Starting /dee2/code/volunteer_pipeline.sh SRR6322339 current disk space = 1543029096448 free memory = 1602768536 SRR6322339 SRAfilesize b811cad8d7645ca1512f6040d3cd24c0 SRR6322339.sra SRR6322339.sra file validated SRR6322339 is single end SRR6322339 is conventional basespace SRR6322339 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322339_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8525 32.0 32.0 32.0 32.0 32.0 2 31.3475 32.0 32.0 32.0 32.0 32.0 3 35.54625 37.0 37.0 37.0 32.0 37.0 4 36.16 37.0 37.0 37.0 32.0 37.0 5 36.67625 37.0 37.0 37.0 37.0 37.0 6 40.33475 41.0 41.0 41.0 41.0 41.0 7 40.258 41.0 41.0 41.0 37.0 41.0 8 33.4995 37.0 32.0 41.0 12.0 41.0 9 37.06925 41.0 37.0 41.0 27.0 41.0 10 34.40075 37.0 32.0 41.0 12.0 41.0 11 39.7615 41.0 41.0 41.0 37.0 41.0 12 38.40475 41.0 37.0 41.0 32.0 41.0 13 35.66725 41.0 32.0 41.0 22.0 41.0 14 35.5215 41.0 32.0 41.0 22.0 41.0 15 39.31275 41.0 41.0 41.0 37.0 41.0 16 35.3785 41.0 32.0 41.0 22.0 41.0 17 39.91675 41.0 41.0 41.0 37.0 41.0 18 40.34525 41.0 41.0 41.0 37.0 41.0 19 36.4665 41.0 37.0 41.0 22.0 41.0 20 39.13075 41.0 41.0 41.0 32.0 41.0 21 39.1405 41.0 41.0 41.0 37.0 41.0 22 36.89475 41.0 37.0 41.0 27.0 41.0 23 39.4865 41.0 41.0 41.0 37.0 41.0 24 40.4335 41.0 41.0 41.0 41.0 41.0 25 35.12475 41.0 32.0 41.0 22.0 41.0 26 39.10925 41.0 41.0 41.0 37.0 41.0 27 30.66775 37.0 22.0 41.0 12.0 41.0 28 35.96175 41.0 37.0 41.0 22.0 41.0 29 38.854 41.0 37.0 41.0 37.0 41.0 30 39.50275 41.0 41.0 41.0 37.0 41.0 31 33.72175 41.0 27.0 41.0 12.0 41.0 32 31.596 37.0 22.0 41.0 12.0 41.0 33 30.74825 37.0 22.0 41.0 12.0 41.0 34 33.103 37.0 27.0 41.0 12.0 41.0 35 37.54425 41.0 37.0 41.0 27.0 41.0 36 26.34825 27.0 12.0 37.0 12.0 41.0 37 29.36575 32.0 22.0 41.0 12.0 41.0 38 23.2735 22.0 12.0 37.0 12.0 41.0 39 23.48425 22.0 12.0 32.0 12.0 41.0 40 32.50275 37.0 27.0 41.0 22.0 41.0 41 38.1655 41.0 37.0 41.0 32.0 41.0 42 33.869 37.0 32.0 41.0 12.0 41.0 43 25.16625 27.0 12.0 37.0 12.0 41.0 44 24.4065 22.0 12.0 37.0 12.0 41.0 45 21.69725 22.0 12.0 32.0 12.0 37.0 46 28.4955 27.0 22.0 37.0 12.0 41.0 47 24.64075 22.0 12.0 37.0 12.0 41.0 48 35.972 37.0 32.0 41.0 27.0 41.0 49 38.203 41.0 37.0 41.0 32.0 41.0 50 39.75325 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 4.0 24 7.0 25 23.0 26 30.0 27 53.0 28 75.0 29 110.0 30 199.0 31 229.0 32 346.0 33 451.0 34 515.0 35 596.0 36 555.0 37 459.0 38 247.0 39 89.0 40 9.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.9 8.375 6.25 34.475 2 26.502388735227562 10.18355544380186 33.56801609253206 29.74603972843852 3 24.224999999999998 14.924999999999999 22.625 38.224999999999994 4 30.9 21.025 20.5 27.575 5 28.425 26.575 23.05 21.95 6 24.6 30.275000000000002 24.224999999999998 20.9 7 19.925 22.6 39.324999999999996 18.15 8 24.975 20.200000000000003 29.4 25.424999999999997 9 22.2 20.5 32.225 25.074999999999996 10 25.674999999999997 32.550000000000004 22.75 19.025 11 27.0 24.15 22.05 26.8 12 24.5 21.6 27.05 26.85 13 26.875 24.175 24.349999999999998 24.6 14 26.6 24.075 24.525 24.8 15 23.775 24.224999999999998 25.474999999999998 26.525 16 29.425 23.400000000000002 23.45 23.724999999999998 17 23.5 25.0 26.35 25.15 18 24.15 24.325 25.424999999999997 26.1 19 28.525 23.849999999999998 22.325 25.3 20 24.075 24.55 25.124999999999996 26.25 21 23.225 26.1 25.674999999999997 25.0 22 26.450000000000003 25.1 22.225 26.224999999999998 23 23.599999999999998 23.875 26.85 25.674999999999997 24 24.224999999999998 24.099999999999998 26.150000000000002 25.525 25 29.549999999999997 22.95 22.175 25.324999999999996 26 23.225 24.375 24.725 27.675 27 28.4 23.974999999999998 23.45 24.175 28 24.8 24.825 25.1 25.275 29 24.125 23.525 26.35 26.0 30 24.025 24.55 24.95 26.474999999999998 31 29.849999999999998 22.8 22.875 24.474999999999998 32 27.6 24.4 23.5 24.5 33 27.0 23.5 24.2 25.3 34 26.474999999999998 25.25 23.35 24.925 35 24.45 24.4 25.1 26.05 36 27.725 22.95 27.700000000000003 21.625 37 29.125 22.8 23.325000000000003 24.75 38 27.55 23.35 27.1 22.0 39 29.325000000000003 21.975 24.575 24.125 40 26.200000000000003 23.775 24.85 25.174999999999997 41 24.45 23.474999999999998 26.35 25.724999999999998 42 25.1 24.099999999999998 24.325 26.474999999999998 43 29.925 22.15 26.575 21.349999999999998 44 30.675 22.925 24.45 21.95 45 25.974999999999998 24.675 27.3 22.05 46 30.675 22.85 22.375 24.099999999999998 47 28.675 25.025 25.15 21.15 48 24.625 22.95 25.75 26.674999999999997 49 25.1 24.474999999999998 23.825 26.6 50 24.425 23.974999999999998 26.25 25.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.0 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 2.0 22 2.0 23 2.5 24 3.0 25 5.5 26 8.0 27 8.0 28 8.0 29 16.5 30 25.0 31 26.5 32 28.0 33 43.0 34 58.0 35 69.5 36 81.0 37 104.5 38 128.0 39 157.0 40 186.0 41 207.5 42 229.0 43 257.5 44 286.0 45 310.0 46 334.0 47 325.0 48 316.0 49 307.0 50 298.0 51 313.0 52 328.0 53 295.5 54 263.0 55 250.0 56 237.0 57 222.0 58 207.0 59 203.5 60 200.0 61 190.5 62 181.0 63 166.5 64 152.0 65 132.0 66 112.0 67 108.5 68 105.0 69 85.5 70 66.0 71 55.0 72 44.0 73 35.0 74 26.0 75 29.0 76 32.0 77 30.0 78 28.0 79 21.0 80 14.0 81 10.5 82 7.0 83 4.0 84 1.0 85 1.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39607448414695 98.75 2 0.5535983895319577 1.0999999999999999 3 0.050327126321087066 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 3134134 READS because READLEN < 1 Read 3134134 spots for SRR6322339.sra Written 3134134 spots for SRR6322339.sra Rejected 3134134 READS because READLEN < 1 Read 3134134 spots for SRR6322339.sra Written 3134134 spots for SRR6322339.sra Rejected 3134134 READS because READLEN < 1 Read 3134134 spots for SRR6322339.sra Written 3134134 spots for SRR6322339.sra Rejected 3134134 READS because READLEN < 1 Read 3134134 spots for SRR6322339.sra Written 3134134 spots for SRR6322339.sra Rejected 3134134 READS because READLEN < 1 Read 3134134 spots for SRR6322339.sra Written 3134134 spots for SRR6322339.sra Rejected 3134134 READS because READLEN < 1 Read 3134134 spots for SRR6322339.sra Written 3134134 spots for SRR6322339.sra Rejected 3134134 READS because READLEN < 1 Read 3134134 spots for SRR6322339.sra Written 3134134 spots for SRR6322339.sra Rejected 3134134 READS because READLEN < 1 Read 3134134 spots for SRR6322339.sra Written 3134134 spots for SRR6322339.sra Rejected 3134136 READS because READLEN < 1 Read 3134136 spots for SRR6322339.sra Written 3134136 spots for SRR6322339.sra Rejected 3134134 READS because READLEN < 1 Read 3134134 spots for SRR6322339.sra Written 3134134 spots for SRR6322339.sra Rejected 3134134 READS because READLEN < 1 Read 3134134 spots for SRR6322339.sra Written 3134134 spots for SRR6322339.sra Rejected 3134134 READS because READLEN < 1 Read 3134134 spots for SRR6322339.sra Written 3134134 spots for SRR6322339.sra Rejected 3134134 READS because READLEN < 1 Read 3134134 spots for SRR6322339.sra Written 3134134 spots for SRR6322339.sra Rejected 3134134 READS because READLEN < 1 Read 3134134 spots for SRR6322339.sra Written 3134134 spots for SRR6322339.sra Rejected 3134134 READS because READLEN < 1 Read 3134134 spots for SRR6322339.sra Written 3134134 spots for SRR6322339.sra Rejected 3134134 READS because READLEN < 1 Read 3134134 spots for SRR6322339.sra Written 3134134 spots for SRR6322339.sra Rejected 3134134 READS because READLEN < 1 Read 3134134 spots for SRR6322339.sra Written 3134134 spots for SRR6322339.sra Rejected 3134134 READS because READLEN < 1 Read 3134134 spots for SRR6322339.sra Written 3134134 spots for SRR6322339.sra Rejected 3134134 READS because READLEN < 1 Read 3134134 spots for SRR6322339.sra Written 3134134 spots for SRR6322339.sra Rejected 3134134 READS because READLEN < 1 Read 3134134 spots for SRR6322339.sra Written 3134134 spots for SRR6322339.sra SRR ids: ['SRR6322339.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mw7gz4m9 SRR6322339.sra spots: 62682682 blocks: [[1, 3134134], [3134135, 6268268], [6268269, 9402402], [9402403, 12536536], [12536537, 15670670], [15670671, 18804804], [18804805, 21938938], [21938939, 25073072], [25073073, 28207206], [28207207, 31341340], [31341341, 34475474], [34475475, 37609608], [37609609, 40743742], [40743743, 43877876], [43877877, 47012010], [47012011, 50146144], [50146145, 53280278], [53280279, 56414412], [56414413, 59548546], [59548547, 62682682]] SRR6322339 file size 8793051 SRR6322339 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322339 SRR6322339_1.fastq Input file: SRR6322339_1.fastq trimmed: SRR6322339-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:36:10 2024 >> started Sat Dec 7 11:36:42 2024 >> done (32.350s) 62682682 reads processed; of these: 563 ( 0.00%) short reads filtered out after trimming by size control 90860 ( 0.14%) empty reads filtered out after trimming by size control 62591259 (99.85%) reads available; of these: 4279 ( 0.01%) trimmed reads available after processing 62586980 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 22 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 4257 0.01% 50 62586980 99.99% 62591259 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=21 prefix-density=0.09 prefix-fanout=1.9 sequence=ATGCCCTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCGATGGTGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=17 fanout-score=50.55 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=10.2 sequence=GCGGCGGCGGCGCCCATCTCGCCGAGGTGCTCCTTGTGCTTGTGGTGCTTCTCCTCCTTGGTGATGCGCTCGTACTCGCCGTCGGCGCCGGTTGGGGTTACCACCGTCTCCGCCGAGTACCCGTACTCGTCGACGGCGCCCGTGGTGGGGTTGACGACCACGTCGGTGTCTTCCTTCTTGTGGTGGAACAGGTGGTGCTTCTTTTCCTCCGCCATGGCCGCCGGTTGATCAAAAGCTCGAGGAG Started job on | Dec 07 11:36:53 Started mapping on | Dec 07 11:36:53 Finished on | Dec 07 11:37:47 Mapping speed, Million of reads per hour | 4172.75 Number of input reads | 62591259 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 60876967 Uniquely mapped reads % | 97.26% Average mapped length | 49.84 Number of splices: Total | 8599621 Number of splices: Annotated (sjdb) | 8332546 Number of splices: GT/AG | 8484818 Number of splices: GC/AG | 101041 Number of splices: AT/AC | 4639 Number of splices: Non-canonical | 9123 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.00% Deletion average length | 1.74 Insertion rate per base | 0.00% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1187047 % of reads mapped to multiple loci | 1.90% Number of reads mapped to too many loci | 143830 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.60% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 527245 527245 527245 N_multimapping 1187047 1187047 1187047 N_noFeature 2285483 59551250 2709793 N_ambiguous 955902 3597 58290 UnstrandedReadsAssigned:57635582 PositiveStrandReadsAssigned:1322120 NegativeStrandReadsAssigned:58108884 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322339 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322339-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 62,591,259 reads, 57,348,635 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,356 rounds 52973 SRR6322339.ke.tsv 35125 SRR6322339.se.tsv 88098 total ==> SRR6322339.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 67.3691 2.61586 PNS24247 1044 945 139.472 4.7966 PNS24249 1928 1829 111.904 1.98843 PNS24246 1044 945 139.472 4.7966 PNS24248 1044 945 139.472 4.7966 PNS24244 1471 1372 242.312 5.73983 PNS24243 293 194 0 0 KQK14069 1603 1504 4.25016 0.0918411 KQK14071 474 375 9.64467 0.835863 ==> SRR6322339.se.tsv <== BRADI_1g14170v3 25 BRADI_1g53295v3 195 BRADI_1g59795v3 805 BRADI_1g07683v3 0 BRADI_1g00485v3 173 BRADI_1g20270v3 1362 BRADI_1g74790v3 653 BRADI_1g09890v3 63 BRADI_1g77505v3 528 BRADI_1g48960v3 2 SRR6322339 completed mapping pipeline successfully