Starting /dee2/code/volunteer_pipeline.sh SRR6257540 current disk space = 1544268054528 free memory = 1605813484 SRR6257540 SRAfilesize f11fabfdaeec7fabcaaf24f7666f10a1 SRR6257540.sra SRR6257540.sra file validated SRR6257540 is paired end SRR6257540 is conventional basespace SRR6257540 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6257540_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.65875 18.0 18.0 18.0 18.0 31.0 2 26.4005 27.0 25.0 31.0 18.0 33.0 3 29.45475 31.0 29.0 33.0 25.0 33.0 4 32.4545 33.0 32.0 33.0 32.0 33.0 5 32.885 33.0 33.0 33.0 33.0 34.0 6 37.32425 38.0 37.0 38.0 36.0 38.0 7 37.61775 38.0 38.0 38.0 37.0 38.0 8 37.7475 38.0 38.0 38.0 38.0 38.0 9 37.781 38.0 38.0 38.0 38.0 38.0 10-14 37.805899999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.8177 38.0 38.0 38.0 38.0 38.0 20-24 37.798700000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.7723 38.0 38.0 38.0 38.0 38.0 30-34 37.75865 38.0 38.0 38.0 38.0 38.0 35-39 37.78285 38.0 38.0 38.0 38.0 38.0 40-44 37.73355 38.0 38.0 38.0 38.0 38.0 45-49 37.735350000000004 38.0 38.0 38.0 38.0 38.0 50-54 37.70105 38.0 38.0 38.0 38.0 38.0 55-59 37.7115 38.0 38.0 38.0 38.0 38.0 60-64 37.6909 38.0 38.0 38.0 38.0 38.0 65-69 37.65185000000001 38.0 38.0 38.0 38.0 38.0 70-74 37.67715 38.0 38.0 38.0 38.0 38.0 75-79 37.64135 38.0 38.0 38.0 38.0 38.0 80-84 37.578700000000005 38.0 38.0 38.0 38.0 38.0 85-89 37.51685 38.0 38.0 38.0 38.0 38.0 90-94 37.51735 38.0 38.0 38.0 38.0 38.0 95-99 37.49995 38.0 38.0 38.0 38.0 38.0 100-104 37.4773 38.0 38.0 38.0 38.0 38.0 105-109 37.462 38.0 38.0 38.0 37.8 38.0 110-114 37.382799999999996 38.0 38.0 38.0 37.0 38.0 115-119 37.32599999999999 38.0 38.0 38.0 37.0 38.0 120-124 37.25160000000001 38.0 38.0 38.0 36.8 38.0 125-129 37.18770000000001 38.0 38.0 38.0 36.0 38.0 130-134 37.1623 38.0 38.0 38.0 36.0 38.0 135-139 37.085 38.0 38.0 38.0 36.0 38.0 140-144 36.988749999999996 38.0 38.0 38.0 35.6 38.0 145-149 36.8072 38.0 38.0 38.0 35.2 38.0 150-151 35.023624999999996 38.0 36.0 38.0 30.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 5.0 19 3.0 20 0.0 21 2.0 22 1.0 23 0.0 24 3.0 25 4.0 26 2.0 27 4.0 28 5.0 29 6.0 30 9.0 31 9.0 32 14.0 33 20.0 34 48.0 35 92.0 36 303.0 37 3467.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 49.672379032258064 12.37399193548387 7.963709677419355 29.98991935483871 2 26.875 15.950000000000001 35.325 21.85 3 23.025000000000002 23.1 24.825 29.049999999999997 4 27.500000000000004 29.675 20.75 22.075 5 26.924999999999997 34.5 21.05 17.525 6 22.425 33.6 24.15 19.825 7 16.875 22.95 41.15 19.025 8 20.65 22.925 29.375 27.05 9 20.95 21.15 32.324999999999996 25.575 10-14 23.64 27.42 24.575 24.365000000000002 15-19 23.915 26.105 24.83 25.15 20-24 24.14 26.97 24.67 24.22 25-29 23.580000000000002 26.455000000000002 25.56 24.404999999999998 30-34 23.865 26.619999999999997 25.21 24.305 35-39 23.89 26.22 24.975 24.915000000000003 40-44 24.065 26.945000000000004 24.825 24.165 45-49 23.1 26.545 25.545 24.81 50-54 23.56 26.045 25.215 25.180000000000003 55-59 23.82 26.19 25.130000000000003 24.86 60-64 23.535 26.145000000000003 25.71 24.610000000000003 65-69 22.935 25.679999999999996 25.735000000000003 25.650000000000002 70-74 23.51 25.69 25.215 25.585 75-79 22.935 25.929999999999996 25.430000000000003 25.705 80-84 23.71 25.915 25.564999999999998 24.81 85-89 23.085 25.995 25.424999999999997 25.495 90-94 24.43 25.195 25.169999999999998 25.205 95-99 23.34 25.395 25.53 25.735000000000003 100-104 23.53 25.66 25.174999999999997 25.635 105-109 23.91 25.224999999999998 26.165 24.7 110-114 24.325 26.484999999999996 24.59 24.6 115-119 25.324999999999996 26.724999999999998 23.625 24.325 120-124 24.63 26.43 23.810000000000002 25.130000000000003 125-129 23.98 25.88 24.565 25.575 130-134 23.69 25.615 25.145 25.55 135-139 24.0 25.665 24.545 25.790000000000003 140-144 23.87 25.695 24.19 26.245 145-149 23.375 26.174999999999997 24.415 26.035000000000004 150-151 23.1125 25.900000000000002 24.525 26.4625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 2.0 25 2.5 26 1.0 27 2.0 28 5.0 29 7.0 30 6.0 31 9.0 32 15.5 33 20.0 34 24.5 35 32.0 36 42.0 37 58.5 38 82.0 39 106.5 40 137.5 41 157.0 42 172.0 43 190.5 44 205.5 45 202.5 46 182.5 47 189.5 48 198.0 49 205.5 50 200.0 51 169.0 52 146.5 53 134.0 54 120.0 55 103.0 56 91.5 57 87.0 58 87.0 59 75.5 60 69.5 61 72.0 62 64.0 63 56.5 64 50.5 65 37.5 66 28.5 67 28.5 68 27.0 69 24.5 70 17.5 71 14.0 72 14.0 73 8.0 74 5.5 75 4.0 76 3.0 77 2.0 78 0.5 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24357034795764 98.4 2 0.6555723651033787 1.3 3 0.10085728693898136 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 0.9875 0.0 0.0 0.0 0.0 96-97 1.1 0.0 0.0 0.0 0.0 98-99 1.325 0.0 0.0 0.0 0.0 100-101 1.6 0.0 0.0 0.0 0.0 102-103 1.925 0.0 0.0 0.0 0.0 104-105 2.3 0.0 0.0 0.0 0.0 106-107 2.5250000000000004 0.0 0.0 0.0 0.0 108-109 3.075 0.0 0.0 0.0 0.0 110-111 3.6624999999999996 0.0 0.0 0.0 0.0 112-113 4.15 0.0 0.0 0.0 0.0 114-115 4.725 0.0 0.0 0.0 0.0 116-117 5.2125 0.0 0.0 0.0 0.0 118-119 5.6375 0.0 0.0 0.0 0.0 120-121 6.1875 0.0 0.0 0.0 0.0 122-123 6.675 0.0 0.0 0.0 0.0 124-125 7.1125 0.0 0.0 0.0 0.0 126-127 7.5875 0.0 0.0 0.0 0.0 128-129 8.2375 0.0 0.0 0.0 0.0 130-131 9.0125 0.0 0.0 0.0 0.0 132-133 9.899999999999999 0.0 0.0 0.0 0.0 134-135 10.7 0.0 0.0 0.0 0.0 136-137 11.5375 0.0 0.0 0.0 0.0 138-139 12.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6257540 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6257540_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01725 33.0 33.0 34.0 32.0 34.0 2 33.1465 33.0 33.0 34.0 33.0 34.0 3 33.17325 34.0 33.0 34.0 33.0 34.0 4 33.11625 34.0 33.0 34.0 33.0 34.0 5 33.15925 34.0 33.0 34.0 33.0 34.0 6 37.4855 38.0 38.0 38.0 38.0 38.0 7 37.453 38.0 38.0 38.0 38.0 38.0 8 37.47675 38.0 38.0 38.0 38.0 38.0 9 37.47225 38.0 38.0 38.0 38.0 38.0 10-14 37.395199999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.37845 38.0 38.0 38.0 37.4 38.0 20-24 37.32834999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.3313 38.0 38.0 38.0 37.0 38.0 30-34 37.26705 38.0 38.0 38.0 37.0 38.0 35-39 37.1806 38.0 38.0 38.0 37.0 38.0 40-44 37.108 38.0 38.0 38.0 36.6 38.0 45-49 37.0384 38.0 38.0 38.0 36.0 38.0 50-54 36.959999999999994 38.0 38.0 38.0 36.0 38.0 55-59 36.871750000000006 38.0 38.0 38.0 35.8 38.0 60-64 36.75335 38.0 38.0 38.0 35.0 38.0 65-69 36.676249999999996 38.0 38.0 38.0 35.0 38.0 70-74 36.55 38.0 38.0 38.0 34.0 38.0 75-79 36.365550000000006 38.0 37.8 38.0 34.0 38.0 80-84 36.12725 38.0 37.2 38.0 33.2 38.0 85-89 36.12545 38.0 37.2 38.0 33.4 38.0 90-94 35.8087 38.0 37.0 38.0 32.0 38.0 95-99 35.590500000000006 38.0 36.4 38.0 30.6 38.0 100-104 35.30805 38.0 36.0 38.0 29.4 38.0 105-109 34.86825 38.0 35.2 38.0 27.8 38.0 110-114 34.451899999999995 38.0 35.0 38.0 25.8 38.0 115-119 34.01035 38.0 34.0 38.0 23.8 38.0 120-124 33.52905 38.0 33.8 38.0 20.6 38.0 125-129 32.873349999999995 37.6 33.4 38.0 15.0 38.0 130-134 32.261900000000004 36.6 32.4 38.0 14.2 38.0 135-139 31.35205 36.0 30.2 38.0 13.8 38.0 140-144 30.402350000000002 35.4 28.0 38.0 13.0 38.0 145-149 29.047400000000003 35.0 24.2 38.0 2.0 38.0 150-151 24.3945 33.0 8.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 0.0 5 3.0 6 1.0 7 0.0 8 4.0 9 3.0 10 0.0 11 1.0 12 3.0 13 3.0 14 4.0 15 1.0 16 7.0 17 5.0 18 4.0 19 8.0 20 15.0 21 11.0 22 14.0 23 15.0 24 12.0 25 18.0 26 18.0 27 20.0 28 33.0 29 33.0 30 47.0 31 75.0 32 112.0 33 180.0 34 305.0 35 716.0 36 1243.0 37 1079.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.93623405851463 17.57939484871218 9.65241310327582 27.831957989497376 2 31.43285821455364 22.355588897224308 26.93173293323331 19.279819954988746 3 24.58114528632158 23.78094523630908 28.557139284821204 23.080770192548137 4 26.30657664416104 30.282570642660666 21.030257564391096 22.380595148787197 5 28.257064266066518 34.45861465366342 17.72943235808952 19.554888722180543 6 23.925 36.1 20.025000000000002 19.950000000000003 7 22.6 17.875 35.8 23.724999999999998 8 22.55 21.625 25.45 30.375000000000004 9 24.275 21.95 27.700000000000003 26.075 10-14 25.985000000000003 25.045 23.755000000000003 25.215 15-19 25.895000000000003 24.5 24.959999999999997 24.645 20-24 25.75 25.635 24.925 23.69 25-29 25.39 26.435 24.279999999999998 23.895 30-34 25.66 25.415 25.11 23.815 35-39 25.009999999999998 25.72 25.025 24.245 40-44 25.72 25.795 24.25 24.235 45-49 25.695 26.0 24.32 23.985 50-54 25.729999999999997 25.419999999999998 24.845 24.005000000000003 55-59 25.745 25.69 24.445 24.12 60-64 25.69 25.71 24.945 23.655 65-69 25.655 25.75 25.11 23.485 70-74 25.740000000000002 25.919999999999998 24.695 23.645 75-79 26.029999999999998 25.064999999999998 25.035 23.87 80-84 25.330000000000002 25.945 24.83 23.895 85-89 25.405 25.82 24.709999999999997 24.065 90-94 25.865 25.929999999999996 24.610000000000003 23.595 95-99 25.095 25.94 25.275 23.69 100-104 25.89 26.235000000000003 24.89 22.985 105-109 25.869999999999997 26.174999999999997 24.58 23.375 110-114 25.590000000000003 26.669999999999998 24.545 23.195 115-119 25.965 26.340000000000003 24.555 23.14 120-124 26.165 26.035000000000004 24.415 23.385 125-129 27.005000000000003 25.86 24.11 23.025000000000002 130-134 26.939999999999998 26.424999999999997 24.2 22.435 135-139 27.095000000000002 26.545 24.275 22.085 140-144 27.169999999999998 27.175 23.76 21.895 145-149 27.105 26.540000000000003 24.81 21.545 150-151 27.6875 25.95 24.474999999999998 21.8875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 1.0 27 1.5 28 3.0 29 6.0 30 5.0 31 6.0 32 12.0 33 18.5 34 24.0 35 30.5 36 46.5 37 67.5 38 74.0 39 98.0 40 125.5 41 128.5 42 147.0 43 173.5 44 190.5 45 182.5 46 181.5 47 195.5 48 190.0 49 185.5 50 181.5 51 154.5 52 136.5 53 127.5 54 115.5 55 120.5 56 101.0 57 77.0 58 95.0 59 102.5 60 81.0 61 69.5 62 71.5 63 73.0 64 68.5 65 56.5 66 47.5 67 53.0 68 45.0 69 29.0 70 25.5 71 23.5 72 16.5 73 10.0 74 9.5 75 6.0 76 3.0 77 2.5 78 1.0 79 1.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06400202377941 97.89999999999999 2 0.7589172780166962 1.5 3 0.12648621300278268 0.375 4 0.025297242600556536 0.1 5 0.025297242600556536 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.875 0.0 0.0 0.0 0.0 94-95 0.9625 0.0 0.0 0.0 0.0 96-97 1.0499999999999998 0.0 0.0 0.0 0.0 98-99 1.2374999999999998 0.0 0.0 0.0 0.0 100-101 1.5 0.0 0.0 0.0 0.0 102-103 1.8 0.0 0.0 0.0 0.0 104-105 2.1500000000000004 0.0 0.0 0.0 0.0 106-107 2.3499999999999996 0.0 0.0 0.0 0.0 108-109 2.875 0.0 0.0 0.0 0.0 110-111 3.45 0.0 0.0 0.0 0.0 112-113 3.85 0.0 0.0 0.0 0.0 114-115 4.35 0.0 0.0 0.0 0.0 116-117 4.824999999999999 0.0 0.0 0.0 0.0 118-119 5.225 0.0 0.0 0.0 0.0 120-121 5.6625 0.0 0.0 0.0 0.0 122-123 6.15 0.0 0.0 0.0 0.0 124-125 6.525 0.0 0.0 0.0 0.0 126-127 6.9375 0.0 0.0 0.0 0.0 128-129 7.525 0.0 0.0 0.0 0.0 130-131 8.2375 0.0 0.0 0.0 0.0 132-133 9.024999999999999 0.0 0.0 0.0 0.0 134-135 9.7625 0.0 0.0 0.0 0.0 136-137 10.475 0.0 0.0 0.0 0.0 138-139 11.162500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 220246 spots for SRR6257540.sra Written 220246 spots for SRR6257540.sra Read 220246 spots for SRR6257540.sra Written 220246 spots for SRR6257540.sra Read 220246 spots for SRR6257540.sra Written 220246 spots for SRR6257540.sra Read 220246 spots for SRR6257540.sra Written 220246 spots for SRR6257540.sra Read 220246 spots for SRR6257540.sra Written 220246 spots for SRR6257540.sra Read 220246 spots for SRR6257540.sra Written 220246 spots for SRR6257540.sra Read 220246 spots for SRR6257540.sra Written 220246 spots for SRR6257540.sra Read 220246 spots for SRR6257540.sra Written 220246 spots for SRR6257540.sra Read 220246 spots for SRR6257540.sra Written 220246 spots for SRR6257540.sra Read 220246 spots for SRR6257540.sra Written 220246 spots for SRR6257540.sra Read 220246 spots for SRR6257540.sra Written 220246 spots for SRR6257540.sra Read 220246 spots for SRR6257540.sra Written 220246 spots for SRR6257540.sra Read 220248 spots for SRR6257540.sra Written 220248 spots for SRR6257540.sra Read 220246 spots for SRR6257540.sra Written 220246 spots for SRR6257540.sra Read 220246 spots for SRR6257540.sra Written 220246 spots for SRR6257540.sra Read 220246 spots for SRR6257540.sra Written 220246 spots for SRR6257540.sra Read 220246 spots for SRR6257540.sra Written 220246 spots for SRR6257540.sra Read 220246 spots for SRR6257540.sra Written 220246 spots for SRR6257540.sra Read 220246 spots for SRR6257540.sra Written 220246 spots for SRR6257540.sra Read 220246 spots for SRR6257540.sra Written 220246 spots for SRR6257540.sra SRR ids: ['SRR6257540.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m0lnvujn SRR6257540.sra spots: 4404922 blocks: [[1, 220246], [220247, 440492], [440493, 660738], [660739, 880984], [880985, 1101230], [1101231, 1321476], [1321477, 1541722], [1541723, 1761968], [1761969, 1982214], [1982215, 2202460], [2202461, 2422706], [2422707, 2642952], [2642953, 2863198], [2863199, 3083444], [3083445, 3303690], [3303691, 3523936], [3523937, 3744182], [3744183, 3964428], [3964429, 4184674], [4184675, 4404922]] SRR6257540 file size 1481911 SRR6257540 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6257540 SRR6257540_1.fastq SRR6257540_2.fastq Input file: SRR6257540_1.fastq Paired file: SRR6257540_2.fastq trimmed: SRR6257540-trimmed-pair1.fastq, SRR6257540-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:05:13 2024 >> started Sat Dec 7 09:05:18 2024 >> done (4.801s) 4404922 read pairs processed; of these: 2346 ( 0.05%) short read pairs filtered out after trimming by size control 4033 ( 0.09%) empty read pairs filtered out after trimming by size control 4398543 (99.86%) read pairs available; of these: 1580879 (35.94%) trimmed read pairs available after processing 2817664 (64.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 9 0.00% 20 5 0.00% 21 3 0.00% 22 9 0.00% 23 5 0.00% 24 10 0.00% 25 6 0.00% 26 7 0.00% 27 16 0.00% 28 10 0.00% 29 11 0.00% 30 9 0.00% 31 8 0.00% 32 12 0.00% 33 16 0.00% 34 10 0.00% 35 5 0.00% 36 9 0.00% 37 7 0.00% 38 5 0.00% 39 16 0.00% 40 12 0.00% 41 17 0.00% 42 24 0.00% 43 17 0.00% 44 25 0.00% 45 22 0.00% 46 22 0.00% 47 24 0.00% 48 30 0.00% 49 29 0.00% 50 39 0.00% 51 37 0.00% 52 35 0.00% 53 49 0.00% 54 49 0.00% 55 48 0.00% 56 45 0.00% 57 57 0.00% 58 65 0.00% 59 88 0.00% 60 112 0.00% 61 106 0.00% 62 127 0.00% 63 127 0.00% 64 143 0.00% 65 177 0.00% 66 199 0.00% 67 216 0.00% 68 224 0.01% 69 286 0.01% 70 291 0.01% 71 351 0.01% 72 405 0.01% 73 457 0.01% 74 523 0.01% 75 559 0.01% 76 738 0.02% 77 768 0.02% 78 813 0.02% 79 929 0.02% 80 995 0.02% 81 1132 0.03% 82 1235 0.03% 83 1569 0.04% 84 1720 0.04% 85 2138 0.05% 86 2067 0.05% 87 2279 0.05% 88 2288 0.05% 89 2519 0.06% 90 2919 0.07% 91 3120 0.07% 92 3571 0.08% 93 3534 0.08% 94 3942 0.09% 95 4380 0.10% 96 4748 0.11% 97 4905 0.11% 98 5063 0.12% 99 5233 0.12% 100 5482 0.12% 101 6061 0.14% 102 6803 0.15% 103 7418 0.17% 104 8056 0.18% 105 8966 0.20% 106 8770 0.20% 107 8978 0.20% 108 9523 0.22% 109 9806 0.22% 110 10599 0.24% 111 10564 0.24% 112 11203 0.25% 113 11647 0.26% 114 11783 0.27% 115 11891 0.27% 116 11829 0.27% 117 12742 0.29% 118 13028 0.30% 119 12785 0.29% 120 13450 0.31% 121 12972 0.29% 122 13225 0.30% 123 13953 0.32% 124 13828 0.31% 125 15087 0.34% 126 15481 0.35% 127 16097 0.37% 128 15605 0.35% 129 15734 0.36% 130 15948 0.36% 131 16531 0.38% 132 17029 0.39% 133 17971 0.41% 134 18093 0.41% 135 19123 0.43% 136 19276 0.44% 137 19298 0.44% 138 20199 0.46% 139 20584 0.47% 140 21488 0.49% 141 22364 0.51% 142 23364 0.53% 143 24987 0.57% 144 27329 0.62% 145 30918 0.70% 146 35453 0.81% 147 43574 0.99% 148 60319 1.37% 149 109170 2.48% 150 586661 13.34% 151 2817664 64.06% 4398543 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=24 prefix-density=0.60 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=20.37 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=1.5 sequence=GCATCGCCGGCCCCCATCCGCTTCCCTCCCGGCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTCGCTATCGGTCTCTCGCCTGTATTTAGCCTTGGACGGAGTCTACCGCCCGATTTGGGCTGCATTCCCAAACAACCCGACTCGTTGACGGCGCCTCGTGGGGCGACAGGGTCCGGGCCGGACGGGGCTCTCACCCTCCCAGGCGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGTCGCTGAGGACGCCTCTCCAGACTACAATTCGGACGGCACGGCCGCCCGATTCTCAAGCTGGGCTGCTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTCTCCTC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=28 prefix-density=0.64 prefix-fanout=2.0 sequence=GTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=97.96 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=5.9 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR6257540 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:05:59 Started mapping on | Dec 07 09:06:00 Finished on | Dec 07 09:06:27 Mapping speed, Million of reads per hour | 586.47 Number of input reads | 4398543 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 4152927 Uniquely mapped reads % | 94.42% Average mapped length | 291.81 Number of splices: Total | 4617711 Number of splices: Annotated (sjdb) | 4334435 Number of splices: GT/AG | 4555110 Number of splices: GC/AG | 55735 Number of splices: AT/AC | 2415 Number of splices: Non-canonical | 4451 Mismatch rate per base, % | 0.08% Deletion rate per base | 0.01% Deletion average length | 1.44 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 77025 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 16583 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.27% % of reads unmapped: other | 2.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 170713 170713 170713 N_multimapping 77025 77025 77025 N_noFeature 210547 4023087 259564 N_ambiguous 97473 657 16692 UnstrandedReadsAssigned:3844907 PositiveStrandReadsAssigned:129183 NegativeStrandReadsAssigned:3876671 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6257540 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6257540-trimmed-pair1.fastq SRR6257540-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,398,543 reads, 3,909,178 reads pseudoaligned [quant] estimated average fragment length: 233.592 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,006 rounds 52973 SRR6257540.ke.tsv 35125 SRR6257540.se.tsv 88098 total ==> SRR6257540.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 703.804 0 0 PNS24247 1044 811.408 11.7134 5.3467 PNS24249 1928 1695.41 3.10567 0.678457 PNS24246 1044 811.408 11.7134 5.3467 PNS24248 1044 811.408 11.7134 5.3467 PNS24244 1471 1238.41 9.75409 2.91719 PNS24243 293 103.08 0 0 KQK14069 1603 1370.41 1059.16 286.255 KQK14071 474 253.255 31.4119 45.9386 ==> SRR6257540.se.tsv <== BRADI_1g14170v3 1307 BRADI_1g53295v3 22 BRADI_1g59795v3 97 BRADI_1g07683v3 0 BRADI_1g00485v3 14 BRADI_1g20270v3 517 BRADI_1g74790v3 36 BRADI_1g09890v3 2 BRADI_1g77505v3 65 BRADI_1g48960v3 0 SRR6257540 completed mapping pipeline successfully