Starting /dee2/code/volunteer_pipeline.sh SRR6322340 current disk space = 1544185180160 free memory = 1604294796 SRR6322340 SRAfilesize ae4a462565a8efdcd8646fdd40db2823 SRR6322340.sra SRR6322340.sra file validated SRR6322340 is single end SRR6322340 is conventional basespace SRR6322340 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322340_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.67375 32.0 32.0 32.0 32.0 32.0 2 25.99375 32.0 12.0 32.0 12.0 32.0 3 33.5475 32.0 32.0 37.0 32.0 37.0 4 35.45125 37.0 37.0 37.0 32.0 37.0 5 36.61375 37.0 37.0 37.0 37.0 37.0 6 40.02975 41.0 41.0 41.0 37.0 41.0 7 32.182 37.0 27.0 41.0 12.0 41.0 8 38.83525 41.0 37.0 41.0 32.0 41.0 9 38.96825 41.0 41.0 41.0 32.0 41.0 10 40.18475 41.0 41.0 41.0 37.0 41.0 11 40.32975 41.0 41.0 41.0 41.0 41.0 12 40.16725 41.0 41.0 41.0 37.0 41.0 13 38.99175 41.0 41.0 41.0 32.0 41.0 14 38.02075 41.0 37.0 41.0 32.0 41.0 15 39.47125 41.0 41.0 41.0 37.0 41.0 16 36.3905 41.0 37.0 41.0 27.0 41.0 17 39.61475 41.0 41.0 41.0 37.0 41.0 18 40.32575 41.0 41.0 41.0 37.0 41.0 19 40.22775 41.0 41.0 41.0 37.0 41.0 20 36.63525 41.0 37.0 41.0 27.0 41.0 21 39.9285 41.0 41.0 41.0 37.0 41.0 22 40.06225 41.0 41.0 41.0 37.0 41.0 23 38.4345 41.0 37.0 41.0 32.0 41.0 24 40.072 41.0 41.0 41.0 37.0 41.0 25 34.4055 41.0 32.0 41.0 12.0 41.0 26 37.60125 41.0 37.0 41.0 27.0 41.0 27 35.13 41.0 32.0 41.0 12.0 41.0 28 30.6335 37.0 22.0 41.0 12.0 41.0 29 38.16275 41.0 37.0 41.0 32.0 41.0 30 33.43325 37.0 27.0 41.0 12.0 41.0 31 39.07375 41.0 41.0 41.0 37.0 41.0 32 28.154 32.0 12.0 41.0 12.0 41.0 33 33.21625 37.0 27.0 41.0 12.0 41.0 34 31.448 37.0 22.0 41.0 12.0 41.0 35 36.34925 41.0 37.0 41.0 27.0 41.0 36 25.045 27.0 12.0 37.0 12.0 41.0 37 37.71175 41.0 37.0 41.0 32.0 41.0 38 38.94675 41.0 41.0 41.0 37.0 41.0 39 33.37425 41.0 27.0 41.0 12.0 41.0 40 38.50675 41.0 37.0 41.0 32.0 41.0 41 27.24925 27.0 12.0 41.0 12.0 41.0 42 37.79875 41.0 37.0 41.0 32.0 41.0 43 39.669 41.0 41.0 41.0 37.0 41.0 44 38.8665 41.0 41.0 41.0 37.0 41.0 45 34.439 41.0 32.0 41.0 12.0 41.0 46 38.76375 41.0 37.0 41.0 32.0 41.0 47 39.56275 41.0 41.0 41.0 37.0 41.0 48 39.38525 41.0 41.0 41.0 37.0 41.0 49 39.65025 41.0 41.0 41.0 37.0 41.0 50 38.6955 41.0 41.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 3.0 25 5.0 26 14.0 27 26.0 28 36.0 29 56.0 30 64.0 31 92.0 32 136.0 33 198.0 34 290.0 35 354.0 36 569.0 37 705.0 38 821.0 39 553.0 40 77.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.3 7.875 8.75 42.075 2 27.80990696504903 8.674880563238622 33.291425697762136 30.223786773950213 3 25.025 11.899999999999999 23.0 40.075 4 28.599999999999998 18.025 20.599999999999998 32.775 5 30.875000000000004 23.05 24.425 21.65 6 25.874999999999996 28.625 24.075 21.425 7 23.474999999999998 21.925 39.050000000000004 15.55 8 20.7 24.675 31.75 22.875 9 21.099999999999998 22.0 34.55 22.35 10 21.775 34.35 26.224999999999998 17.65 11 25.074999999999996 25.7 24.725 24.5 12 22.725 22.8 29.5 24.975 13 22.375 26.674999999999997 28.15 22.8 14 23.25 24.3 28.449999999999996 24.0 15 23.575 25.224999999999998 26.75 24.45 16 25.624999999999996 25.35 24.55 24.474999999999998 17 25.2 24.375 25.7 24.725 18 22.45 24.675 26.200000000000003 26.674999999999997 19 23.65 24.95 26.275 25.124999999999996 20 25.224999999999998 24.95 26.650000000000002 23.175 21 24.175 25.575 25.15 25.1 22 23.125 26.025 25.124999999999996 25.724999999999998 23 23.275000000000002 25.75 26.575 24.4 24 23.974999999999998 24.425 24.224999999999998 27.375 25 27.425 23.25 24.175 25.15 26 24.775 25.900000000000002 23.9 25.424999999999997 27 23.325000000000003 24.55 27.0 25.124999999999996 28 29.975 23.549999999999997 22.15 24.325 29 23.400000000000002 25.1 25.324999999999996 26.174999999999997 30 22.925 24.8 26.875 25.4 31 22.7 25.3 26.200000000000003 25.8 32 29.725 24.3 24.6 21.375 33 24.375 24.975 25.474999999999998 25.174999999999997 34 25.0 25.8 24.075 25.124999999999996 35 24.325 24.75 27.175 23.75 36 30.5 24.375 22.525000000000002 22.6 37 21.75 25.8 26.674999999999997 25.775 38 24.775 24.725 25.525 24.975 39 25.674999999999997 25.374999999999996 24.5 24.45 40 24.525 26.525 25.624999999999996 23.325000000000003 41 29.925 23.575 26.174999999999997 20.325 42 23.7 24.75 25.05 26.5 43 21.75543885971493 26.63165791447862 25.531382845711427 26.081520380095025 44 23.225 24.2 26.474999999999998 26.1 45 26.38159539884971 23.13078269567392 25.63140785196299 24.85621405351338 46 24.025 25.074999999999996 25.650000000000002 25.25 47 24.7 25.25 25.324999999999996 24.725 48 22.775000000000002 24.625 26.55 26.05 49 22.925 26.075 25.6 25.4 50 22.836418209104554 25.137568784392194 26.28814407203602 25.737868934467233 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 1.5 6 2.0 7 1.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 3.0 24 6.0 25 7.5 26 9.0 27 14.0 28 19.0 29 21.0 30 23.0 31 34.0 32 45.0 33 61.0 34 77.0 35 86.0 36 95.0 37 128.0 38 161.0 39 189.5 40 218.0 41 241.5 42 265.0 43 293.0 44 321.0 45 322.5 46 324.0 47 344.5 48 365.0 49 362.0 50 359.0 51 333.0 52 307.0 53 283.5 54 260.0 55 236.5 56 213.0 57 203.0 58 193.0 59 186.5 60 180.0 61 161.0 62 142.0 63 127.5 64 113.0 65 106.0 66 99.0 67 79.5 68 60.0 69 52.5 70 45.0 71 45.0 72 45.0 73 32.5 74 20.0 75 16.5 76 13.0 77 12.5 78 12.0 79 7.5 80 3.0 81 3.0 82 3.0 83 1.5 84 0.0 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.025 44 0.0 45 0.025 46 0.0 47 0.0 48 0.0 49 0.0 50 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.34262125902993 94.325 2 2.5283797729618165 4.9 3 0.10319917440660474 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025799793601651185 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTAT 19 0.475 TruSeq Adapter, Index 15 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1209576 READS because READLEN < 1 Read 1209576 spots for SRR6322340.sra Written 1209576 spots for SRR6322340.sra Rejected 1209576 READS because READLEN < 1 Read 1209576 spots for SRR6322340.sra Written 1209576 spots for SRR6322340.sra Rejected 1209576 READS because READLEN < 1 Read 1209576 spots for SRR6322340.sra Written 1209576 spots for SRR6322340.sra Rejected 1209576 READS because READLEN < 1 Read 1209576 spots for SRR6322340.sra Written 1209576 spots for SRR6322340.sra Rejected 1209576 READS because READLEN < 1 Read 1209576 spots for SRR6322340.sra Written 1209576 spots for SRR6322340.sra Rejected 1209576 READS because READLEN < 1 Read 1209576 spots for SRR6322340.sra Written 1209576 spots for SRR6322340.sra Rejected 1209576 READS because READLEN < 1 Read 1209576 spots for SRR6322340.sra Written 1209576 spots for SRR6322340.sra Rejected 1209576 READS because READLEN < 1 Read 1209576 spots for SRR6322340.sra Written 1209576 spots for SRR6322340.sra Rejected 1209576 READS because READLEN < 1 Read 1209576 spots for SRR6322340.sra Written 1209576 spots for SRR6322340.sra Rejected 1209576 READS because READLEN < 1 Read 1209576 spots for SRR6322340.sra Written 1209576 spots for SRR6322340.sra Rejected 1209576 READS because READLEN < 1 Read 1209576 spots for SRR6322340.sra Written 1209576 spots for SRR6322340.sra Rejected 1209576 READS because READLEN < 1 Read 1209576 spots for SRR6322340.sra Written 1209576 spots for SRR6322340.sra Rejected 1209576 READS because READLEN < 1 Read 1209576 spots for SRR6322340.sra Written 1209576 spots for SRR6322340.sra Rejected 1209576 READS because READLEN < 1 Read 1209576 spots for SRR6322340.sra Written 1209576 spots for SRR6322340.sra Rejected 1209584 READS because READLEN < 1 Read 1209584 spots for SRR6322340.sra Written 1209584 spots for SRR6322340.sra Rejected 1209576 READS because READLEN < 1 Read 1209576 spots for SRR6322340.sra Written 1209576 spots for SRR6322340.sra Rejected 1209576 READS because READLEN < 1 Read 1209576 spots for SRR6322340.sra Written 1209576 spots for SRR6322340.sra Rejected 1209576 READS because READLEN < 1 Read 1209576 spots for SRR6322340.sra Written 1209576 spots for SRR6322340.sra Rejected 1209576 READS because READLEN < 1 Read 1209576 spots for SRR6322340.sra Written 1209576 spots for SRR6322340.sra Rejected 1209576 READS because READLEN < 1 Read 1209576 spots for SRR6322340.sra Written 1209576 spots for SRR6322340.sra SRR ids: ['SRR6322340.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_efww0a8_ SRR6322340.sra spots: 24191528 blocks: [[1, 1209576], [1209577, 2419152], [2419153, 3628728], [3628729, 4838304], [4838305, 6047880], [6047881, 7257456], [7257457, 8467032], [8467033, 9676608], [9676609, 10886184], [10886185, 12095760], [12095761, 13305336], [13305337, 14514912], [14514913, 15724488], [15724489, 16934064], [16934065, 18143640], [18143641, 19353216], [19353217, 20562792], [20562793, 21772368], [21772369, 22981944], [22981945, 24191528]] SRR6322340 file size 3380233 SRR6322340 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322340 SRR6322340_1.fastq Input file: SRR6322340_1.fastq trimmed: SRR6322340-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:30:28 2024 >> started Sat Dec 7 09:30:40 2024 >> done (12.772s) 24191528 reads processed; of these: 189 ( 0.00%) short reads filtered out after trimming by size control 209111 ( 0.86%) empty reads filtered out after trimming by size control 23982228 (99.13%) reads available; of these: 55 ( 0.00%) trimmed reads available after processing 23982173 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 44 0.00% 50 23982173 100.00% 23982228 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=21 prefix-density=0.12 prefix-fanout=2.0 sequence=TTAGGCATGGGCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=22 fanout-score=29.04 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=5.4 sequence=ATCTCCTTGCCAATGGTATAGTGACCGCGGGCAAAGTTGTTGGCTGCATCCTCCTTGCCACTGATGAGCTGCTCAGGGTGGAAGAGCTGGCGGTAAGTGCCAGTCCGCACCTCATCAATCACAGTGGGTTCCAGATCCACAAAGACAGCACG Started job on | Dec 07 09:31:10 Started mapping on | Dec 07 09:31:10 Finished on | Dec 07 09:31:28 Mapping speed, Million of reads per hour | 4796.45 Number of input reads | 23982228 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 23240577 Uniquely mapped reads % | 96.91% Average mapped length | 49.85 Number of splices: Total | 3301042 Number of splices: Annotated (sjdb) | 3206663 Number of splices: GT/AG | 3257324 Number of splices: GC/AG | 38964 Number of splices: AT/AC | 1762 Number of splices: Non-canonical | 2992 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.00% Deletion average length | 1.76 Insertion rate per base | 0.00% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 465418 % of reads mapped to multiple loci | 1.94% Number of reads mapped to too many loci | 86783 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.78% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 276233 276233 276233 N_multimapping 465418 465418 465418 N_noFeature 1022506 22697583 1195170 N_ambiguous 391759 1401 22592 UnstrandedReadsAssigned:21826312 PositiveStrandReadsAssigned:541593 NegativeStrandReadsAssigned:22022815 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322340 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322340-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,982,228 reads, 21,463,568 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,262 rounds 52973 SRR6322340.ke.tsv 35125 SRR6322340.se.tsv 88098 total ==> SRR6322340.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 31.8446 3.4556 PNS24247 1044 945 81.9167 7.87324 PNS24249 1928 1829 18.7802 0.93261 PNS24246 1044 945 81.9167 7.87324 PNS24248 1044 945 81.9167 7.87324 PNS24244 1471 1372 91.6249 6.06558 PNS24243 293 194 0 0 KQK14069 1603 1504 5.0339 0.303997 KQK14071 474 375 0.846118 0.204933 ==> SRR6322340.se.tsv <== BRADI_1g14170v3 15 BRADI_1g53295v3 73 BRADI_1g59795v3 323 BRADI_1g07683v3 0 BRADI_1g00485v3 121 BRADI_1g20270v3 417 BRADI_1g74790v3 275 BRADI_1g09890v3 8 BRADI_1g77505v3 198 BRADI_1g48960v3 0 SRR6322340 completed mapping pipeline successfully