Starting /dee2/code/volunteer_pipeline.sh SRR6322337 current disk space = 1543084445696 free memory = 1600657748 SRR6322337 SRAfilesize db693c2b74684529358e32adb66657e2 SRR6322337.sra SRR6322337.sra file validated SRR6322337 is single end SRR6322337 is conventional basespace SRR6322337 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322337_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 53 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.855 32.0 32.0 32.0 32.0 32.0 2 31.54375 32.0 32.0 32.0 32.0 32.0 3 35.80625 37.0 37.0 37.0 32.0 37.0 4 36.38125 37.0 37.0 37.0 37.0 37.0 5 36.71875 37.0 37.0 37.0 37.0 37.0 6 40.3755 41.0 41.0 41.0 41.0 41.0 7 40.28875 41.0 41.0 41.0 41.0 41.0 8 33.904 37.0 32.0 41.0 12.0 41.0 9 37.7035 41.0 37.0 41.0 32.0 41.0 10 34.968 41.0 32.0 41.0 22.0 41.0 11 39.872 41.0 41.0 41.0 37.0 41.0 12 38.874 41.0 41.0 41.0 32.0 41.0 13 36.3635 41.0 37.0 41.0 27.0 41.0 14 36.14975 41.0 32.0 41.0 22.0 41.0 15 39.577 41.0 41.0 41.0 37.0 41.0 16 35.954 41.0 32.0 41.0 22.0 41.0 17 40.0755 41.0 41.0 41.0 37.0 41.0 18 40.367 41.0 41.0 41.0 41.0 41.0 19 36.9645 41.0 37.0 41.0 27.0 41.0 20 39.376 41.0 41.0 41.0 37.0 41.0 21 39.186 41.0 41.0 41.0 37.0 41.0 22 36.9825 41.0 37.0 41.0 27.0 41.0 23 39.56575 41.0 41.0 41.0 37.0 41.0 24 40.435 41.0 41.0 41.0 41.0 41.0 25 35.022 41.0 32.0 41.0 22.0 41.0 26 39.31875 41.0 41.0 41.0 37.0 41.0 27 30.80125 37.0 22.0 41.0 12.0 41.0 28 37.0255 41.0 37.0 41.0 27.0 41.0 29 38.9985 41.0 41.0 41.0 37.0 41.0 30 39.97125 41.0 41.0 41.0 37.0 41.0 31 34.268 41.0 32.0 41.0 12.0 41.0 32 32.57075 37.0 27.0 41.0 12.0 41.0 33 31.4315 37.0 22.0 41.0 12.0 41.0 34 33.86225 37.0 27.0 41.0 12.0 41.0 35 37.956 41.0 37.0 41.0 27.0 41.0 36 26.70375 27.0 12.0 41.0 12.0 41.0 37 30.028 37.0 22.0 41.0 12.0 41.0 38 23.52475 22.0 12.0 37.0 12.0 41.0 39 23.93225 22.0 12.0 37.0 12.0 41.0 40 32.76175 37.0 27.0 41.0 22.0 41.0 41 38.32125 41.0 37.0 41.0 32.0 41.0 42 34.10975 41.0 32.0 41.0 12.0 41.0 43 25.522 27.0 12.0 37.0 12.0 41.0 44 24.4775 22.0 12.0 37.0 12.0 41.0 45 21.914 22.0 12.0 32.0 12.0 37.0 46 28.51225 27.0 22.0 37.0 12.0 41.0 47 24.86875 27.0 12.0 37.0 12.0 41.0 48 36.19875 37.0 37.0 41.0 27.0 41.0 49 38.686 41.0 37.0 41.0 32.0 41.0 50 39.84725 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 3.0 25 18.0 26 33.0 27 48.0 28 65.0 29 102.0 30 132.0 31 207.0 32 302.0 33 442.0 34 520.0 35 589.0 36 621.0 37 507.0 38 280.0 39 117.0 40 12.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.125 7.225 11.725 39.925 2 26.327655310621246 14.253507014028056 27.980961923847698 31.437875751503007 3 26.075 14.299999999999999 25.224999999999998 34.4 4 31.25 19.6 19.15 30.0 5 32.975 22.675 22.525000000000002 21.825 6 30.425 27.55 21.675 20.349999999999998 7 19.925 25.525 36.25 18.3 8 26.450000000000003 25.424999999999997 24.875 23.25 9 27.075 20.974999999999998 29.125 22.825 10 24.6 34.875 22.075 18.45 11 31.275 22.275 21.175 25.275 12 25.575 19.5 25.25 29.675 13 26.35 25.825 22.725 25.1 14 25.85 23.75 23.0 27.400000000000002 15 24.425 26.224999999999998 24.6 24.75 16 26.55 24.375 19.775000000000002 29.299999999999997 17 27.825 23.200000000000003 23.075000000000003 25.900000000000002 18 24.425 22.925 28.7 23.95 19 26.450000000000003 21.15 22.55 29.849999999999998 20 23.7 22.05 28.725 25.525 21 28.425 23.125 23.35 25.1 22 26.375 27.375 21.2 25.05 23 24.099999999999998 28.075 22.775000000000002 25.05 24 23.325000000000003 23.3 24.099999999999998 29.275000000000002 25 27.825 21.975 24.45 25.75 26 23.5 23.95 23.400000000000002 29.15 27 26.8 21.55 23.775 27.875 28 26.025 25.3 22.075 26.6 29 29.275000000000002 23.425 22.375 24.925 30 26.674999999999997 21.925 26.5 24.9 31 27.474999999999998 22.325 21.349999999999998 28.849999999999998 32 26.200000000000003 27.025 22.825 23.95 33 26.125 21.475 23.7 28.7 34 29.925 22.3 20.7 27.075 35 25.0 26.55 23.95 24.5 36 31.424999999999997 20.625 25.974999999999998 21.975 37 30.025000000000002 21.875 24.25 23.849999999999998 38 31.05 21.4 25.35 22.2 39 32.975 21.675 23.1 22.25 40 26.85 26.174999999999997 22.425 24.55 41 23.7 25.275 27.3 23.724999999999998 42 26.125 25.85 23.05 24.975 43 28.549999999999997 21.275 27.425 22.75 44 28.975 21.275 25.025 24.725 45 27.525 22.0 27.625 22.85 46 28.075 20.849999999999998 21.05 30.025000000000002 47 31.775 20.849999999999998 23.3 24.075 48 23.599999999999998 21.475 28.000000000000004 26.924999999999997 49 24.675 26.55 23.1 25.674999999999997 50 23.95 23.925 27.400000000000002 24.725 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 2.0 25 2.5 26 3.0 27 5.5 28 8.0 29 14.5 30 21.0 31 27.5 32 34.0 33 35.0 34 36.0 35 58.5 36 81.0 37 89.5 38 98.0 39 123.0 40 148.0 41 182.0 42 216.0 43 220.5 44 225.0 45 252.0 46 279.0 47 311.0 48 343.0 49 351.0 50 359.0 51 350.0 52 341.0 53 296.5 54 252.0 55 239.0 56 226.0 57 216.5 58 207.0 59 212.0 60 217.0 61 194.0 62 171.0 63 158.5 64 146.0 65 148.0 66 150.0 67 128.0 68 106.0 69 104.5 70 103.0 71 91.0 72 79.0 73 64.0 74 49.0 75 47.5 76 46.0 77 34.5 78 23.0 79 18.5 80 14.0 81 12.5 82 11.0 83 7.5 84 4.0 85 2.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.2 #Duplication Level Percentage of deduplicated Percentage of total 1 98.79115226337449 96.025 2 0.9002057613168725 1.7500000000000002 3 0.102880658436214 0.3 4 0.0257201646090535 0.1 5 0.0257201646090535 0.125 6 0.0 0.0 7 0.0257201646090535 0.17500000000000002 8 0.051440329218107 0.4 9 0.0 0.0 >10 0.07716049382716049 1.125 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATATCTCGTAT 22 0.5499999999999999 TruSeq Adapter, Index 7 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATATCGCGTAT 12 0.3 TruSeq Adapter, Index 7 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATAGCTCGTAT 11 0.27499999999999997 TruSeq Adapter, Index 7 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTTGATATCTCGTAT 8 0.2 TruSeq Adapter, Index 7 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATTGGATAGCTCGTAT 8 0.2 TruSeq Adapter, Index 21 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATAGCGCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 7 (97% over 36bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATATCTCGTA 5 0.125 TruSeq Adapter, Index 7 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.825 0.0 0.0 0.0 0.0 2 0.825 0.0 0.0 0.0 0.0 3 0.825 0.0 0.0 0.0 0.0 4 0.825 0.0 0.0 0.0 0.0 5 0.825 0.0 0.0 0.0 0.0 6 0.825 0.0 0.0 0.0 0.0 7 0.825 0.0 0.0 0.0 0.0 8 0.825 0.0 0.0 0.0 0.0 9 0.825 0.0 0.0 0.0 0.0 10 0.825 0.0 0.0 0.0 0.0 11 0.825 0.0 0.0 0.0 0.0 12 0.825 0.0 0.0 0.0 0.0 13 0.825 0.0 0.0 0.0 0.0 14 0.825 0.0 0.0 0.0 0.0 15 0.825 0.0 0.0 0.0 0.0 16 0.825 0.0 0.0 0.0 0.0 17 0.825 0.0 0.0 0.0 0.0 18 0.825 0.0 0.0 0.0 0.0 19 0.825 0.0 0.0 0.0 0.0 20 0.825 0.0 0.0 0.0 0.0 21 0.825 0.0 0.0 0.0 0.0 22 0.825 0.0 0.0 0.0 0.0 23 0.825 0.0 0.0 0.0 0.0 24 0.825 0.0 0.0 0.0 0.0 25 0.825 0.0 0.0 0.0 0.0 26 0.825 0.0 0.0 0.0 0.0 27 0.825 0.0 0.0 0.0 0.0 28 0.825 0.0 0.0 0.0 0.0 29 0.825 0.0 0.0 0.0 0.0 30 0.825 0.0 0.0 0.0 0.0 31 0.825 0.0 0.0 0.0 0.0 32 0.825 0.0 0.0 0.0 0.0 33 0.825 0.0 0.0 0.0 0.0 34 0.825 0.0 0.0 0.0 0.0 35 0.825 0.0 0.0 0.0 0.0 36 0.825 0.0 0.0 0.0 0.0 37 0.825 0.0 0.0 0.0 0.0 38 0.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 980206 READS because READLEN < 1 Read 980206 spots for SRR6322337.sra Written 980206 spots for SRR6322337.sra Rejected 980206 READS because READLEN < 1 Read 980206 spots for SRR6322337.sra Written 980206 spots for SRR6322337.sra Rejected 980206 READS because READLEN < 1 Read 980206 spots for SRR6322337.sra Written 980206 spots for SRR6322337.sra Rejected 980206 READS because READLEN < 1 Read 980206 spots for SRR6322337.sra Written 980206 spots for SRR6322337.sra Rejected 980206 READS because READLEN < 1 Read 980206 spots for SRR6322337.sra Written 980206 spots for SRR6322337.sra Rejected 980206 READS because READLEN < 1 Read 980206 spots for SRR6322337.sra Written 980206 spots for SRR6322337.sra Rejected 980206 READS because READLEN < 1 Read 980206 spots for SRR6322337.sra Written 980206 spots for SRR6322337.sra Rejected 980206 READS because READLEN < 1 Read 980206 spots for SRR6322337.sra Written 980206 spots for SRR6322337.sra Rejected 980206 READS because READLEN < 1 Read 980206 spots for SRR6322337.sra Written 980206 spots for SRR6322337.sra Rejected 980206 READS because READLEN < 1 Read 980206 spots for SRR6322337.sra Written 980206 spots for SRR6322337.sra Rejected 980206 READS because READLEN < 1 Read 980206 spots for SRR6322337.sra Written 980206 spots for SRR6322337.sra Rejected 980206 READS because READLEN < 1 Read 980206 spots for SRR6322337.sra Written 980206 spots for SRR6322337.sra Rejected 980221 READS because READLEN < 1 Read 980221 spots for SRR6322337.sra Written 980221 spots for SRR6322337.sra Rejected 980206 READS because READLEN < 1 Read 980206 spots for SRR6322337.sra Written 980206 spots for SRR6322337.sra Rejected 980206 READS because READLEN < 1 Read 980206 spots for SRR6322337.sra Written 980206 spots for SRR6322337.sra Rejected 980206 READS because READLEN < 1 Read 980206 spots for SRR6322337.sra Written 980206 spots for SRR6322337.sra Rejected 980206 READS because READLEN < 1 Read 980206 spots for SRR6322337.sra Written 980206 spots for SRR6322337.sra Rejected 980206 READS because READLEN < 1 Read 980206 spots for SRR6322337.sra Written 980206 spots for SRR6322337.sra Rejected 980206 READS because READLEN < 1 Read 980206 spots for SRR6322337.sra Written 980206 spots for SRR6322337.sra Rejected 980206 READS because READLEN < 1 Read 980206 spots for SRR6322337.sra Written 980206 spots for SRR6322337.sra SRR ids: ['SRR6322337.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tuoe_70v SRR6322337.sra spots: 19604135 blocks: [[1, 980206], [980207, 1960412], [1960413, 2940618], [2940619, 3920824], [3920825, 4901030], [4901031, 5881236], [5881237, 6861442], [6861443, 7841648], [7841649, 8821854], [8821855, 9802060], [9802061, 10782266], [10782267, 11762472], [11762473, 12742678], [12742679, 13722884], [13722885, 14703090], [14703091, 15683296], [15683297, 16663502], [16663503, 17643708], [17643709, 18623914], [18623915, 19604135]] SRR6322337 file size 2735131 SRR6322337 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322337 SRR6322337_1.fastq Input file: SRR6322337_1.fastq trimmed: SRR6322337-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:30:08 2024 >> started Sat Dec 7 11:30:15 2024 >> done (7.187s) 19604135 reads processed; of these: 446 ( 0.00%) short reads filtered out after trimming by size control 918090 ( 4.68%) empty reads filtered out after trimming by size control 18685599 (95.31%) reads available; of these: 1284 ( 0.01%) trimmed reads available after processing 18684315 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 1271 0.01% 50 18684315 99.99% 18685599 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=31 prefix-density=0.13 prefix-fanout=2.1 sequence=GAGCTTGGCGGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=4 fanout-score=78.31 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=14.0 sequence=GCGGCGGCGGCGCCCATCTCGCCGAGGTGCTCCTTGTGCTTGTGGTGCTTCTCCTCCTTGGTGATGCGCTCGTACTCGCCGTCGGCGCCGGTTGGGGTTACCACCGTCTCCGCCGAGTACCCGTACTCGTCGACGGCGCCCGTGGTGGGGTTGACGACCACGTCGGTGTCTTCCTTCTTGTGGTGGAACAGGTGGTGCTTCTTTTCCTCCGCCATGGCCGCCGGTTGATCAAAAGCTCGAGGAGCTAGCTACTGAGCT Started job on | Dec 07 11:30:27 Started mapping on | Dec 07 11:30:27 Finished on | Dec 07 11:30:46 Mapping speed, Million of reads per hour | 3540.43 Number of input reads | 18685599 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 18080379 Uniquely mapped reads % | 96.76% Average mapped length | 49.84 Number of splices: Total | 2353018 Number of splices: Annotated (sjdb) | 2263748 Number of splices: GT/AG | 2320006 Number of splices: GC/AG | 28500 Number of splices: AT/AC | 1236 Number of splices: Non-canonical | 3276 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.00% Deletion average length | 1.73 Insertion rate per base | 0.00% Insertion average length | 1.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 354725 % of reads mapped to multiple loci | 1.90% Number of reads mapped to too many loci | 51092 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.06% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 250495 250495 250495 N_multimapping 354725 354725 354725 N_noFeature 716789 17672105 866614 N_ambiguous 275811 1185 18588 UnstrandedReadsAssigned:17087779 PositiveStrandReadsAssigned:407089 NegativeStrandReadsAssigned:17195177 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322337 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322337-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,685,599 reads, 16,950,528 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52973 SRR6322337.ke.tsv 35125 SRR6322337.se.tsv 88098 total ==> SRR6322337.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 1.08969e-06 1.35803e-07 PNS24247 1044 945 50.4169 5.56513 PNS24249 1928 1829 83.4887 4.76152 PNS24246 1044 945 50.4169 5.56513 PNS24248 1044 945 50.4169 5.56513 PNS24244 1471 1372 30.2607 2.30068 PNS24243 293 194 0 0 KQK14069 1603 1504 6.66231 0.462071 KQK14071 474 375 13.407 3.72935 ==> SRR6322337.se.tsv <== BRADI_1g14170v3 20 BRADI_1g53295v3 67 BRADI_1g59795v3 268 BRADI_1g07683v3 0 BRADI_1g00485v3 33 BRADI_1g20270v3 368 BRADI_1g74790v3 254 BRADI_1g09890v3 24 BRADI_1g77505v3 183 BRADI_1g48960v3 5 SRR6322337 completed mapping pipeline successfully