Starting /dee2/code/volunteer_pipeline.sh SRR6127948 current disk space = 1526183337984 free memory = 1555193948 SRR6127948 SRAfilesize 0b8e822d6c1c03922cf9e871ada6d215 SRR6127948.sra SRR6127948.sra file validated SRR6127948 is paired end SRR6127948 is conventional basespace SRR6127948 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6127948_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2855 33.0 33.0 33.0 33.0 33.0 2 32.49125 33.0 33.0 33.0 33.0 33.0 3 32.7135 33.0 33.0 33.0 33.0 33.0 4 36.7135 37.0 37.0 37.0 37.0 37.0 5 36.69825 37.0 37.0 37.0 37.0 37.0 6 36.68225 37.0 37.0 37.0 37.0 37.0 7 36.63025 37.0 37.0 37.0 37.0 37.0 8 36.67175 37.0 37.0 37.0 37.0 37.0 9 36.67675 37.0 37.0 37.0 37.0 37.0 10-11 36.668499999999995 37.0 37.0 37.0 37.0 37.0 12-13 36.613375 37.0 37.0 37.0 37.0 37.0 14-15 38.931125 40.0 40.0 40.0 37.0 40.0 16-17 38.974125 40.0 40.0 40.0 37.0 40.0 18-19 38.938125 40.0 40.0 40.0 37.0 40.0 20-21 38.905125 40.0 40.0 40.0 37.0 40.0 22-23 38.753875 40.0 40.0 40.0 37.0 40.0 24-25 38.6905 40.0 38.5 40.0 37.0 40.0 26-27 38.561 40.0 37.0 40.0 37.0 40.0 28-29 38.615624999999994 40.0 37.0 40.0 37.0 40.0 30-31 38.513999999999996 40.0 37.0 40.0 37.0 40.0 32-33 38.426 40.0 37.0 40.0 37.0 40.0 34-35 38.3625 40.0 37.0 40.0 37.0 40.0 36-37 38.199 40.0 37.0 40.0 37.0 40.0 38-39 38.106750000000005 40.0 37.0 40.0 35.0 40.0 40-41 37.9915 40.0 37.0 40.0 33.0 40.0 42-43 37.688 40.0 37.0 40.0 33.0 40.0 44-45 37.681375 40.0 37.0 40.0 33.0 40.0 46-47 37.357749999999996 40.0 37.0 40.0 33.0 40.0 48-49 37.362125 40.0 37.0 40.0 33.0 40.0 50-51 37.138875 40.0 37.0 40.0 33.0 40.0 52-53 36.838750000000005 38.5 37.0 40.0 33.0 40.0 54-55 36.318375 37.0 37.0 40.0 33.0 40.0 56-57 36.325125 37.0 37.0 40.0 33.0 40.0 58-59 36.071625 37.0 37.0 40.0 33.0 40.0 60-61 35.889 37.0 37.0 40.0 33.0 40.0 62-63 35.68075 37.0 37.0 40.0 33.0 40.0 64-65 35.46825 37.0 37.0 37.0 33.0 40.0 66-67 34.926 37.0 33.0 37.0 30.0 40.0 68-69 34.718375 37.0 33.0 37.0 27.0 40.0 70-71 34.420375 37.0 33.0 37.0 27.0 40.0 72-73 34.130750000000006 37.0 33.0 37.0 27.0 37.0 74-75 33.760125 37.0 33.0 37.0 27.0 37.0 76-77 31.188499999999998 33.0 30.0 35.0 24.5 37.0 78-79 32.91025 37.0 33.0 37.0 27.0 37.0 80-81 33.016 37.0 33.0 37.0 27.0 37.0 82-83 33.076750000000004 37.0 33.0 37.0 27.0 37.0 84-85 33.07525 37.0 33.0 37.0 27.0 37.0 86-87 33.00625 37.0 33.0 37.0 27.0 37.0 88-89 32.849625 37.0 33.0 37.0 27.0 37.0 90-91 32.908874999999995 37.0 33.0 37.0 27.0 37.0 92-93 32.66575 37.0 33.0 37.0 27.0 37.0 94-95 32.541375 37.0 33.0 37.0 27.0 37.0 96-97 32.171625000000006 37.0 33.0 37.0 22.0 37.0 98-99 31.781125 37.0 33.0 37.0 18.5 37.0 100 28.057 33.0 27.0 33.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 2.0 10 5.0 11 3.0 12 7.0 13 7.0 14 7.0 15 7.0 16 7.0 17 11.0 18 7.0 19 10.0 20 16.0 21 6.0 22 15.0 23 14.0 24 14.0 25 26.0 26 27.0 27 37.0 28 35.0 29 47.0 30 60.0 31 79.0 32 98.0 33 137.0 34 170.0 35 255.0 36 553.0 37 1391.0 38 943.0 39 2.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.855403348554034 12.430238457635717 7.280568239472348 45.4337899543379 2 22.05 17.075000000000003 36.6 24.275 3 21.075 22.225 23.7 33.0 4 26.474999999999998 28.499999999999996 21.45 23.575 5 24.825 32.4 22.375 20.4 6 19.825 32.275 26.35 21.55 7 16.150000000000002 21.175 40.8 21.875 8 20.9 18.425 31.2 29.475 9 20.325 19.15 32.35 28.175 10-11 24.0375 30.3 21.4375 24.224999999999998 12-13 23.35 21.9375 27.4125 27.3 14-15 23.599999999999998 24.3875 25.874999999999996 26.137500000000003 16-17 23.7375 24.5375 25.124999999999996 26.6 18-19 22.9875 24.962500000000002 26.3 25.75 20-21 24.75 24.125 25.5 25.624999999999996 22-23 23.724999999999998 24.325 26.6125 25.337500000000002 24-25 23.2125 24.7875 26.1125 25.887500000000003 26-27 23.1 24.0625 25.775 27.0625 28-29 23.1125 24.474999999999998 26.6625 25.75 30-31 23.1625 24.7375 25.687500000000004 26.4125 32-33 23.425 25.75 25.424999999999997 25.4 34-35 23.1375 24.837500000000002 26.0125 26.0125 36-37 23.875 24.762500000000003 25.525 25.837500000000002 38-39 22.5875 24.3875 25.775 27.250000000000004 40-41 24.4125 24.65 25.074999999999996 25.8625 42-43 24.474999999999998 25.424999999999997 24.8625 25.2375 44-45 23.325000000000003 24.837500000000002 25.775 26.0625 46-47 23.4375 26.137500000000003 24.575 25.85 48-49 23.6625 24.8625 24.3625 27.1125 50-51 23.825 24.9875 25.362499999999997 25.825 52-53 23.8875 24.5625 25.7125 25.837500000000002 54-55 23.4125 24.4125 25.6 26.575 56-57 22.7 23.549999999999997 26.5375 27.212500000000002 58-59 22.275 25.224999999999998 26.950000000000003 25.55 60-61 23.1875 24.7 25.6 26.5125 62-63 22.5625 24.462500000000002 26.174999999999997 26.8 64-65 23.025000000000002 25.5 25.474999999999998 26.0 66-67 23.6375 24.6625 25.337500000000002 26.3625 68-69 24.224999999999998 25.8625 24.1125 25.8 70-71 24.637500000000003 24.625 26.0375 24.7 72-73 24.625 24.6875 24.5 26.187500000000004 74-75 23.7875 24.587500000000002 25.0 26.625 76-77 23.1 24.3 25.7125 26.887499999999996 78-79 22.9375 25.15 24.95 26.9625 80-81 23.4125 24.3875 25.587500000000002 26.6125 82-83 23.6875 25.2875 25.2875 25.7375 84-85 23.0375 24.4875 24.925 27.55 86-87 23.9 23.325000000000003 26.5 26.275 88-89 24.025 25.2625 25.112499999999997 25.6 90-91 23.8375 24.3 25.112499999999997 26.75 92-93 23.2375 24.3125 25.937500000000004 26.5125 94-95 24.3625 25.1 24.3625 26.174999999999997 96-97 23.474999999999998 24.8125 24.837500000000002 26.875 98-99 24.4875 24.325 25.0375 26.150000000000002 100 24.75 24.025 22.8 28.425 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 2.0 27 1.5 28 1.0 29 6.0 30 12.5 31 22.0 32 24.0 33 26.0 34 39.5 35 45.0 36 49.5 37 65.0 38 86.5 39 94.0 40 88.5 41 97.0 42 113.0 43 121.5 44 126.0 45 131.5 46 171.5 47 203.5 48 184.0 49 179.5 50 176.0 51 173.5 52 177.0 53 167.5 54 162.5 55 158.5 56 156.0 57 132.0 58 101.5 59 108.0 60 104.5 61 77.0 62 69.0 63 60.0 64 50.0 65 43.5 66 31.0 67 22.5 68 24.5 69 24.0 70 15.0 71 13.0 72 14.0 73 11.5 74 8.5 75 6.5 76 4.0 77 3.0 78 3.0 79 1.5 80 1.0 81 1.0 82 1.0 83 1.5 84 1.5 85 0.5 86 0.5 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.375 #Duplication Level Percentage of deduplicated Percentage of total 1 91.5983026874116 80.95 2 5.912305516265913 10.45 3 1.3295615275813295 3.5249999999999995 4 0.6789250353606789 2.4 5 0.16973125884016974 0.75 6 0.11315417256011315 0.6 7 0.14144271570014144 0.8750000000000001 8 0.0 0.0 9 0.056577086280056574 0.44999999999999996 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCACTTCAATTGCTGTTGCCAATGACTTCAGCTGACTTGGCGACAGTT 9 0.22499999999999998 No Hit CTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAAACCA 9 0.22499999999999998 No Hit GTTTACGGCTAGGACTACTGGGGTCTCTAATCCCATTTGCTCCCCTAGCT 7 0.17500000000000002 No Hit GCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAG 7 0.17500000000000002 No Hit CTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGT 7 0.17500000000000002 No Hit CAATGACTTCAGCTGACTTGGCGACAGTTCATCATTAAAGATGAGGAGAT 7 0.17500000000000002 No Hit CACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTT 7 0.17500000000000002 No Hit CAGCACTCGTCAGGCGGTTGAACCATGTTGATTTCCCTGCGTTTGTATAG 6 0.15 No Hit GTTGATACCGTCTGCGATAGGCTAGTTCATAAACGAGGGGCGATGCCCGG 6 0.15 No Hit GCCTTCTCTCGTTCTCGCCCGCTTTGCAAAAATATCTAATATCAATTGCG 6 0.15 No Hit CGCTGATTCCGCCAAGCCCGTTCCCTTGGCTGTGGTTTCGCTGGATAGTA 6 0.15 No Hit CGCATGACGAGGCAGTTTCCAGAAACGTGTATCACATCTAGGCATGGAAT 5 0.125 No Hit GTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGA 5 0.125 No Hit CTAAGAAGCTAGCTGCGGAGGGATGGCTCCGCATAGCTAGTTAGCAGGCT 5 0.125 No Hit GGCAGGTTCATTTTAAACGCGGTGACTAGGATGCTCATTTGAATGTCCCC 5 0.125 No Hit GTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGGGAA 5 0.125 No Hit CCCGTTTCAGGTGGTCCTCAGCGTACGGCGGGACCTCTGAGAATTGGGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.32499999999999996 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.7749999999999999 0.0 0.0 0.0 0.0 88 0.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6127948 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6127948_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.06 33.0 33.0 33.0 33.0 33.0 2 32.15525 33.0 33.0 33.0 33.0 33.0 3 32.18275 33.0 33.0 33.0 33.0 33.0 4 35.76525 37.0 37.0 37.0 33.0 37.0 5 35.64125 37.0 37.0 37.0 33.0 37.0 6 35.65875 37.0 37.0 37.0 33.0 37.0 7 35.61775 37.0 37.0 37.0 33.0 37.0 8 35.831 37.0 37.0 37.0 33.0 37.0 9 36.08125 37.0 37.0 37.0 33.0 37.0 10-11 36.140125 37.0 37.0 37.0 37.0 37.0 12-13 36.11775 37.0 37.0 37.0 37.0 37.0 14-15 38.338750000000005 40.0 37.0 40.0 37.0 40.0 16-17 38.303 40.0 38.5 40.0 37.0 40.0 18-19 38.3615 40.0 40.0 40.0 37.0 40.0 20-21 38.2855 40.0 37.0 40.0 37.0 40.0 22-23 37.47825 40.0 37.0 40.0 33.0 40.0 24-25 37.998374999999996 40.0 37.0 40.0 37.0 40.0 26-27 38.077375 40.0 37.0 40.0 37.0 40.0 28-29 38.10275 40.0 37.0 40.0 37.0 40.0 30-31 37.97175 40.0 37.0 40.0 37.0 40.0 32-33 37.833 40.0 37.0 40.0 33.0 40.0 34-35 37.836375000000004 40.0 37.0 40.0 35.0 40.0 36-37 37.72175 40.0 37.0 40.0 35.0 40.0 38-39 37.555 40.0 37.0 40.0 33.0 40.0 40-41 37.41525 40.0 37.0 40.0 33.0 40.0 42-43 37.355125 40.0 37.0 40.0 33.0 40.0 44-45 37.044624999999996 40.0 37.0 40.0 33.0 40.0 46-47 36.929 40.0 37.0 40.0 33.0 40.0 48-49 36.797250000000005 40.0 37.0 40.0 33.0 40.0 50-51 34.983875 37.0 35.0 38.5 30.0 38.5 52-53 35.305 37.0 35.0 38.5 30.0 40.0 54-55 36.05225 37.0 37.0 40.0 33.0 40.0 56-57 36.025875 37.0 37.0 40.0 33.0 40.0 58-59 35.789125 37.0 37.0 40.0 33.0 40.0 60-61 35.398875000000004 37.0 37.0 40.0 33.0 40.0 62-63 35.325 37.0 37.0 37.0 33.0 40.0 64-65 35.177125 37.0 37.0 37.0 33.0 40.0 66-67 34.953625 37.0 37.0 37.0 33.0 40.0 68-69 34.639125 37.0 33.0 37.0 33.0 40.0 70-71 34.581375 37.0 33.0 37.0 33.0 38.5 72-73 34.357625 37.0 33.0 37.0 27.0 37.0 74-75 34.086124999999996 37.0 33.0 37.0 27.0 37.0 76-77 33.812625 37.0 33.0 37.0 27.0 37.0 78-79 33.416875 37.0 33.0 37.0 27.0 37.0 80-81 33.369875 37.0 33.0 37.0 27.0 37.0 82-83 33.34075 37.0 33.0 37.0 27.0 37.0 84-85 33.34425 37.0 33.0 37.0 27.0 37.0 86-87 33.276250000000005 37.0 33.0 37.0 27.0 37.0 88-89 33.141125 37.0 33.0 37.0 27.0 37.0 90-91 33.160624999999996 37.0 33.0 37.0 27.0 37.0 92-93 32.916624999999996 37.0 33.0 37.0 27.0 37.0 94-95 32.79125 37.0 33.0 37.0 27.0 37.0 96-97 32.47525 37.0 33.0 37.0 22.0 37.0 98-99 32.37125 37.0 33.0 37.0 22.0 37.0 100-101 30.704749999999997 35.0 30.0 37.0 18.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 3.0 4 7.0 5 4.0 6 5.0 7 5.0 8 12.0 9 4.0 10 4.0 11 4.0 12 2.0 13 8.0 14 7.0 15 7.0 16 4.0 17 8.0 18 9.0 19 11.0 20 8.0 21 8.0 22 11.0 23 13.0 24 26.0 25 21.0 26 26.0 27 32.0 28 26.0 29 37.0 30 43.0 31 55.0 32 85.0 33 113.0 34 164.0 35 271.0 36 525.0 37 1556.0 38 851.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.875 17.549999999999997 9.15 37.425000000000004 2 30.9 22.35 28.7 18.05 3 23.65 26.224999999999998 26.125 24.0 4 27.025 33.85 18.4 20.724999999999998 5 28.95 32.550000000000004 18.8 19.7 6 22.825 36.025 19.875 21.275 7 21.15 16.575 37.4 24.875 8 23.65 21.3 23.925 31.125000000000004 9 24.65 22.225 26.424999999999997 26.700000000000003 10-11 27.925 28.275 19.075 24.725 12-13 27.237499999999997 22.900000000000002 23.65 26.2125 14-15 25.4625 25.837500000000002 24.637500000000003 24.0625 16-17 27.375 24.925 23.525 24.175 18-19 26.3125 24.875 24.2 24.6125 20-21 26.700850425212607 24.562281140570285 23.82441220610305 24.912456228114056 22-23 26.025 26.1 24.125 23.75 24-25 26.31578947368421 25.415676959619955 23.202900362545318 25.065633204150515 26-27 26.3 25.45 23.674999999999997 24.575 28-29 26.787499999999998 26.187500000000004 23.4875 23.5375 30-31 26.05 25.424999999999997 23.5125 25.0125 32-33 26.737499999999997 25.775 23.474999999999998 24.0125 34-35 25.7375 26.6625 23.799999999999997 23.799999999999997 36-37 26.525 26.1 22.8125 24.5625 38-39 27.1125 25.05 23.8125 24.025 40-41 27.375 25.424999999999997 24.212500000000002 22.9875 42-43 27.1125 24.6125 24.5625 23.7125 44-45 26.5125 24.712500000000002 23.4625 25.3125 46-47 26.450000000000003 25.525 24.2 23.825 48-49 26.55 25.7375 23.775 23.9375 50-51 25.912499999999998 25.25 25.1 23.7375 52-53 27.500000000000004 25.412499999999998 23.3625 23.724999999999998 54-55 26.637499999999996 25.637500000000003 23.6125 24.1125 56-57 26.5625 25.85 24.462500000000002 23.125 58-59 26.775 26.05 23.925 23.25 60-61 25.75 25.387500000000003 24.725 24.1375 62-63 26.200000000000003 25.025 24.95 23.825 64-65 27.450000000000003 25.775 23.1 23.674999999999997 66-67 26.5875 24.6125 24.6 24.2 68-69 27.278409801225152 25.428178522315285 23.87798474809351 23.415426928366045 70-71 26.6 24.9125 24.637500000000003 23.849999999999998 72-73 26.26578322290286 24.54056757094637 24.50306288286036 24.69058632329041 74-75 25.45 25.0125 25.025 24.5125 76-77 25.6125 25.8125 24.6 23.974999999999998 78-79 26.484931849443544 25.697136426159812 24.484181568088033 23.333750156308618 80-81 26.35 26.437500000000004 24.0 23.2125 82-83 26.525762881440716 25.63781890945473 24.712356178089045 23.12406203101551 84-85 26.19196596170692 24.414966837692404 24.715304717807534 24.677762482793142 86-87 25.565695711963997 26.178272284035504 24.990623827978496 23.265408176022003 88-89 26.6125 26.3125 24.0125 23.0625 90-91 26.937499999999996 26.3125 23.75 23.0 92-93 26.924999999999997 25.5125 24.15 23.4125 94-95 26.700000000000003 26.55 24.2875 22.4625 96-97 27.500000000000004 26.0 24.5125 21.987499999999997 98-99 26.2625 26.5 23.6625 23.575 100-101 27.487499999999997 26.137500000000003 23.25 23.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 2.0 25 3.0 26 1.5 27 1.5 28 2.5 29 3.5 30 8.5 31 17.0 32 22.5 33 23.0 34 23.5 35 36.0 36 48.5 37 57.5 38 70.5 39 84.0 40 100.5 41 101.0 42 103.5 43 119.5 44 132.0 45 142.5 46 152.5 47 161.5 48 168.5 49 174.5 50 176.0 51 168.5 52 160.0 53 166.5 54 169.0 55 161.5 56 163.0 57 148.5 58 134.5 59 113.0 60 94.0 61 88.0 62 74.5 63 63.5 64 51.5 65 40.5 66 36.5 67 46.0 68 39.5 69 26.5 70 29.0 71 24.0 72 12.5 73 11.5 74 10.0 75 6.5 76 5.0 77 5.0 78 3.0 79 1.0 80 2.0 81 1.5 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.05 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.0125 74-75 0.0 76-77 0.0 78-79 0.0375 80-81 0.0 82-83 0.05 84-85 0.11249999999999999 86-87 0.0125 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.925 #Duplication Level Percentage of deduplicated Percentage of total 1 92.57629914764917 84.175 2 5.773989551828429 10.5 3 1.154797910365686 3.15 4 0.30244707176244157 1.0999999999999999 5 0.08248556502612042 0.375 6 0.05499037668408029 0.3 7 0.0 0.0 8 0.05499037668408029 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCAATATAAGCCTTGGTAGGGATAGATAGCCACCTATATAGTATAGCT 8 0.2 No Hit CGAATAGCTCGTAACCAAACATGCACAGCGGTCAAACAGTATGTCCCAAG 8 0.2 No Hit CATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAAT 6 0.15 No Hit GCAAACTTCAAATTGAGCTGGCTCAGCTGCAATATGCACTGCCGCGTCTG 6 0.15 No Hit AGCGGATTTAATTCTGCATTTAATTGATTCTTCAAATGAGGATTATGCGG 5 0.125 No Hit GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 5 0.125 No Hit ACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTTGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.3 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.425 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.7749999999999999 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1803559 spots for SRR6127948.sra Written 1803559 spots for SRR6127948.sra Read 1803559 spots for SRR6127948.sra Written 1803559 spots for SRR6127948.sra Read 1803559 spots for SRR6127948.sra Written 1803559 spots for SRR6127948.sra Read 1803559 spots for SRR6127948.sra Written 1803559 spots for SRR6127948.sra Read 1803559 spots for SRR6127948.sra Written 1803559 spots for SRR6127948.sra Read 1803559 spots for SRR6127948.sra Written 1803559 spots for SRR6127948.sra Read 1803559 spots for SRR6127948.sra Written 1803559 spots for SRR6127948.sra Read 1803559 spots for SRR6127948.sra Written 1803559 spots for SRR6127948.sra Read 1803559 spots for SRR6127948.sra Written 1803559 spots for SRR6127948.sra Read 1803559 spots for SRR6127948.sra Written 1803559 spots for SRR6127948.sra Read 1803559 spots for SRR6127948.sra Written 1803559 spots for SRR6127948.sra Read 1803559 spots for SRR6127948.sra Written 1803559 spots for SRR6127948.sra Read 1803565 spots for SRR6127948.sra Written 1803565 spots for SRR6127948.sra Read 1803559 spots for SRR6127948.sra Written 1803559 spots for SRR6127948.sra Read 1803559 spots for SRR6127948.sra Written 1803559 spots for SRR6127948.sra Read 1803559 spots for SRR6127948.sra Written 1803559 spots for SRR6127948.sra Read 1803559 spots for SRR6127948.sra Written 1803559 spots for SRR6127948.sra Read 1803559 spots for SRR6127948.sra Written 1803559 spots for SRR6127948.sra Read 1803559 spots for SRR6127948.sra Written 1803559 spots for SRR6127948.sra Read 1803559 spots for SRR6127948.sra Written 1803559 spots for SRR6127948.sra SRR ids: ['SRR6127948.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wml2yzkk SRR6127948.sra spots: 36071186 blocks: [[1, 1803559], [1803560, 3607118], [3607119, 5410677], [5410678, 7214236], [7214237, 9017795], [9017796, 10821354], [10821355, 12624913], [12624914, 14428472], [14428473, 16232031], [16232032, 18035590], [18035591, 19839149], [19839150, 21642708], [21642709, 23446267], [23446268, 25249826], [25249827, 27053385], [27053386, 28856944], [28856945, 30660503], [30660504, 32464062], [32464063, 34267621], [34267622, 36071186]] SRR6127948 file size 8608612 SRR6127948 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6127948 SRR6127948_1.fastq SRR6127948_2.fastq Input file: SRR6127948_1.fastq Paired file: SRR6127948_2.fastq trimmed: SRR6127948-trimmed-pair1.fastq, SRR6127948-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 04:59:37 2024 >> started Tue Dec 10 05:00:12 2024 >> done (34.967s) 36071186 read pairs processed; of these: 143090 ( 0.40%) short read pairs filtered out after trimming by size control 266215 ( 0.74%) empty read pairs filtered out after trimming by size control 35661881 (98.87%) read pairs available; of these: 6042678 (16.94%) trimmed read pairs available after processing 29619203 (83.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 23 0.00% 20 48 0.00% 21 88 0.00% 22 128 0.00% 23 214 0.00% 24 253 0.00% 25 326 0.00% 26 413 0.00% 27 490 0.00% 28 663 0.00% 29 776 0.00% 30 912 0.00% 31 1158 0.00% 32 1254 0.00% 33 1470 0.00% 34 1611 0.00% 35 1938 0.01% 36 2062 0.01% 37 2442 0.01% 38 2650 0.01% 39 3044 0.01% 40 3392 0.01% 41 3571 0.01% 42 4040 0.01% 43 4479 0.01% 44 4802 0.01% 45 5318 0.01% 46 5985 0.02% 47 6196 0.02% 48 6707 0.02% 49 7211 0.02% 50 7711 0.02% 51 8460 0.02% 52 9012 0.03% 53 9553 0.03% 54 10456 0.03% 55 11388 0.03% 56 12276 0.03% 57 13339 0.04% 58 14642 0.04% 59 28244 0.08% 60 29005 0.08% 61 31058 0.09% 62 37316 0.10% 63 37903 0.11% 64 42705 0.12% 65 44971 0.13% 66 44069 0.12% 67 44891 0.13% 68 48214 0.14% 69 55624 0.16% 70 55345 0.16% 71 57181 0.16% 72 61182 0.17% 73 58741 0.16% 74 63245 0.18% 75 59061 0.17% 76 58694 0.16% 77 62529 0.18% 78 67453 0.19% 79 70326 0.20% 80 74275 0.21% 81 79182 0.22% 82 87713 0.25% 83 94288 0.26% 84 101151 0.28% 85 113033 0.32% 86 128502 0.36% 87 128035 0.36% 88 127852 0.36% 89 124105 0.35% 90 148284 0.42% 91 151032 0.42% 92 169277 0.47% 93 194497 0.55% 94 214071 0.60% 95 250469 0.70% 96 308256 0.86% 97 388696 1.09% 98 500604 1.40% 99 639300 1.79% 100 30410985 85.28% 35661881 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=31 prefix-density=0.74 prefix-fanout=1.9 sequence=TTCGCTATCGGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=35.16 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=1.1 sequence=GCGTGAGCAGCTCGAGCAATCCGCCGACAGCCGACGGGTTTGGGGCCGGGACCCCCGAGCCCAGTCCTCAGAGCCAATCCTTTTCCCGAAGTTACGGATCCGTTTTGCCGACTTCCCTTGCCTACATTGTTCCATTGGCCAGAGGCTGTTCACCTTGGAGACCTGATGCGGTTATGAGTACGACCGGGCGTGAACGGTACTCGGTCCTCCGGATTTTCATGGGCCGCCGGGGGCGCACCGGACACCGCGCGACGTGCGGTGCTCTTCCGGCCACTGGACCCTACCTCCGGCTGAACCGATTCCAGGGTTGGCAGGCCGTTAAGCAGAAAAGATAACTCTTCCCGAGGCCCCCGCCGGCGTCTCCGGACTTCCTAACGTCGCCGTCAACCGCCACATCCCGGCTCGGGAAATCTTAACCCGATTCCCTTTCGGGGGATACGCGTGATCGCGCTATCTGCCGGGGTTACCCCGTCCCTTAGGATCGGCTTACCCATGTGCAAGTGCCGTTCAC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=21 prefix-density=0.68 prefix-fanout=2.0 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=14.63 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.7 sequence=CGAGCTCGCATTTTGAAAATTCTATGGAAGAGCTAGCATCTCTGACGAAAACAGCAGACGGAAAAGTACTGACCAGCGTCACACAAAAACGGAACAGGGCTGACGCCGCTACATATATAGGAAAAGGGAAGGTAGAAGAGCTGAAGGCACTCGTGGAAGAGCTTGAAGCTGATCTCCTCATCTTTAATGATGAACTGTCGCCAAGTCAGCTGAAGTCATTGGCAACAGCAATTGAAGTGAAGATGATTGACCGCACGCAATTGATATTAGATATTTTTGCAAAGCGGGCGAGAACGAGAGAAGGCAAACTTCAAATTGAGCTGGCTCAGCTGCAATATGCACTGCCGCGTCTGACGGGACAAGGGATCAACCTTTCCCGGCAAGGCGGAGGAATTGGGGCAAGAGGTCCCGGGGAAACGAAACTGGAAACCGACCGCCGCCATATCAGAAATCGCATTCATGAAATCAACACACAGCTTTCCACTGTCATTCGCCATAGAAGCCGATACCG SRR6127948 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:01:06 Started mapping on | Dec 10 05:01:06 Finished on | Dec 10 05:20:51 Mapping speed, Million of reads per hour | 108.34 Number of input reads | 35661881 Average input read length | 197 UNIQUE READS: Uniquely mapped reads number | 17389251 Uniquely mapped reads % | 48.76% Average mapped length | 196.99 Number of splices: Total | 9211474 Number of splices: Annotated (sjdb) | 8659523 Number of splices: GT/AG | 9076811 Number of splices: GC/AG | 106866 Number of splices: AT/AC | 3519 Number of splices: Non-canonical | 24278 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.22 Insertion rate per base | 0.02% Insertion average length | 1.99 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3124665 % of reads mapped to multiple loci | 8.76% Number of reads mapped to too many loci | 794701 % of reads mapped to too many loci | 2.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 28.82% % of reads unmapped: other | 11.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 15161066 15161066 15161066 N_multimapping 3124665 3124665 3124665 N_noFeature 1629747 16851619 1774762 N_ambiguous 444968 2113 53257 UnstrandedReadsAssigned:15314536 PositiveStrandReadsAssigned:535519 NegativeStrandReadsAssigned:15561232 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR6127948 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6127948-trimmed-pair1.fastq SRR6127948-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,661,881 reads, 16,099,799 reads pseudoaligned [quant] estimated average fragment length: 172.487 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52973 SRR6127948.ke.tsv 35125 SRR6127948.se.tsv 88098 total ==> SRR6127948.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 764.694 0 0 PNS24247 1044 872.513 59.7419 5.35638 PNS24249 1928 1756.51 33.9726 1.51301 PNS24246 1044 872.513 59.7419 5.35638 PNS24248 1044 872.513 59.7419 5.35638 PNS24244 1471 1299.51 194.802 11.7267 PNS24243 293 130.097 0 0 KQK14069 1603 1431.51 6216.45 339.712 KQK14071 474 304.143 63.2203 16.2608 ==> SRR6127948.se.tsv <== BRADI_1g14170v3 6657 BRADI_1g53295v3 513 BRADI_1g59795v3 83 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 301 BRADI_1g74790v3 99 BRADI_1g09890v3 0 BRADI_1g77505v3 365 BRADI_1g48960v3 0 SRR6127948 completed mapping pipeline successfully