025 37.0 33.0 37.0 27.0 37.0 92-93 33.586375 37.0 33.0 37.0 27.0 37.0 94-95 33.486125 37.0 33.0 37.0 27.0 37.0 96-97 33.2705 37.0 33.0 37.0 27.0 37.0 98-99 33.304874999999996 37.0 33.0 37.0 27.0 37.0 100-101 31.714624999999998 35.0 30.0 37.0 21.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 31.0 3 6.0 4 1.0 5 2.0 6 2.0 7 2.0 8 2.0 9 5.0 10 2.0 11 3.0 12 5.0 13 2.0 14 9.0 15 10.0 16 3.0 17 4.0 18 6.0 19 9.0 20 7.0 21 8.0 22 12.0 23 12.0 24 10.0 25 18.0 26 15.0 27 20.0 28 28.0 29 34.0 30 36.0 31 60.0 32 73.0 33 106.0 34 152.0 35 179.0 36 462.0 37 1425.0 38 1239.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.05 18.625 9.575 35.75 2 26.6 23.7 32.925 16.775000000000002 3 21.475 26.325 27.35 24.85 4 24.55 34.525 20.45 20.474999999999998 5 25.674999999999997 34.425 21.125 18.775 6 22.1 37.45 20.225 20.225 7 19.650000000000002 18.224999999999998 38.224999999999994 23.9 8 21.825 22.0 26.25 29.925 9 23.75 22.25 27.875 26.125 10-11 25.637500000000003 29.625 20.575 24.1625 12-13 25.2375 23.1875 25.374999999999996 26.200000000000003 14-15 24.587500000000002 25.387500000000003 26.3 23.724999999999998 16-17 25.374999999999996 26.1625 24.837500000000002 23.625 18-19 25.05 25.937500000000004 24.95 24.0625 20-21 24.668667166791696 26.331582895723933 24.63115778944736 24.36859214803701 22-23 25.412499999999998 26.087500000000002 25.6125 22.8875 24-25 24.125 26.0625 25.387500000000003 24.425 26-27 24.224999999999998 26.075 26.25 23.45 28-29 25.837500000000002 26.275 24.962500000000002 22.925 30-31 23.8875 26.375 25.0 24.7375 32-33 25.162499999999998 26.687499999999996 25.2125 22.9375 34-35 24.637500000000003 26.337500000000002 24.95 24.075 36-37 25.112499999999997 25.8625 25.3125 23.7125 38-39 24.837500000000002 26.0375 25.974999999999998 23.150000000000002 40-41 26.05 24.95 25.825 23.175 42-43 25.2625 26.637499999999996 25.162499999999998 22.9375 44-45 24.0 26.424999999999997 26.2875 23.2875 46-47 26.075 25.874999999999996 25.724999999999998 22.325 48-49 25.362499999999997 25.087500000000002 25.525 24.025 50-51 25.2625 27.224999999999998 25.15 22.3625 52-53 24.1375 26.85 25.4375 23.575 54-55 24.3125 26.6625 25.8125 23.2125 56-57 24.9875 26.687499999999996 25.724999999999998 22.6 58-59 25.2 25.724999999999998 25.75 23.325000000000003 60-61 24.837500000000002 26.5625 24.962500000000002 23.6375 62-63 24.025 27.1125 25.874999999999996 22.9875 64-65 23.962500000000002 26.337500000000002 26.137500000000003 23.5625 66-67 24.3875 26.4625 26.1625 22.9875 68-69 25.0 26.325 26.0375 22.6375 70-71 24.875 26.0375 25.937500000000004 23.150000000000002 72-73 24.7 26.224999999999998 26.474999999999998 22.6 74-75 23.925 26.787499999999998 25.137500000000003 24.15 76-77 25.124999999999996 26.275 25.8 22.8 78-79 23.74343585896474 27.206801700425103 25.381345336334082 23.668417104276067 80-81 25.7875 25.087500000000002 25.650000000000002 23.474999999999998 82-83 25.04376094023506 27.44436109027257 25.468867216804203 22.043010752688172 84-85 24.97185036907294 26.748404854247465 25.74752908795196 22.532215688727636 86-87 24.875 26.737499999999997 25.387500000000003 23.0 88-89 25.900000000000002 26.825 24.9125 22.3625 90-91 24.4875 26.437500000000004 26.1125 22.9625 92-93 25.75 26.625 25.5625 22.0625 94-95 25.7625 26.1 25.937500000000004 22.2 96-97 24.75 27.800000000000004 25.0 22.45 98-99 25.124999999999996 27.1 25.412499999999998 22.3625 100-101 27.0 26.7625 24.1375 22.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.0 23 0.5 24 0.5 25 1.0 26 1.0 27 1.0 28 5.0 29 11.0 30 14.5 31 19.0 32 24.0 33 27.5 34 39.0 35 53.5 36 55.5 37 77.0 38 92.0 39 105.5 40 141.5 41 145.5 42 151.5 43 165.5 44 177.5 45 191.0 46 192.5 47 200.0 48 191.0 49 182.0 50 187.5 51 170.5 52 145.5 53 134.0 54 128.0 55 111.0 56 99.0 57 100.0 58 94.5 59 84.5 60 63.5 61 51.5 62 60.0 63 54.5 64 43.0 65 35.0 66 32.5 67 31.0 68 22.0 69 20.5 70 17.5 71 12.5 72 11.5 73 7.0 74 3.0 75 3.0 76 2.5 77 1.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.025 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.025 80-81 0.0 82-83 0.025 84-85 0.08750000000000001 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.35 #Duplication Level Percentage of deduplicated Percentage of total 1 96.48662821185108 92.0 2 2.5170424750917673 4.8 3 0.6816990036706869 1.95 4 0.26219192448872575 1.0 5 0.05243838489774515 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCAATATAAGCCTTGGTAGGGATAGATAGCCACCTATATAGTATAGCT 5 0.125 No Hit CCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.7 0.0 0.0 0.0 0.0 88-89 0.8500000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1601003 spots for SRR6127947.sra Written 1601003 spots for SRR6127947.sra Read 1601003 spots for SRR6127947.sra Written 1601003 spots for SRR6127947.sra Read 1601003 spots for SRR6127947.sra Written 1601003 spots for SRR6127947.sra Read 1601003 spots for SRR6127947.sra Written 1601003 spots for SRR6127947.sra Read 1601003 spots for SRR6127947.sra Written 1601003 spots for SRR6127947.sra Read 1601003 spots for SRR6127947.sra Written 1601003 spots for SRR6127947.sra Read 1601003 spots for SRR6127947.sra Written 1601003 spots for SRR6127947.sra Read 1601003 spots for SRR6127947.sra Written 1601003 spots for SRR6127947.sra Read 1601003 spots for SRR6127947.sra Written 1601003 spots for SRR6127947.sra Read 1601003 spots for SRR6127947.sra Written 1601003 spots for SRR6127947.sra Read 1601003 spots for SRR6127947.sra Written 1601003 spots for SRR6127947.sra Read 1601003 spots for SRR6127947.sra Written 1601003 spots for SRR6127947.sra Read 1601003 spots for SRR6127947.sra Written 1601003 spots for SRR6127947.sra Read 1601015 spots for SRR6127947.sra Written 1601015 spots for SRR6127947.sra Read 1601003 spots for SRR6127947.sra Written 1601003 spots for SRR6127947.sra Read 1601003 spots for SRR6127947.sra Written 1601003 spots for SRR6127947.sra Read 1601003 spots for SRR6127947.sra Written 1601003 spots for SRR6127947.sra Read 1601003 spots for SRR6127947.sra Written 1601003 spots for SRR6127947.sra Read 1601003 spots for SRR6127947.sra Written 1601003 spots for SRR6127947.sra Read 1601003 spots for SRR6127947.sra Written 1601003 spots for SRR6127947.sra SRR ids: ['SRR6127947.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pvwuosbe SRR6127947.sra spots: 32020072 blocks: [[1, 1601003], [1601004, 3202006], [3202007, 4803009], [4803010, 6404012], [6404013, 8005015], [8005016, 9606018], [9606019, 11207021], [11207022, 12808024], [12808025, 14409027], [14409028, 16010030], [16010031, 17611033], [17611034, 19212036], [19212037, 20813039], [20813040, 22414042], [22414043, 24015045], [24015046, 25616048], [25616049, 27217051], [27217052, 28818054], [28818055, 30419057], [30419058, 32020072]] SRR6127947 file size 7639352 SRR6127947 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6127947 SRR6127947_1.fastq SRR6127947_2.fastq Input file: SRR6127947_1.fastq Paired file: SRR6127947_2.fastq trimmed: SRR6127947-trimmed-pair1.fastq, SRR6127947-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 04:55:13 2024 >> started Tue Dec 10 04:55:44 2024 >> done (30.407s) 32020072 read pairs processed; of these: 112587 ( 0.35%) short read pairs filtered out after trimming by size control 329013 ( 1.03%) empty read pairs filtered out after trimming by size control 31578472 (98.62%) read pairs available; of these: 4592763 (14.54%) trimmed read pairs available after processing 26985709 (85.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 14 0.00% 20 25 0.00% 21 58 0.00% 22 84 0.00% 23 97 0.00% 24 145 0.00% 25 208 0.00% 26 251 0.00% 27 278 0.00% 28 339 0.00% 29 459 0.00% 30 554 0.00% 31 640 0.00% 32 766 0.00% 33 937 0.00% 34 1025 0.00% 35 1108 0.00% 36 1275 0.00% 37 1521 0.00% 38 1654 0.01% 39 1877 0.01% 40 2027 0.01% 41 2216 0.01% 42 2461 0.01% 43 2749 0.01% 44 2952 0.01% 45 3471 0.01% 46 3710 0.01% 47 3991 0.01% 48 4272 0.01% 49 4837 0.02% 50 4937 0.02% 51 5322 0.02% 52 5945 0.02% 53 6354 0.02% 54 6800 0.02% 55 7667 0.02% 56 8080 0.03% 57 9110 0.03% 58 9844 0.03% 59 18928 0.06% 60 19773 0.06% 61 20834 0.07% 62 23354 0.07% 63 25073 0.08% 64 27123 0.09% 65 29205 0.09% 66 29414 0.09% 67 30630 0.10% 68 32014 0.10% 69 34437 0.11% 70 35840 0.11% 71 37371 0.12% 72 39324 0.12% 73 40234 0.13% 74 42872 0.14% 75 39358 0.12% 76 39189 0.12% 77 43396 0.14% 78 46741 0.15% 79 50482 0.16% 80 53786 0.17% 81 59908 0.19% 82 63560 0.20% 83 68375 0.22% 84 74918 0.24% 85 83635 0.26% 86 97970 0.31% 87 99315 0.31% 88 96335 0.31% 89 96156 0.30% 90 107549 0.34% 91 116982 0.37% 92 130721 0.41% 93 147172 0.47% 94 171486 0.54% 95 199693 0.63% 96 244648 0.77% 97 310543 0.98% 98 400392 1.27% 99 518826 1.64% 100 27620834 87.47% 31578472 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=25 prefix-density=0.13 prefix-fanout=2.0 sequence=GCAAGACATCTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=21 fanout-score=387.73 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=21.8 sequence=CTTCTTCTTCAACCATGATTTCAGCATGTTGAGCTTCGTCAGTTAAACCAGCGAATATATTAAGGTGTTCAGTTAAAATCTTTGAACCAAGCGCAATTGCTTCTTTCGGTCCAGTGCTTCCATCAGTCCAAACATCAAGTGTAAGTTTATCATAGTTTGCAACTTGGCCTACACGAGTGTTCTCTACCTGATAAGATACACGGGAAACTGGCGTATAGATAGAATCGATCGGAATCACGCCGATTGGCTGATCGCCTCTCTTGTTTGCGTCAGCAGGCGTATACCCACGTCCTCTTTGAGCAGTAAGGCGAACTCGGAAACTCGCATTCTCACCAAGAGTCGCGATATGAAGATCAGGATTTAAGATCTCTACATCACTATCGTGTGTAATATCAGCTGCCGTTACAGTTCCTTCACCCTGTACATCAATTTCTAGCGTCTTCTCTTCATCAGAGTAGATTTTCAATGCAAGCTTTTTAATGTGTAAGATAATCGTTGTAACATCTTCCAC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=7.08 fanout-score-rank=9 prefix-density=0.69 prefix-fanout=1.5 sequence=TTGAAGCAGATCGAGTATCTCATCCGCTCCAAGTGGGTTCCTTGCCTCGAGTTCAGCAAGGTCGGTTTCGTCTTCCGTGAGCACGGCAACTCTCCCGGGTACTACGACGGCAGGTACTGGACAATGTGGAAGCTTCCCATGTTCGGGTGCACCGACGCCACGCAGGTGCTAAAGGAGCTGGAGGAGGTGAAGAAGGAGTACCCTGACGCCTATGTCCGCATCATCGGCTTCGACAACACCAGGCAAGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGGCAAGGCCTAAGCAAGTTGATTTCTTATAATACAAGAACGGGTCACACCGATTTTATTTACCTTTTTCACACGTTTGTTTCATGTTGTATTTATGCATGTGATCTCTCCCAACAACCCGGATTAACTGTATTCATGAGTACTACTATTATAAGAGTACTACAACTATCGTTGGGAGAGGGGCATGTAATATAAACTCCGGTTATACATATTAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=14 fanout-score=210.78 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=25.5 sequence=AAGAAGAAGATCAAAAAGAGAAAGTTCTTGAAATGACAATTGAAGAATTGGATCTTTCTGTTCGTTCTTACAACTGCTTAAAGCGTGCGGGTATTAACACGGTTCAAGAGCTTGCGAACAAGACGGAAGAAGATATGATGAAAGTTCGAAATCTAGGACGCAAATCACTTGAAGAAGTGAAAGCGAGACTAGAAGAACTTGGACTCGGACTTCGCAAAGACGAT SRR6127947 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 04:56:35 Started mapping on | Dec 10 04:56:36 Finished on | Dec 10 05:12:17 Mapping speed, Million of reads per hour | 120.81 Number of input reads | 31578472 Average input read length | 197 UNIQUE READS: Uniquely mapped reads number | 22642922 Uniquely mapped reads % | 71.70% Average mapped length | 197.35 Number of splices: Total | 15414484 Number of splices: Annotated (sjdb) | 14597023 Number of splices: GT/AG | 15190627 Number of splices: GC/AG | 186656 Number of splices: AT/AC | 6919 Number of splices: Non-canonical | 30282 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.30 Insertion rate per base | 0.02% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 524799 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 70411 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 25.16% % of reads unmapped: other | 1.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 8424412 8424412 8424412 N_multimapping 524799 524799 524799 N_noFeature 1135128 22022595 1308779 N_ambiguous 511445 2903 66637 UnstrandedReadsAssigned:20996349 PositiveStrandReadsAssigned:617424 NegativeStrandReadsAssigned:21267506 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR6127947 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6127947-trimmed-pair1.fastq SRR6127947-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,578,472 reads, 21,447,218 reads pseudoaligned [quant] estimated average fragment length: 166.787 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,216 rounds 52973 SRR6127947.ke.tsv 35125 SRR6127947.se.tsv 88098 total ==> SRR6127947.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 770.403 0 0 PNS24247 1044 878.213 90.0013 7.31058 PNS24249 1928 1762.21 60.6774 2.45624 PNS24246 1044 878.213 90.0013 7.31058 PNS24248 1044 878.213 90.0013 7.31058 PNS24244 1471 1305.21 221.319 12.0959 PNS24243 293 133.658 1 0.533712 KQK14069 1603 1437.21 11530.6 572.312 KQK14071 474 309.717 46.7597 10.7698 ==> SRR6127947.se.tsv <== BRADI_1g14170v3 12303 BRADI_1g53295v3 772 BRADI_1g59795v3 140 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 313 BRADI_1g74790v3 102 BRADI_1g09890v3 0 BRADI_1g77505v3 400 BRADI_1g48960v3 0 SRR6127947 completed mapping pipeline successfully