Starting /dee2/code/volunteer_pipeline.sh SRR6322341 current disk space = 1544190177280 free memory = 1597266472 SRR6322341 SRAfilesize baf183e788f69bf03c357cb5597953ff SRR6322341.sra SRR6322341.sra file validated SRR6322341 is single end SRR6322341 is conventional basespace SRR6322341 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322341_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.87875 32.0 32.0 32.0 32.0 32.0 2 31.44125 32.0 32.0 32.0 32.0 32.0 3 35.6925 37.0 37.0 37.0 32.0 37.0 4 36.29 37.0 37.0 37.0 37.0 37.0 5 36.6925 37.0 37.0 37.0 37.0 37.0 6 40.359 41.0 41.0 41.0 41.0 41.0 7 40.203 41.0 41.0 41.0 37.0 41.0 8 33.85 37.0 32.0 41.0 12.0 41.0 9 37.12675 41.0 37.0 41.0 32.0 41.0 10 34.59425 37.0 32.0 41.0 22.0 41.0 11 39.88 41.0 41.0 41.0 37.0 41.0 12 38.599 41.0 37.0 41.0 32.0 41.0 13 35.97125 41.0 32.0 41.0 22.0 41.0 14 35.469 41.0 32.0 41.0 22.0 41.0 15 39.36 41.0 41.0 41.0 37.0 41.0 16 35.4845 41.0 32.0 41.0 22.0 41.0 17 39.94 41.0 41.0 41.0 37.0 41.0 18 40.3655 41.0 41.0 41.0 41.0 41.0 19 36.5165 41.0 37.0 41.0 27.0 41.0 20 39.1265 41.0 41.0 41.0 37.0 41.0 21 39.04175 41.0 41.0 41.0 37.0 41.0 22 36.65325 41.0 37.0 41.0 27.0 41.0 23 39.3495 41.0 41.0 41.0 37.0 41.0 24 40.37 41.0 41.0 41.0 41.0 41.0 25 34.78975 41.0 32.0 41.0 22.0 41.0 26 39.05475 41.0 41.0 41.0 37.0 41.0 27 30.40775 37.0 22.0 41.0 12.0 41.0 28 36.30625 41.0 37.0 41.0 22.0 41.0 29 38.88575 41.0 37.0 41.0 37.0 41.0 30 39.69875 41.0 41.0 41.0 37.0 41.0 31 33.73025 41.0 27.0 41.0 12.0 41.0 32 31.206 37.0 22.0 41.0 12.0 41.0 33 30.682 37.0 22.0 41.0 12.0 41.0 34 33.049 37.0 27.0 41.0 12.0 41.0 35 37.61825 41.0 37.0 41.0 27.0 41.0 36 26.66025 27.0 12.0 37.0 12.0 41.0 37 29.5935 32.0 22.0 41.0 12.0 41.0 38 23.4225 22.0 12.0 37.0 12.0 41.0 39 23.83925 22.0 12.0 37.0 12.0 37.0 40 32.443 37.0 27.0 41.0 22.0 41.0 41 38.17825 41.0 37.0 41.0 32.0 41.0 42 33.52875 37.0 27.0 41.0 12.0 41.0 43 25.0385 27.0 12.0 37.0 12.0 41.0 44 25.023 27.0 12.0 37.0 12.0 41.0 45 21.9565 22.0 12.0 32.0 12.0 37.0 46 28.2765 27.0 22.0 37.0 12.0 41.0 47 24.212 22.0 12.0 37.0 12.0 41.0 48 35.8425 37.0 32.0 41.0 27.0 41.0 49 38.27675 41.0 37.0 41.0 32.0 41.0 50 39.75275 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 6.0 24 11.0 25 22.0 26 39.0 27 46.0 28 81.0 29 118.0 30 155.0 31 207.0 32 341.0 33 422.0 34 549.0 35 659.0 36 584.0 37 434.0 38 246.0 39 67.0 40 12.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.0 8.15 8.275 42.575 2 24.92469879518072 10.742971887550201 34.36244979919679 29.96987951807229 3 23.5 15.75 21.3 39.45 4 29.025000000000002 20.8 19.625 30.55 5 28.475 25.55 22.400000000000002 23.575 6 24.975 30.875000000000004 23.5 20.65 7 17.575 24.0 39.800000000000004 18.625 8 25.124999999999996 23.0 27.1 24.775 9 20.65 21.3 33.375 24.675 10 23.025000000000002 35.375 23.125 18.475 11 26.8 24.349999999999998 23.575 25.275 12 24.85 22.675 26.3 26.174999999999997 13 27.150000000000002 24.725 24.55 23.575 14 25.3 24.625 25.35 24.725 15 23.674999999999997 25.275 25.424999999999997 25.624999999999996 16 26.200000000000003 25.7 23.525 24.575 17 24.2 24.6 24.9 26.3 18 22.825 24.4 26.8 25.974999999999998 19 28.675 24.349999999999998 21.65 25.324999999999996 20 22.775000000000002 26.375 26.950000000000003 23.9 21 23.575 24.675 25.424999999999997 26.325 22 25.8 26.224999999999998 23.724999999999998 24.25 23 24.65 25.474999999999998 24.9 24.975 24 23.125 24.349999999999998 24.65 27.875 25 28.075 25.6 22.650000000000002 23.674999999999997 26 22.45 26.375 25.5 25.674999999999997 27 28.349999999999998 23.150000000000002 23.7 24.8 28 25.55 25.35 24.775 24.325 29 24.325 24.5 26.325 24.85 30 23.375 23.875 26.075 26.674999999999997 31 26.6 23.7 24.15 25.55 32 26.625 24.6 24.6 24.175 33 26.55 24.275 23.549999999999997 25.624999999999996 34 26.575 23.575 23.9 25.95 35 22.7 25.95 26.05 25.3 36 26.375 22.75 27.575 23.3 37 28.575 23.525 23.525 24.375 38 27.650000000000002 24.95 25.650000000000002 21.75 39 27.975 24.4 24.325 23.3 40 25.35 25.724999999999998 24.325 24.6 41 23.849999999999998 25.224999999999998 24.625 26.3 42 26.474999999999998 23.425 24.575 25.525 43 28.449999999999996 23.925 24.65 22.975 44 27.875 23.875 25.8 22.45 45 27.35 23.075000000000003 26.924999999999997 22.650000000000002 46 27.500000000000004 23.9 22.925 25.674999999999997 47 27.925 25.0 24.95 22.125 48 23.275000000000002 25.424999999999997 25.124999999999996 26.174999999999997 49 23.474999999999998 25.95 24.875 25.7 50 23.35 24.675 26.35 25.624999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 1.0 20 2.0 21 3.5 22 5.0 23 3.5 24 2.0 25 3.5 26 5.0 27 7.5 28 10.0 29 12.5 30 15.0 31 29.5 32 44.0 33 54.0 34 64.0 35 78.5 36 93.0 37 120.5 38 148.0 39 168.0 40 188.0 41 209.5 42 231.0 43 261.5 44 292.0 45 313.5 46 335.0 47 323.5 48 312.0 49 335.5 50 359.0 51 337.0 52 315.0 53 303.5 54 292.0 55 275.0 56 258.0 57 230.0 58 202.0 59 200.5 60 199.0 61 183.0 62 167.0 63 137.0 64 107.0 65 102.0 66 97.0 67 90.5 68 84.0 69 70.5 70 57.0 71 55.5 72 54.0 73 42.0 74 30.0 75 24.0 76 18.0 77 11.5 78 5.0 79 4.0 80 3.0 81 2.5 82 2.0 83 2.5 84 3.0 85 1.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1388608 READS because READLEN < 1 Read 1388608 spots for SRR6322341.sra Written 1388608 spots for SRR6322341.sra Rejected 1388608 READS because READLEN < 1 Read 1388608 spots for SRR6322341.sra Written 1388608 spots for SRR6322341.sra Rejected 1388608 READS because READLEN < 1 Read 1388608 spots for SRR6322341.sra Written 1388608 spots for SRR6322341.sra Rejected 1388608 READS because READLEN < 1 Read 1388608 spots for SRR6322341.sra Written 1388608 spots for SRR6322341.sra Rejected 1388608 READS because READLEN < 1 Read 1388608 spots for SRR6322341.sra Written 1388608 spots for SRR6322341.sra Rejected 1388608 READS because READLEN < 1 Read 1388608 spots for SRR6322341.sra Written 1388608 spots for SRR6322341.sra Rejected 1388608 READS because READLEN < 1 Read 1388608 spots for SRR6322341.sra Written 1388608 spots for SRR6322341.sra Rejected 1388608 READS because READLEN < 1 Read 1388608 spots for SRR6322341.sra Written 1388608 spots for SRR6322341.sra Rejected 1388608 READS because READLEN < 1 Read 1388608 spots for SRR6322341.sra Written 1388608 spots for SRR6322341.sra Rejected 1388608 READS because READLEN < 1 Read 1388608 spots for SRR6322341.sra Written 1388608 spots for SRR6322341.sra Rejected 1388608 READS because READLEN < 1 Read 1388608 spots for SRR6322341.sra Written 1388608 spots for SRR6322341.sra Rejected 1388608 READS because READLEN < 1 Read 1388608 spots for SRR6322341.sra Written 1388608 spots for SRR6322341.sra Rejected 1388608 READS because READLEN < 1 Read 1388608 spots for SRR6322341.sra Written 1388608 spots for SRR6322341.sra Rejected 1388608 READS because READLEN < 1 Read 1388608 spots for SRR6322341.sra Written 1388608 spots for SRR6322341.sra Rejected 1388608 READS because READLEN < 1 Read 1388608 spots for SRR6322341.sra Written 1388608 spots for SRR6322341.sra Rejected 1388608 READS because READLEN < 1 Read 1388608 spots for SRR6322341.sra Written 1388608 spots for SRR6322341.sra Rejected 1388626 READS because READLEN < 1 Read 1388626 spots for SRR6322341.sra Written 1388626 spots for SRR6322341.sra Rejected 1388608 READS because READLEN < 1 Read 1388608 spots for SRR6322341.sra Written 1388608 spots for SRR6322341.sra Rejected 1388608 READS because READLEN < 1 Read 1388608 spots for SRR6322341.sra Written 1388608 spots for SRR6322341.sra Rejected 1388608 READS because READLEN < 1 Read 1388608 spots for SRR6322341.sra Written 1388608 spots for SRR6322341.sra SRR ids: ['SRR6322341.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k348jrx7 SRR6322341.sra spots: 27772178 blocks: [[1, 1388608], [1388609, 2777216], [2777217, 4165824], [4165825, 5554432], [5554433, 6943040], [6943041, 8331648], [8331649, 9720256], [9720257, 11108864], [11108865, 12497472], [12497473, 13886080], [13886081, 15274688], [15274689, 16663296], [16663297, 18051904], [18051905, 19440512], [19440513, 20829120], [20829121, 22217728], [22217729, 23606336], [23606337, 24994944], [24994945, 26383552], [26383553, 27772178]] SRR6322341 file size 3883762 SRR6322341 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322341 SRR6322341_1.fastq Input file: SRR6322341_1.fastq trimmed: SRR6322341-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:30:16 2024 >> started Sat Dec 7 09:30:28 2024 >> done (12.141s) 27772178 reads processed; of these: 335 ( 0.00%) short reads filtered out after trimming by size control 82615 ( 0.30%) empty reads filtered out after trimming by size control 27689228 (99.70%) reads available; of these: 1876 ( 0.01%) trimmed reads available after processing 27687352 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 1868 0.01% 50 27687352 99.99% 27689228 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=19 prefix-density=0.08 prefix-fanout=2.2 sequence=TTAGGCATGGGCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=19 fanout-score=30.53 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=5.8 sequence=ATCTCCTTGCCAATGGTATAGTGACCGCGGGCAAAGTTGTTGGCTGCATCCTCCTTGCCACTGATGAGCTGCTCAGGGTGGAAGAGCTGGCGGTAAGTGCCAGTCCGCACCTCATCAATCACAGTGGGTTCCAGATCCACAAAGACAGCACGGG Started job on | Dec 07 09:30:41 Started mapping on | Dec 07 09:30:41 Finished on | Dec 07 09:31:06 Mapping speed, Million of reads per hour | 3987.25 Number of input reads | 27689228 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 26180360 Uniquely mapped reads % | 94.55% Average mapped length | 49.83 Number of splices: Total | 3652047 Number of splices: Annotated (sjdb) | 3532837 Number of splices: GT/AG | 3603253 Number of splices: GC/AG | 42697 Number of splices: AT/AC | 2011 Number of splices: Non-canonical | 4086 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.00% Deletion average length | 1.74 Insertion rate per base | 0.00% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 608716 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 719954 % of reads mapped to too many loci | 2.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.59% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 900152 900152 900152 N_multimapping 608716 608716 608716 N_noFeature 1115339 25587641 1302524 N_ambiguous 429958 1606 25952 UnstrandedReadsAssigned:24635063 PositiveStrandReadsAssigned:591113 NegativeStrandReadsAssigned:24851884 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322341 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322341-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,689,228 reads, 24,507,401 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,233 rounds 52973 SRR6322341.ke.tsv 35125 SRR6322341.se.tsv 88098 total ==> SRR6322341.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 214.885 19.7669 PNS24247 1044 945 23.202 1.89039 PNS24249 1928 1829 3.69363 0.155489 PNS24246 1044 945 23.202 1.89039 PNS24248 1044 945 23.202 1.89039 PNS24244 1471 1372 107.815 6.05041 PNS24243 293 194 0 0 KQK14069 1603 1504 6.00253 0.307288 KQK14071 474 375 0 0 ==> SRR6322341.se.tsv <== BRADI_1g14170v3 6 BRADI_1g53295v3 78 BRADI_1g59795v3 323 BRADI_1g07683v3 0 BRADI_1g00485v3 145 BRADI_1g20270v3 687 BRADI_1g74790v3 200 BRADI_1g09890v3 10 BRADI_1g77505v3 220 BRADI_1g48960v3 0 SRR6322341 completed mapping pipeline successfully