Starting /dee2/code/volunteer_pipeline.sh SRR6322342 current disk space = 1544172429312 free memory = 1597359212 SRR6322342 SRAfilesize ac3dbfc61c69cbff3915d8814310dc81 SRR6322342.sra SRR6322342.sra file validated SRR6322342 is single end SRR6322342 is conventional basespace SRR6322342 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322342_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.69 32.0 32.0 32.0 32.0 32.0 2 25.79875 32.0 12.0 32.0 12.0 32.0 3 33.665 32.0 32.0 37.0 32.0 37.0 4 35.4575 37.0 37.0 37.0 32.0 37.0 5 36.6175 37.0 37.0 37.0 37.0 37.0 6 40.0895 41.0 41.0 41.0 37.0 41.0 7 32.548 37.0 27.0 41.0 12.0 41.0 8 38.76975 41.0 37.0 41.0 32.0 41.0 9 38.85525 41.0 37.0 41.0 32.0 41.0 10 40.1765 41.0 41.0 41.0 37.0 41.0 11 40.337 41.0 41.0 41.0 41.0 41.0 12 40.12575 41.0 41.0 41.0 37.0 41.0 13 39.1315 41.0 41.0 41.0 37.0 41.0 14 38.237 41.0 37.0 41.0 32.0 41.0 15 39.57275 41.0 41.0 41.0 37.0 41.0 16 36.45775 41.0 37.0 41.0 27.0 41.0 17 39.73175 41.0 41.0 41.0 37.0 41.0 18 40.39 41.0 41.0 41.0 41.0 41.0 19 40.182 41.0 41.0 41.0 37.0 41.0 20 36.66925 41.0 37.0 41.0 27.0 41.0 21 39.903 41.0 41.0 41.0 37.0 41.0 22 40.104 41.0 41.0 41.0 37.0 41.0 23 38.43475 41.0 37.0 41.0 32.0 41.0 24 40.04925 41.0 41.0 41.0 37.0 41.0 25 34.2025 41.0 27.0 41.0 12.0 41.0 26 37.44375 41.0 37.0 41.0 27.0 41.0 27 35.3025 41.0 32.0 41.0 22.0 41.0 28 30.44575 37.0 22.0 41.0 12.0 41.0 29 38.389 41.0 37.0 41.0 32.0 41.0 30 33.77375 37.0 27.0 41.0 12.0 41.0 31 39.08475 41.0 41.0 41.0 37.0 41.0 32 28.184 32.0 12.0 41.0 12.0 41.0 33 33.67675 37.0 27.0 41.0 12.0 41.0 34 31.6855 37.0 27.0 41.0 12.0 41.0 35 36.29575 41.0 37.0 41.0 27.0 41.0 36 24.7215 22.0 12.0 37.0 12.0 41.0 37 37.8435 41.0 37.0 41.0 32.0 41.0 38 39.1025 41.0 41.0 41.0 37.0 41.0 39 33.94525 41.0 32.0 41.0 12.0 41.0 40 38.65025 41.0 37.0 41.0 32.0 41.0 41 27.48575 27.0 12.0 41.0 12.0 41.0 42 37.89725 41.0 37.0 41.0 32.0 41.0 43 39.79075 41.0 41.0 41.0 37.0 41.0 44 39.08975 41.0 41.0 41.0 37.0 41.0 45 34.66425 41.0 32.0 41.0 12.0 41.0 46 38.855 41.0 41.0 41.0 37.0 41.0 47 39.726 41.0 41.0 41.0 37.0 41.0 48 39.55975 41.0 41.0 41.0 37.0 41.0 49 39.68025 41.0 41.0 41.0 37.0 41.0 50 38.9075 41.0 41.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 2.0 23 2.0 24 2.0 25 1.0 26 12.0 27 19.0 28 28.0 29 62.0 30 66.0 31 109.0 32 145.0 33 175.0 34 226.0 35 369.0 36 535.0 37 725.0 38 873.0 39 577.0 40 71.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.65 8.325000000000001 8.375 42.65 2 27.40796772566818 8.472012102874432 35.67826525466465 28.44175491679274 3 25.45 13.0 22.0 39.550000000000004 4 29.2 19.05 19.3 32.45 5 28.375 25.174999999999997 23.200000000000003 23.25 6 24.975 28.825 23.125 23.075000000000003 7 22.975 22.6 38.35 16.075 8 21.8 22.425 31.0 24.775 9 21.525 20.9 32.85 24.725 10 20.525 34.5 26.75 18.224999999999998 11 27.275 24.6 24.125 24.0 12 24.025 21.875 27.250000000000004 26.85 13 23.75 24.95 25.8 25.5 14 23.125 26.025 26.150000000000002 24.7 15 23.400000000000002 25.174999999999997 26.1 25.324999999999996 16 24.5 26.6 22.475 26.424999999999997 17 24.6 24.0 26.1 25.3 18 24.025 24.0 25.275 26.700000000000003 19 23.125 25.25 24.925 26.700000000000003 20 25.1 25.374999999999996 24.5 25.025 21 24.075 23.7 25.674999999999997 26.55 22 24.3 24.275 25.074999999999996 26.35 23 23.825 25.650000000000002 25.575 24.95 24 24.2 25.324999999999996 23.375 27.1 25 28.849999999999998 24.725 21.775 24.65 26 24.224999999999998 24.775 26.150000000000002 24.85 27 24.05 24.45 26.825 24.675 28 29.65 22.125 23.325000000000003 24.9 29 23.724999999999998 24.875 25.85 25.55 30 25.074999999999996 23.0 25.4 26.525 31 24.925 23.825 24.9 26.35 32 29.975 24.575 23.549999999999997 21.9 33 26.1 23.5 25.275 25.124999999999996 34 25.2 25.4 23.95 25.45 35 23.25 24.875 26.35 25.525 36 30.475 24.474999999999998 24.025 21.025 37 23.825 25.5 24.925 25.75 38 23.825 24.85 26.474999999999998 24.85 39 26.424999999999997 22.75 24.575 26.25 40 24.325 24.575 24.474999999999998 26.625 41 30.85 23.175 24.075 21.9 42 22.925 24.275 27.025 25.775 43 23.724999999999998 25.874999999999996 25.900000000000002 24.5 44 22.575 26.05 25.874999999999996 25.5 45 26.05 23.65 25.324999999999996 24.975 46 24.075 24.725 24.474999999999998 26.724999999999998 47 25.1 26.25 24.45 24.2 48 24.575 23.35 25.85 26.224999999999998 49 23.65 24.85 24.875 26.625 50 24.15 25.025 25.650000000000002 25.174999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 0.0 23 3.0 24 6.0 25 6.5 26 7.0 27 7.5 28 8.0 29 13.5 30 19.0 31 29.0 32 39.0 33 55.0 34 71.0 35 86.0 36 101.0 37 118.0 38 135.0 39 172.5 40 210.0 41 218.5 42 227.0 43 255.0 44 283.0 45 305.5 46 328.0 47 330.5 48 333.0 49 337.0 50 341.0 51 324.0 52 307.0 53 290.5 54 274.0 55 261.5 56 249.0 57 234.0 58 219.0 59 200.5 60 182.0 61 180.5 62 179.0 63 153.5 64 128.0 65 117.0 66 106.0 67 88.5 68 71.0 69 68.0 70 65.0 71 56.0 72 47.0 73 35.0 74 23.0 75 22.0 76 21.0 77 15.0 78 9.0 79 6.5 80 4.0 81 3.0 82 2.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.8500000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.55 #Duplication Level Percentage of deduplicated Percentage of total 1 97.64223475140953 95.25 2 2.203997949769349 4.3 3 0.1537672988211174 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1266218 READS because READLEN < 1 Read 1266218 spots for SRR6322342.sra Written 1266218 spots for SRR6322342.sra Rejected 1266218 READS because READLEN < 1 Read 1266218 spots for SRR6322342.sra Written 1266218 spots for SRR6322342.sra Rejected 1266218 READS because READLEN < 1 Read 1266218 spots for SRR6322342.sra Written 1266218 spots for SRR6322342.sra Rejected 1266218 READS because READLEN < 1 Read 1266218 spots for SRR6322342.sra Written 1266218 spots for SRR6322342.sra Rejected 1266218 READS because READLEN < 1 Read 1266218 spots for SRR6322342.sra Written 1266218 spots for SRR6322342.sra Rejected 1266218 READS because READLEN < 1 Read 1266218 spots for SRR6322342.sra Written 1266218 spots for SRR6322342.sra Rejected 1266218 READS because READLEN < 1 Read 1266218 spots for SRR6322342.sra Written 1266218 spots for SRR6322342.sra Rejected 1266218 READS because READLEN < 1 Read 1266218 spots for SRR6322342.sra Written 1266218 spots for SRR6322342.sra Rejected 1266218 READS because READLEN < 1 Read 1266218 spots for SRR6322342.sra Written 1266218 spots for SRR6322342.sra Rejected 1266218 READS because READLEN < 1 Read 1266218 spots for SRR6322342.sra Written 1266218 spots for SRR6322342.sra Rejected 1266236 READS because READLEN < 1 Read 1266236 spots for SRR6322342.sra Written 1266236 spots for SRR6322342.sra Rejected 1266218 READS because READLEN < 1 Read 1266218 spots for SRR6322342.sra Written 1266218 spots for SRR6322342.sra Rejected 1266218 READS because READLEN < 1 Read 1266218 spots for SRR6322342.sra Written 1266218 spots for SRR6322342.sra Rejected 1266218 READS because READLEN < 1 Read 1266218 spots for SRR6322342.sra Written 1266218 spots for SRR6322342.sra Rejected 1266218 READS because READLEN < 1 Read 1266218 spots for SRR6322342.sra Written 1266218 spots for SRR6322342.sra Rejected 1266218 READS because READLEN < 1 Read 1266218 spots for SRR6322342.sra Written 1266218 spots for SRR6322342.sra Rejected 1266218 READS because READLEN < 1 Read 1266218 spots for SRR6322342.sra Written 1266218 spots for SRR6322342.sra Rejected 1266218 READS because READLEN < 1 Read 1266218 spots for SRR6322342.sra Written 1266218 spots for SRR6322342.sra Rejected 1266218 READS because READLEN < 1 Read 1266218 spots for SRR6322342.sra Written 1266218 spots for SRR6322342.sra Rejected 1266218 READS because READLEN < 1 Read 1266218 spots for SRR6322342.sra Written 1266218 spots for SRR6322342.sra SRR ids: ['SRR6322342.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_338s9dc1 SRR6322342.sra spots: 25324378 blocks: [[1, 1266218], [1266219, 2532436], [2532437, 3798654], [3798655, 5064872], [5064873, 6331090], [6331091, 7597308], [7597309, 8863526], [8863527, 10129744], [10129745, 11395962], [11395963, 12662180], [12662181, 13928398], [13928399, 15194616], [15194617, 16460834], [16460835, 17727052], [17727053, 18993270], [18993271, 20259488], [20259489, 21525706], [21525707, 22791924], [22791925, 24058142], [24058143, 25324378]] SRR6322342 file size 3539540 SRR6322342 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322342 SRR6322342_1.fastq Input file: SRR6322342_1.fastq trimmed: SRR6322342-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:31:15 2024 >> started Sat Dec 7 09:31:36 2024 >> done (20.678s) 25324378 reads processed; of these: 294 ( 0.00%) short reads filtered out after trimming by size control 72720 ( 0.29%) empty reads filtered out after trimming by size control 25251364 (99.71%) reads available; of these: 62 ( 0.00%) trimmed reads available after processing 25251302 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 51 0.00% 50 25251302 100.00% 25251364 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=24 prefix-density=0.12 prefix-fanout=2.2 sequence=TTAGGCATGGGCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=20 fanout-score=38.74 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=6.4 sequence=ATCTCCTTGCCAATGGTATAGTGACCGCGGGCAAAGTTGTTGGCTGCATCCTCCTTGCCACTGATGAGCTGCTCAGGGTGGAAGAGCTGGCGGTAAGTGCCAGTCCGCACCTCATCAATCACAGTGGGTTCCAGATCCACAAAGACAGCACGGG Started job on | Dec 07 09:31:46 Started mapping on | Dec 07 09:31:47 Finished on | Dec 07 09:32:08 Mapping speed, Million of reads per hour | 4328.81 Number of input reads | 25251364 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 24488907 Uniquely mapped reads % | 96.98% Average mapped length | 49.83 Number of splices: Total | 3372341 Number of splices: Annotated (sjdb) | 3272997 Number of splices: GT/AG | 3328732 Number of splices: GC/AG | 38201 Number of splices: AT/AC | 1825 Number of splices: Non-canonical | 3583 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.00% Deletion average length | 1.72 Insertion rate per base | 0.00% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 464643 % of reads mapped to multiple loci | 1.84% Number of reads mapped to too many loci | 110899 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.73% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 297814 297814 297814 N_multimapping 464643 464643 464643 N_noFeature 881461 23966666 1043412 N_ambiguous 379959 1490 20697 UnstrandedReadsAssigned:23227487 PositiveStrandReadsAssigned:520751 NegativeStrandReadsAssigned:23424798 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322342 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322342-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,251,364 reads, 22,841,827 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,241 rounds 52973 SRR6322342.ke.tsv 35125 SRR6322342.se.tsv 88098 total ==> SRR6322342.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 140.076 13.6949 PNS24247 1044 945 25.2753 2.18869 PNS24249 1928 1829 20.0109 0.89531 PNS24246 1044 945 25.2753 2.18869 PNS24248 1044 945 25.2753 2.18869 PNS24244 1471 1372 55.0872 3.28561 PNS24243 293 194 0 0 KQK14069 1603 1504 3.99646 0.217444 KQK14071 474 375 2.00985 0.438582 ==> SRR6322342.se.tsv <== BRADI_1g14170v3 6 BRADI_1g53295v3 54 BRADI_1g59795v3 220 BRADI_1g07683v3 0 BRADI_1g00485v3 235 BRADI_1g20270v3 713 BRADI_1g74790v3 139 BRADI_1g09890v3 34 BRADI_1g77505v3 205 BRADI_1g48960v3 0 SRR6322342 completed mapping pipeline successfully