Starting /dee2/code/volunteer_pipeline.sh SRR6322338 current disk space = 1543057694720 free memory = 1606411328 SRR6322338 SRAfilesize 136f5752810b6c2381f6c77c5bc3330f SRR6322338.sra SRR6322338.sra file validated SRR6322338 is single end SRR6322338 is conventional basespace SRR6322338 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322338_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.745 32.0 32.0 32.0 32.0 32.0 2 26.07625 32.0 12.0 32.0 12.0 32.0 3 33.69625 32.0 32.0 37.0 32.0 37.0 4 35.50375 37.0 37.0 37.0 32.0 37.0 5 36.61625 37.0 37.0 37.0 37.0 37.0 6 40.07325 41.0 41.0 41.0 37.0 41.0 7 32.1135 37.0 27.0 41.0 12.0 41.0 8 38.74775 41.0 37.0 41.0 32.0 41.0 9 38.87875 41.0 37.0 41.0 32.0 41.0 10 40.1335 41.0 41.0 41.0 37.0 41.0 11 40.3345 41.0 41.0 41.0 41.0 41.0 12 40.202 41.0 41.0 41.0 37.0 41.0 13 39.11025 41.0 41.0 41.0 37.0 41.0 14 38.1655 41.0 37.0 41.0 32.0 41.0 15 39.52975 41.0 41.0 41.0 37.0 41.0 16 36.60825 41.0 37.0 41.0 27.0 41.0 17 39.7205 41.0 41.0 41.0 37.0 41.0 18 40.33225 41.0 41.0 41.0 41.0 41.0 19 40.16275 41.0 41.0 41.0 37.0 41.0 20 36.53625 41.0 37.0 41.0 27.0 41.0 21 39.889 41.0 41.0 41.0 37.0 41.0 22 40.05875 41.0 41.0 41.0 37.0 41.0 23 38.5485 41.0 41.0 41.0 32.0 41.0 24 40.00175 41.0 41.0 41.0 37.0 41.0 25 34.49225 41.0 32.0 41.0 12.0 41.0 26 37.7325 41.0 37.0 41.0 27.0 41.0 27 35.52675 41.0 32.0 41.0 22.0 41.0 28 30.58775 37.0 22.0 41.0 12.0 41.0 29 38.33275 41.0 37.0 41.0 32.0 41.0 30 34.30575 41.0 32.0 41.0 12.0 41.0 31 39.341 41.0 41.0 41.0 37.0 41.0 32 27.9615 32.0 12.0 41.0 12.0 41.0 33 33.683 37.0 27.0 41.0 12.0 41.0 34 31.56175 37.0 22.0 41.0 12.0 41.0 35 36.229 41.0 37.0 41.0 22.0 41.0 36 24.96425 27.0 12.0 37.0 12.0 41.0 37 37.8945 41.0 37.0 41.0 32.0 41.0 38 38.992 41.0 41.0 41.0 37.0 41.0 39 33.996 41.0 32.0 41.0 12.0 41.0 40 38.76425 41.0 37.0 41.0 32.0 41.0 41 27.6115 32.0 12.0 41.0 12.0 41.0 42 37.8545 41.0 37.0 41.0 32.0 41.0 43 39.8165 41.0 41.0 41.0 37.0 41.0 44 39.014 41.0 41.0 41.0 37.0 41.0 45 34.929 41.0 32.0 41.0 12.0 41.0 46 38.95 41.0 41.0 41.0 37.0 41.0 47 39.66925 41.0 41.0 41.0 37.0 41.0 48 39.5555 41.0 41.0 41.0 37.0 41.0 49 39.8685 41.0 41.0 41.0 37.0 41.0 50 38.72075 41.0 41.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 1.0 24 2.0 25 8.0 26 10.0 27 20.0 28 34.0 29 60.0 30 62.0 31 93.0 32 141.0 33 162.0 34 241.0 35 371.0 36 513.0 37 751.0 38 848.0 39 575.0 40 104.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.35 7.3999999999999995 6.800000000000001 40.45 2 29.158266129032256 8.644153225806452 36.038306451612904 26.159274193548388 3 23.925 13.725000000000001 22.2 40.150000000000006 4 29.45 19.45 20.575 30.525000000000002 5 29.7 25.724999999999998 22.775000000000002 21.8 6 24.45 28.499999999999996 24.55 22.5 7 22.6 21.6 39.2 16.6 8 21.375 22.25 32.550000000000004 23.825 9 20.8 21.099999999999998 34.075 24.025 10 22.325 32.875 25.900000000000002 18.9 11 25.4 24.375 24.925 25.3 12 22.7 23.150000000000002 27.85 26.3 13 22.925 25.0 27.05 25.025 14 24.099999999999998 24.349999999999998 26.625 24.925 15 23.925 24.825 25.624999999999996 25.624999999999996 16 27.025 22.650000000000002 24.175 26.150000000000002 17 23.75 24.65 26.825 24.775 18 22.900000000000002 24.474999999999998 25.5 27.125 19 23.775 25.4 24.474999999999998 26.35 20 26.450000000000003 24.349999999999998 24.575 24.625 21 22.225 24.7 26.025 27.05 22 24.65 25.474999999999998 24.675 25.2 23 24.975 25.525 25.6 23.9 24 24.05 24.25 24.325 27.375 25 28.725 23.875 21.575 25.825 26 24.05 24.875 25.900000000000002 25.174999999999997 27 25.0 23.849999999999998 25.324999999999996 25.825 28 28.225 24.224999999999998 21.775 25.775 29 23.125 25.0 26.674999999999997 25.2 30 26.150000000000002 22.825 25.25 25.775 31 23.95 23.5 26.875 25.674999999999997 32 30.45 22.875 25.35 21.325 33 24.175 23.225 26.275 26.325 34 24.925 25.2 25.900000000000002 23.974999999999998 35 24.349999999999998 25.474999999999998 26.1 24.075 36 28.499999999999996 25.224999999999998 23.775 22.5 37 23.674999999999997 26.150000000000002 24.125 26.05 38 23.974999999999998 25.75 25.15 25.124999999999996 39 25.3 23.175 25.25 26.275 40 24.575 25.525 25.0 24.9 41 29.525000000000002 22.650000000000002 24.725 23.1 42 24.275 23.075000000000003 25.05 27.6 43 23.1 24.275 26.5 26.125 44 24.6 23.9 25.6 25.900000000000002 45 25.174999999999997 23.075000000000003 25.900000000000002 25.85 46 23.599999999999998 24.25 24.7 27.450000000000003 47 23.474999999999998 25.775 26.25 24.5 48 23.05 23.775 27.474999999999998 25.7 49 23.625 25.7 24.925 25.75 50 24.7 24.525 25.900000000000002 24.875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 1.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 5.0 24 9.0 25 8.0 26 7.0 27 6.5 28 6.0 29 13.0 30 20.0 31 29.0 32 38.0 33 44.0 34 50.0 35 76.5 36 103.0 37 128.5 38 154.0 39 173.5 40 193.0 41 233.5 42 274.0 43 287.5 44 301.0 45 324.0 46 347.0 47 345.5 48 344.0 49 334.0 50 324.0 51 306.5 52 289.0 53 287.0 54 285.0 55 256.5 56 228.0 57 216.0 58 204.0 59 180.5 60 157.0 61 155.5 62 154.0 63 157.0 64 160.0 65 125.0 66 90.0 67 87.0 68 84.0 69 70.0 70 56.0 71 51.5 72 47.0 73 40.5 74 34.0 75 27.5 76 21.0 77 13.0 78 5.0 79 5.5 80 6.0 81 5.0 82 4.0 83 2.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.8 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.93156281920326 95.875 2 1.9918283963227785 3.9 3 0.07660878447395301 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1078666 READS because READLEN < 1 Read 1078666 spots for SRR6322338.sra Written 1078666 spots for SRR6322338.sra Rejected 1078666 READS because READLEN < 1 Read 1078666 spots for SRR6322338.sra Written 1078666 spots for SRR6322338.sra Rejected 1078666 READS because READLEN < 1 Read 1078666 spots for SRR6322338.sra Written 1078666 spots for SRR6322338.sra Rejected 1078666 READS because READLEN < 1 Read 1078666 spots for SRR6322338.sra Written 1078666 spots for SRR6322338.sra Rejected 1078666 READS because READLEN < 1 Read 1078666 spots for SRR6322338.sra Written 1078666 spots for SRR6322338.sra Rejected 1078666 READS because READLEN < 1 Read 1078666 spots for SRR6322338.sra Written 1078666 spots for SRR6322338.sra Rejected 1078680 READS because READLEN < 1 Read 1078680 spots for SRR6322338.sra Written 1078680 spots for SRR6322338.sra Rejected 1078666 READS because READLEN < 1 Read 1078666 spots for SRR6322338.sra Written 1078666 spots for SRR6322338.sra Rejected 1078666 READS because READLEN < 1 Read 1078666 spots for SRR6322338.sra Written 1078666 spots for SRR6322338.sra Rejected 1078666 READS because READLEN < 1 Read 1078666 spots for SRR6322338.sra Written 1078666 spots for SRR6322338.sra Rejected 1078666 READS because READLEN < 1 Read 1078666 spots for SRR6322338.sra Written 1078666 spots for SRR6322338.sra Rejected 1078666 READS because READLEN < 1 Read 1078666 spots for SRR6322338.sra Written 1078666 spots for SRR6322338.sra Rejected 1078666 READS because READLEN < 1 Read 1078666 spots for SRR6322338.sra Written 1078666 spots for SRR6322338.sra Rejected 1078666 READS because READLEN < 1 Read 1078666 spots for SRR6322338.sra Written 1078666 spots for SRR6322338.sra Rejected 1078666 READS because READLEN < 1 Read 1078666 spots for SRR6322338.sra Written 1078666 spots for SRR6322338.sra Rejected 1078666 READS because READLEN < 1 Read 1078666 spots for SRR6322338.sra Written 1078666 spots for SRR6322338.sra Rejected 1078666 READS because READLEN < 1 Read 1078666 spots for SRR6322338.sra Written 1078666 spots for SRR6322338.sra Rejected 1078666 READS because READLEN < 1 Read 1078666 spots for SRR6322338.sra Written 1078666 spots for SRR6322338.sra Rejected 1078666 READS because READLEN < 1 Read 1078666 spots for SRR6322338.sra Written 1078666 spots for SRR6322338.sra Rejected 1078666 READS because READLEN < 1 Read 1078666 spots for SRR6322338.sra Written 1078666 spots for SRR6322338.sra SRR ids: ['SRR6322338.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__bfyslac SRR6322338.sra spots: 21573334 blocks: [[1, 1078666], [1078667, 2157332], [2157333, 3235998], [3235999, 4314664], [4314665, 5393330], [5393331, 6471996], [6471997, 7550662], [7550663, 8629328], [8629329, 9707994], [9707995, 10786660], [10786661, 11865326], [11865327, 12943992], [12943993, 14022658], [14022659, 15101324], [15101325, 16179990], [16179991, 17258656], [17258657, 18337322], [18337323, 19415988], [19415989, 20494654], [20494655, 21573334]] SRR6322338 file size 3012049 SRR6322338 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322338 SRR6322338_1.fastq Input file: SRR6322338_1.fastq trimmed: SRR6322338-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:32:34 2024 >> started Sat Dec 7 11:32:47 2024 >> done (13.012s) 21573334 reads processed; of these: 217 ( 0.00%) short reads filtered out after trimming by size control 21940 ( 0.10%) empty reads filtered out after trimming by size control 21551177 (99.90%) reads available; of these: 49 ( 0.00%) trimmed reads available after processing 21551128 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 43 0.00% 50 21551128 100.00% 21551177 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=24 prefix-density=0.13 prefix-fanout=2.2 sequence=TTAGGCATGGGCTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=18 fanout-score=48.55 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=9.8 sequence=GCGGCGGCGGCGCCCATCTCGCCGAGGTGCTCCTTGTGCTTGTGGTGCTTCTCCTCCTTGGTGATGCGCTCGTACTCGCCGTCGGCGCCGGTTGGGGTTACCACCGTCTCCGCCGAGTACCCGTACTCGTCGACGGCGCCCGTGGTGGGGTTGACGACCACGTCGGTGTCTTCCTTCTTGTGGTGGAACAGGTGGTGCTTCTTTTCCTCCGCCATGGCCGCCGGTTGATCAAAAGCTCGAGGAG Started job on | Dec 07 11:32:58 Started mapping on | Dec 07 11:32:58 Finished on | Dec 07 11:33:16 Mapping speed, Million of reads per hour | 4310.24 Number of input reads | 21551177 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 20806343 Uniquely mapped reads % | 96.54% Average mapped length | 49.83 Number of splices: Total | 2902601 Number of splices: Annotated (sjdb) | 2807992 Number of splices: GT/AG | 2862932 Number of splices: GC/AG | 34961 Number of splices: AT/AC | 1526 Number of splices: Non-canonical | 3182 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.00% Deletion average length | 1.72 Insertion rate per base | 0.00% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 448452 % of reads mapped to multiple loci | 2.08% Number of reads mapped to too many loci | 113497 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.83% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 296382 296382 296382 N_multimapping 448452 448452 448452 N_noFeature 848218 20340073 1001400 N_ambiguous 332659 1218 20780 UnstrandedReadsAssigned:19625466 PositiveStrandReadsAssigned:465052 NegativeStrandReadsAssigned:19784163 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322338 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322338-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,551,177 reads, 19,305,069 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,216 rounds 52973 SRR6322338.ke.tsv 35125 SRR6322338.se.tsv 88098 total ==> SRR6322338.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 95.024 10.8532 PNS24247 1044 945 32.3886 3.2765 PNS24249 1928 1829 11.1839 0.584559 PNS24246 1044 945 32.3886 3.2765 PNS24248 1044 945 32.3886 3.2765 PNS24244 1471 1372 81.6263 5.68755 PNS24243 293 194 0 0 KQK14069 1603 1504 18.6501 1.18545 KQK14071 474 375 2.39454 0.610435 ==> SRR6322338.se.tsv <== BRADI_1g14170v3 22 BRADI_1g53295v3 60 BRADI_1g59795v3 245 BRADI_1g07683v3 0 BRADI_1g00485v3 91 BRADI_1g20270v3 415 BRADI_1g74790v3 278 BRADI_1g09890v3 19 BRADI_1g77505v3 286 BRADI_1g48960v3 1 SRR6322338 completed mapping pipeline successfully