Starting /dee2/code/volunteer_pipeline.sh SRR6257542 current disk space = 1544232861696 free memory = 1597993316 SRR6257542 SRAfilesize eb8cfe42f7abd87ec97a5606406fe2bf SRR6257542.sra SRR6257542.sra file validated SRR6257542 is paired end SRR6257542 is conventional basespace SRR6257542 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6257542_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.9685 32.0 25.0 33.0 18.0 34.0 2 28.53825 29.0 27.0 33.0 18.0 33.0 3 31.62625 33.0 31.0 33.0 29.0 34.0 4 32.41375 33.0 32.0 33.0 32.0 34.0 5 32.43625 33.0 32.0 33.0 31.0 34.0 6 36.32975 38.0 36.0 38.0 33.0 38.0 7 37.24025 38.0 38.0 38.0 36.0 38.0 8 37.49575 38.0 38.0 38.0 37.0 38.0 9 37.63225 38.0 38.0 38.0 38.0 38.0 10-14 37.7266 38.0 38.0 38.0 38.0 38.0 15-19 37.754549999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.7862 38.0 38.0 38.0 38.0 38.0 25-29 37.772149999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.775400000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.76595 38.0 38.0 38.0 38.0 38.0 40-44 37.737750000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.721650000000004 38.0 38.0 38.0 38.0 38.0 50-54 37.6922 38.0 38.0 38.0 38.0 38.0 55-59 37.706599999999995 38.0 38.0 38.0 38.0 38.0 60-64 37.7106 38.0 38.0 38.0 38.0 38.0 65-69 37.70335 38.0 38.0 38.0 38.0 38.0 70-74 37.71040000000001 38.0 38.0 38.0 38.0 38.0 75-79 37.607150000000004 38.0 38.0 38.0 38.0 38.0 80-84 37.568549999999995 38.0 38.0 38.0 38.0 38.0 85-89 37.500750000000004 38.0 38.0 38.0 38.0 38.0 90-94 37.497800000000005 38.0 38.0 38.0 38.0 38.0 95-99 37.45175 38.0 38.0 38.0 38.0 38.0 100-104 37.41985 38.0 38.0 38.0 38.0 38.0 105-109 37.3809 38.0 38.0 38.0 37.4 38.0 110-114 37.322500000000005 38.0 38.0 38.0 37.0 38.0 115-119 37.285250000000005 38.0 38.0 38.0 37.0 38.0 120-124 37.28935 38.0 38.0 38.0 37.0 38.0 125-129 37.17715 38.0 38.0 38.0 36.0 38.0 130-134 37.10645000000001 38.0 38.0 38.0 36.0 38.0 135-139 37.0129 38.0 38.0 38.0 36.0 38.0 140-144 36.9187 38.0 38.0 38.0 35.8 38.0 145-149 36.74385 38.0 38.0 38.0 35.2 38.0 150-151 35.034125 38.0 36.0 38.0 31.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 7.0 20 1.0 21 1.0 22 1.0 23 2.0 24 2.0 25 2.0 26 2.0 27 4.0 28 4.0 29 10.0 30 9.0 31 19.0 32 22.0 33 31.0 34 59.0 35 71.0 36 254.0 37 3495.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.608454957221944 14.242576748867638 8.354302969300454 33.794665324609966 2 29.125 21.224999999999998 28.9 20.75 3 23.275000000000002 21.95 21.7 33.074999999999996 4 28.050000000000004 30.475 18.3 23.175 5 26.674999999999997 37.025000000000006 18.75 17.549999999999997 6 22.25 34.625 23.35 19.775000000000002 7 17.525 25.7 39.45 17.325 8 21.349999999999998 22.85 30.0 25.8 9 20.075000000000003 21.3 34.1 24.525 10-14 22.5 28.63 25.240000000000002 23.630000000000003 15-19 22.400000000000002 27.305 26.35 23.945 20-24 22.645 27.310000000000002 26.415 23.630000000000003 25-29 22.255 27.089999999999996 26.72 23.935000000000002 30-34 22.255 27.189999999999998 26.115 24.44 35-39 22.009999999999998 26.240000000000002 27.055 24.695 40-44 22.23 26.605 26.724999999999998 24.44 45-49 21.765 27.115000000000002 26.075 25.045 50-54 23.125 25.705 26.490000000000002 24.68 55-59 22.45 26.545 26.505000000000003 24.5 60-64 22.13 26.490000000000002 26.419999999999998 24.959999999999997 65-69 21.925 26.784999999999997 26.484999999999996 24.805 70-74 22.720000000000002 25.674999999999997 26.38 25.224999999999998 75-79 22.259999999999998 26.505000000000003 26.145000000000003 25.09 80-84 22.15 26.51 26.334999999999997 25.005 85-89 22.5 26.295 26.265 24.94 90-94 22.63 25.724999999999998 26.215 25.430000000000003 95-99 22.89 26.41 25.95 24.75 100-104 22.755 26.35 25.924999999999997 24.97 105-109 22.830000000000002 26.775 25.285000000000004 25.11 110-114 22.86 26.905 26.1 24.135 115-119 23.580000000000002 26.395000000000003 25.635 24.39 120-124 23.265 25.755 25.22 25.759999999999998 125-129 22.63 26.55 25.569999999999997 25.25 130-134 23.294999999999998 26.150000000000002 25.3 25.255 135-139 22.825 26.155 25.005 26.015 140-144 23.435 25.965 25.605 24.995 145-149 23.165 25.685000000000002 25.480000000000004 25.669999999999998 150-151 23.3875 25.575 25.0125 26.025 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 0.5 24 0.5 25 1.5 26 2.0 27 3.0 28 4.0 29 5.0 30 10.5 31 13.0 32 14.5 33 23.5 34 30.0 35 41.5 36 55.5 37 78.5 38 102.5 39 123.5 40 156.0 41 179.0 42 206.5 43 229.0 44 246.0 45 257.0 46 235.5 47 206.5 48 184.5 49 167.0 50 153.5 51 147.0 52 144.0 53 123.5 54 98.5 55 87.0 56 85.0 57 77.0 58 66.5 59 64.5 60 51.0 61 45.5 62 45.0 63 34.0 64 31.5 65 30.5 66 25.5 67 23.0 68 19.0 69 14.5 70 14.0 71 13.0 72 9.5 73 7.0 74 5.5 75 2.0 76 0.5 77 1.5 78 1.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11571500757958 98.075 2 0.808489135927236 1.6 3 0.05053057099545225 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025265285497726126 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGTTGTTATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 2 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.0625 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.7875000000000001 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.1625 0.0 0.0 0.0 0.0 96-97 1.4125 0.0 0.0 0.0 0.0 98-99 1.65 0.0 0.0 0.0 0.0 100-101 1.8624999999999998 0.0 0.0 0.0 0.0 102-103 2.1875 0.0 0.0 0.0 0.0 104-105 2.5875 0.0 0.0 0.0 0.0 106-107 3.0625 0.0 0.0 0.0 0.0 108-109 3.3625 0.0 0.0 0.0 0.0 110-111 3.625 0.0 0.0 0.0 0.0 112-113 4.025 0.0 0.0 0.0 0.0 114-115 4.512499999999999 0.0 0.0 0.0 0.0 116-117 5.125 0.0 0.0 0.0 0.0 118-119 5.8625 0.0 0.0 0.0 0.0 120-121 6.4625 0.0 0.0 0.0 0.0 122-123 7.0625 0.0 0.0 0.0 0.0 124-125 7.7125 0.0 0.0 0.0 0.0 126-127 8.3875 0.0 0.0 0.0 0.0 128-129 9.212499999999999 0.0 0.0 0.0 0.0 130-131 9.875 0.0 0.0 0.0 0.0 132-133 10.662500000000001 0.0 0.0 0.0 0.0 134-135 11.475000000000001 0.0 0.0 0.0 0.0 136-137 12.5125 0.0 0.0 0.0 0.0 138-139 13.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTTGAG 10 0.006830828 145.0 6 AAAAAAA 35 0.0035366106 20.714287 80-84 >>END_MODULE SRR6257542 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6257542_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9655 33.0 33.0 34.0 31.0 34.0 2 32.17075 33.0 33.0 34.0 31.0 34.0 3 32.1115 33.0 33.0 34.0 31.0 34.0 4 32.0735 33.0 33.0 34.0 31.0 34.0 5 32.208 33.0 33.0 34.0 31.0 34.0 6 36.2345 38.0 38.0 38.0 34.0 38.0 7 36.20175 38.0 38.0 38.0 34.0 38.0 8 36.11825 38.0 38.0 38.0 33.0 38.0 9 36.05025 38.0 38.0 38.0 33.0 38.0 10-14 36.0484 38.0 38.0 38.0 33.0 38.0 15-19 36.048199999999994 38.0 38.0 38.0 33.0 38.0 20-24 36.001799999999996 38.0 38.0 38.0 33.2 38.0 25-29 35.8951 38.0 38.0 38.0 33.0 38.0 30-34 35.8172 38.0 38.0 38.0 32.6 38.0 35-39 35.6563 38.0 37.0 38.0 30.8 38.0 40-44 35.447500000000005 38.0 37.0 38.0 29.4 38.0 45-49 35.415200000000006 38.0 37.0 38.0 29.4 38.0 50-54 35.29545 38.0 37.0 38.0 29.0 38.0 55-59 35.084999999999994 38.0 36.2 38.0 28.6 38.0 60-64 34.87755 38.0 36.0 38.0 27.6 38.0 65-69 34.8056 38.0 36.0 38.0 27.4 38.0 70-74 34.54595 38.0 35.8 38.0 26.4 38.0 75-79 34.272850000000005 38.0 35.0 38.0 25.2 38.0 80-84 33.912850000000006 38.0 34.4 38.0 19.4 38.0 85-89 33.685050000000004 38.0 34.0 38.0 16.0 38.0 90-94 33.37275 38.0 34.0 38.0 15.6 38.0 95-99 32.99665 38.0 33.4 38.0 15.0 38.0 100-104 32.65315 38.0 33.0 38.0 15.0 38.0 105-109 32.18655 37.2 31.8 38.0 15.0 38.0 110-114 31.579200000000004 37.0 30.4 38.0 15.0 38.0 115-119 31.045650000000002 36.4 28.6 38.0 14.2 38.0 120-124 30.213350000000002 35.6 27.0 38.0 13.0 38.0 125-129 29.572899999999997 35.0 24.6 38.0 13.0 38.0 130-134 28.631399999999996 35.0 22.6 38.0 4.2 38.0 135-139 27.48925 34.0 17.2 38.0 2.0 38.0 140-144 26.0551 34.0 14.0 38.0 2.0 38.0 145-149 24.297949999999997 33.0 6.4 38.0 2.0 38.0 150-151 19.9155 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 38.0 3 9.0 4 7.0 5 6.0 6 9.0 7 4.0 8 7.0 9 4.0 10 6.0 11 7.0 12 10.0 13 9.0 14 16.0 15 15.0 16 15.0 17 20.0 18 19.0 19 21.0 20 25.0 21 36.0 22 24.0 23 29.0 24 31.0 25 44.0 26 50.0 27 50.0 28 74.0 29 99.0 30 99.0 31 156.0 32 217.0 33 315.0 34 450.0 35 675.0 36 957.0 37 447.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.2 17.45 12.4 35.949999999999996 2 27.55 24.025 29.875 18.55 3 22.225 25.3 28.225 24.25 4 24.95 31.2 20.674999999999997 23.175 5 27.6 33.125 20.775 18.5 6 23.225 36.5 20.474999999999998 19.8 7 22.425 18.175 36.175000000000004 23.225 8 24.15 23.325000000000003 24.625 27.900000000000002 9 24.55 23.0 27.025 25.424999999999997 10-14 25.795 27.67 22.905 23.630000000000003 15-19 26.02 26.540000000000003 24.095 23.345 20-24 25.465 27.07 24.415 23.05 25-29 25.445 26.605 24.745 23.205000000000002 30-34 24.845 27.155 24.759999999999998 23.24 35-39 25.685000000000002 26.395000000000003 24.965 22.955000000000002 40-44 25.4 26.275 25.165 23.16 45-49 25.595000000000002 26.235000000000003 25.180000000000003 22.99 50-54 24.86 27.16 25.15 22.830000000000002 55-59 24.775 26.400000000000002 25.14 23.685000000000002 60-64 25.165 26.05 25.259999999999998 23.525 65-69 25.169999999999998 26.465 25.564999999999998 22.8 70-74 25.580000000000002 26.875 24.83 22.715 75-79 25.330000000000002 26.56 25.235000000000003 22.875 80-84 24.84 26.815 25.330000000000002 23.015 85-89 24.654999999999998 26.625 25.405 23.315 90-94 25.369999999999997 27.125 24.875 22.63 95-99 25.324999999999996 26.915 25.314999999999998 22.445 100-104 25.385 26.674999999999997 25.019999999999996 22.919999999999998 105-109 25.465 26.55 25.290000000000003 22.695 110-114 25.965 27.445000000000004 24.805 21.785 115-119 25.34 27.235 24.93 22.495 120-124 25.965 26.979999999999997 25.195 21.86 125-129 25.779999999999998 27.71 24.795 21.715 130-134 26.96 26.619999999999997 24.895 21.525 135-139 27.01 27.389999999999997 24.725 20.875 140-144 27.295 27.48 24.69 20.535 145-149 27.71 27.439999999999998 24.635 20.215 150-151 27.075 27.2625 25.5375 20.125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 2.0 22 1.5 23 1.5 24 1.5 25 1.0 26 1.5 27 3.0 28 5.5 29 9.0 30 9.0 31 12.5 32 17.0 33 17.5 34 28.5 35 38.0 36 49.5 37 66.0 38 88.5 39 112.5 40 133.5 41 156.5 42 176.5 43 190.0 44 205.0 45 206.0 46 208.5 47 210.0 48 192.0 49 176.0 50 159.0 51 142.5 52 137.0 53 123.0 54 110.0 55 109.0 56 96.5 57 89.0 58 83.5 59 77.0 60 74.0 61 69.5 62 65.5 63 59.0 64 54.5 65 46.0 66 35.0 67 27.5 68 24.0 69 24.5 70 21.0 71 18.0 72 10.0 73 7.5 74 6.5 75 2.5 76 2.0 77 2.0 78 1.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21796165489405 98.32499999999999 2 0.7315842583249244 1.4500000000000002 3 0.0 0.0 4 0.025227043390514632 0.1 5 0.025227043390514632 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCGGTTGTTGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (97% over 34bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5874999999999999 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.2999999999999998 0.0 0.0 0.0 0.0 98-99 1.5125000000000002 0.0 0.0 0.0 0.0 100-101 1.7125 0.0 0.0 0.0 0.0 102-103 2.0 0.0 0.0 0.0 0.0 104-105 2.375 0.0 0.0 0.0 0.0 106-107 2.825 0.0 0.0 0.0 0.0 108-109 3.0625 0.0 0.0 0.0 0.0 110-111 3.2750000000000004 0.0 0.0 0.0 0.0 112-113 3.65 0.0 0.0 0.0 0.0 114-115 4.0625 0.0 0.0 0.0 0.0 116-117 4.6375 0.0 0.0 0.0 0.0 118-119 5.3 0.0 0.0 0.0 0.0 120-121 5.800000000000001 0.0 0.0 0.0 0.0 122-123 6.324999999999999 0.0 0.0 0.0 0.0 124-125 6.875 0.0 0.0 0.0 0.0 126-127 7.425 0.0 0.0 0.0 0.0 128-129 8.0375 0.0 0.0 0.0 0.0 130-131 8.5625 0.0 0.0 0.0 0.0 132-133 9.25 0.0 0.0 0.0 0.0 134-135 9.9 0.0 0.0 0.0 0.0 136-137 10.825 0.0 0.0 0.0 0.0 138-139 11.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTTAC 10 0.006830828 145.0 8 GATCCAA 10 0.006830828 145.0 5 TCATATT 10 0.006830828 145.0 145 >>END_MODULE Read 306152 spots for SRR6257542.sra Written 306152 spots for SRR6257542.sra Read 306152 spots for SRR6257542.sra Written 306152 spots for SRR6257542.sra Read 306152 spots for SRR6257542.sra Written 306152 spots for SRR6257542.sra Read 306152 spots for SRR6257542.sra Written 306152 spots for SRR6257542.sra Read 306152 spots for SRR6257542.sra Written 306152 spots for SRR6257542.sra Read 306152 spots for SRR6257542.sra Written 306152 spots for SRR6257542.sra Read 306152 spots for SRR6257542.sra Written 306152 spots for SRR6257542.sra Read 306152 spots for SRR6257542.sra Written 306152 spots for SRR6257542.sra Read 306152 spots for SRR6257542.sra Written 306152 spots for SRR6257542.sra Read 306152 spots for SRR6257542.sra Written 306152 spots for SRR6257542.sra Read 306152 spots for SRR6257542.sra Written 306152 spots for SRR6257542.sra Read 306152 spots for SRR6257542.sra Written 306152 spots for SRR6257542.sra Read 306160 spots for SRR6257542.sra Written 306160 spots for SRR6257542.sra Read 306152 spots for SRR6257542.sra Written 306152 spots for SRR6257542.sra Read 306152 spots for SRR6257542.sra Written 306152 spots for SRR6257542.sra Read 306152 spots for SRR6257542.sra Written 306152 spots for SRR6257542.sra Read 306152 spots for SRR6257542.sra Written 306152 spots for SRR6257542.sra Read 306152 spots for SRR6257542.sra Written 306152 spots for SRR6257542.sra Read 306152 spots for SRR6257542.sra Written 306152 spots for SRR6257542.sra Read 306152 spots for SRR6257542.sra Written 306152 spots for SRR6257542.sra SRR ids: ['SRR6257542.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_squivl17 SRR6257542.sra spots: 6123048 blocks: [[1, 306152], [306153, 612304], [612305, 918456], [918457, 1224608], [1224609, 1530760], [1530761, 1836912], [1836913, 2143064], [2143065, 2449216], [2449217, 2755368], [2755369, 3061520], [3061521, 3367672], [3367673, 3673824], [3673825, 3979976], [3979977, 4286128], [4286129, 4592280], [4592281, 4898432], [4898433, 5204584], [5204585, 5510736], [5510737, 5816888], [5816889, 6123048]] SRR6257542 file size 2060771 SRR6257542 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6257542 SRR6257542_1.fastq SRR6257542_2.fastq Input file: SRR6257542_1.fastq Paired file: SRR6257542_2.fastq trimmed: SRR6257542-trimmed-pair1.fastq, SRR6257542-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:07:23 2024 >> started Sat Dec 7 09:07:35 2024 >> done (11.683s) 6123048 read pairs processed; of these: 7126 ( 0.12%) short read pairs filtered out after trimming by size control 14612 ( 0.24%) empty read pairs filtered out after trimming by size control 6101310 (99.64%) read pairs available; of these: 2515891 (41.24%) trimmed read pairs available after processing 3585419 (58.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 5 0.00% 21 0 0.00% 22 2 0.00% 23 2 0.00% 24 7 0.00% 25 6 0.00% 26 6 0.00% 27 6 0.00% 28 9 0.00% 29 7 0.00% 30 6 0.00% 31 6 0.00% 32 10 0.00% 33 7 0.00% 34 7 0.00% 35 12 0.00% 36 6 0.00% 37 7 0.00% 38 14 0.00% 39 15 0.00% 40 23 0.00% 41 13 0.00% 42 22 0.00% 43 22 0.00% 44 20 0.00% 45 22 0.00% 46 28 0.00% 47 24 0.00% 48 35 0.00% 49 45 0.00% 50 48 0.00% 51 47 0.00% 52 47 0.00% 53 50 0.00% 54 68 0.00% 55 68 0.00% 56 78 0.00% 57 103 0.00% 58 100 0.00% 59 125 0.00% 60 140 0.00% 61 167 0.00% 62 201 0.00% 63 219 0.00% 64 247 0.00% 65 256 0.00% 66 307 0.01% 67 342 0.01% 68 420 0.01% 69 448 0.01% 70 476 0.01% 71 542 0.01% 72 677 0.01% 73 836 0.01% 74 946 0.02% 75 1042 0.02% 76 1178 0.02% 77 1354 0.02% 78 1339 0.02% 79 1528 0.03% 80 1668 0.03% 81 1907 0.03% 82 2147 0.04% 83 2426 0.04% 84 3013 0.05% 85 3736 0.06% 86 3923 0.06% 87 4177 0.07% 88 4417 0.07% 89 4825 0.08% 90 4827 0.08% 91 5438 0.09% 92 6297 0.10% 93 6610 0.11% 94 7337 0.12% 95 7983 0.13% 96 8341 0.14% 97 8497 0.14% 98 8826 0.14% 99 9523 0.16% 100 10044 0.16% 101 10592 0.17% 102 11646 0.19% 103 12383 0.20% 104 12803 0.21% 105 13431 0.22% 106 14397 0.24% 107 14979 0.25% 108 15165 0.25% 109 16033 0.26% 110 16543 0.27% 111 16708 0.27% 112 17203 0.28% 113 17572 0.29% 114 19287 0.32% 115 20174 0.33% 116 20716 0.34% 117 20894 0.34% 118 21270 0.35% 119 21280 0.35% 120 21609 0.35% 121 22144 0.36% 122 23125 0.38% 123 23572 0.39% 124 24516 0.40% 125 25295 0.41% 126 25952 0.43% 127 27058 0.44% 128 27074 0.44% 129 27575 0.45% 130 28967 0.47% 131 29385 0.48% 132 29522 0.48% 133 31097 0.51% 134 31727 0.52% 135 32238 0.53% 136 33895 0.56% 137 34624 0.57% 138 35811 0.59% 139 37307 0.61% 140 38792 0.64% 141 40520 0.66% 142 43347 0.71% 143 46029 0.75% 144 49102 0.80% 145 55774 0.91% 146 63564 1.04% 147 77223 1.27% 148 105798 1.73% 149 178235 2.92% 150 802176 13.15% 151 3585419 58.76% 6101310 reads passed initial QC criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=11 prefix-density=1.01 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=40.44 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.8 sequence=GTTCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGG criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=31 prefix-density=0.65 prefix-fanout=1.9 sequence=AGGTACTGGACAATGTGGAAGCTGCCCATGTTCGGGTGCACCGACGCCACGCAGGTGCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=52.80 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.9 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6257542 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:08:13 Started mapping on | Dec 07 09:08:13 Finished on | Dec 07 09:08:45 Mapping speed, Million of reads per hour | 686.40 Number of input reads | 6101310 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 5896854 Uniquely mapped reads % | 96.65% Average mapped length | 289.83 Number of splices: Total | 6732323 Number of splices: Annotated (sjdb) | 6333780 Number of splices: GT/AG | 6643922 Number of splices: GC/AG | 79554 Number of splices: AT/AC | 3392 Number of splices: Non-canonical | 5455 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 91326 % of reads mapped to multiple loci | 1.50% Number of reads mapped to too many loci | 15299 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.29% % of reads unmapped: other | 1.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 118396 118396 118396 N_multimapping 91326 91326 91326 N_noFeature 241709 5719589 305382 N_ambiguous 134518 804 20962 UnstrandedReadsAssigned:5520627 PositiveStrandReadsAssigned:176461 NegativeStrandReadsAssigned:5570510 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6257542 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6257542-trimmed-pair1.fastq SRR6257542-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,101,310 reads, 5,621,409 reads pseudoaligned [quant] estimated average fragment length: 225.986 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52973 SRR6257542.ke.tsv 35125 SRR6257542.se.tsv 88098 total ==> SRR6257542.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 711.282 0.0249403 0.00896708 PNS24247 1044 819.014 19.7682 6.17256 PNS24249 1928 1703.01 12.7545 1.91529 PNS24246 1044 819.014 19.7682 6.17256 PNS24248 1044 819.014 19.7682 6.17256 PNS24244 1471 1246.01 5.91609 1.21423 PNS24243 293 106.513 0 0 KQK14069 1603 1378.01 1689.23 313.492 KQK14071 474 258.939 36.4035 35.9532 ==> SRR6257542.se.tsv <== BRADI_1g14170v3 1993 BRADI_1g53295v3 16 BRADI_1g59795v3 121 BRADI_1g07683v3 0 BRADI_1g00485v3 17 BRADI_1g20270v3 902 BRADI_1g74790v3 61 BRADI_1g09890v3 2 BRADI_1g77505v3 126 BRADI_1g48960v3 0 SRR6257542 completed mapping pipeline successfully