Starting /dee2/code/volunteer_pipeline.sh SRR6322343 current disk space = 1543074566144 free memory = 1603040280 SRR6322343 SRAfilesize b528a0316b20ec962e452ea18e37fae1 SRR6322343.sra SRR6322343.sra file validated SRR6322343 is single end SRR6322343 is conventional basespace SRR6322343 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322343_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.87875 32.0 32.0 32.0 32.0 32.0 2 31.48625 32.0 32.0 32.0 32.0 32.0 3 35.7225 37.0 37.0 37.0 32.0 37.0 4 36.375 37.0 37.0 37.0 37.0 37.0 5 36.70375 37.0 37.0 37.0 37.0 37.0 6 40.4255 41.0 41.0 41.0 41.0 41.0 7 40.3095 41.0 41.0 41.0 41.0 41.0 8 33.70075 37.0 32.0 41.0 12.0 41.0 9 37.529 41.0 37.0 41.0 32.0 41.0 10 34.746 37.0 32.0 41.0 22.0 41.0 11 39.90075 41.0 41.0 41.0 37.0 41.0 12 38.55325 41.0 37.0 41.0 32.0 41.0 13 35.8855 41.0 32.0 41.0 22.0 41.0 14 35.6835 41.0 32.0 41.0 22.0 41.0 15 39.4055 41.0 41.0 41.0 37.0 41.0 16 35.7315 41.0 32.0 41.0 22.0 41.0 17 40.0125 41.0 41.0 41.0 37.0 41.0 18 40.40475 41.0 41.0 41.0 41.0 41.0 19 36.74475 41.0 37.0 41.0 27.0 41.0 20 39.25875 41.0 41.0 41.0 37.0 41.0 21 39.149 41.0 41.0 41.0 37.0 41.0 22 36.83675 41.0 37.0 41.0 27.0 41.0 23 39.42475 41.0 41.0 41.0 37.0 41.0 24 40.4155 41.0 41.0 41.0 41.0 41.0 25 35.004 41.0 32.0 41.0 22.0 41.0 26 39.191 41.0 41.0 41.0 37.0 41.0 27 30.67275 37.0 22.0 41.0 12.0 41.0 28 36.54525 41.0 37.0 41.0 27.0 41.0 29 39.0595 41.0 41.0 41.0 37.0 41.0 30 39.84625 41.0 41.0 41.0 37.0 41.0 31 33.704 41.0 27.0 41.0 12.0 41.0 32 31.86875 37.0 22.0 41.0 12.0 41.0 33 30.64625 37.0 22.0 41.0 12.0 41.0 34 33.20075 37.0 27.0 41.0 12.0 41.0 35 37.7515 41.0 37.0 41.0 27.0 41.0 36 26.54475 27.0 12.0 41.0 12.0 41.0 37 29.36925 32.0 22.0 41.0 12.0 41.0 38 23.698 22.0 12.0 37.0 12.0 41.0 39 23.6235 22.0 12.0 37.0 12.0 41.0 40 32.65725 37.0 27.0 41.0 22.0 41.0 41 38.15475 41.0 37.0 41.0 32.0 41.0 42 33.64575 37.0 27.0 41.0 12.0 41.0 43 25.7675 27.0 12.0 37.0 12.0 41.0 44 24.50675 22.0 12.0 37.0 12.0 41.0 45 22.07475 22.0 12.0 32.0 12.0 37.0 46 28.6065 32.0 22.0 37.0 12.0 41.0 47 24.61825 27.0 12.0 37.0 12.0 41.0 48 35.93775 37.0 37.0 41.0 27.0 41.0 49 38.45575 41.0 37.0 41.0 32.0 41.0 50 39.75275 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 4.0 24 7.0 25 11.0 26 40.0 27 42.0 28 68.0 29 107.0 30 142.0 31 222.0 32 351.0 33 439.0 34 561.0 35 613.0 36 570.0 37 472.0 38 246.0 39 91.0 40 13.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.875 12.125 7.049999999999999 34.949999999999996 2 28.299524167292763 11.995992987728526 34.81091910843977 24.893563736538944 3 25.55 18.675 24.55 31.225 4 27.325 24.25 21.325 27.1 5 27.450000000000003 30.349999999999998 22.2 20.0 6 24.7 31.424999999999997 22.275 21.6 7 16.775000000000002 23.1 41.025 19.1 8 25.424999999999997 21.825 27.425 25.324999999999996 9 21.3 20.05 32.475 26.174999999999997 10 23.1 34.1 22.925 19.875 11 27.825 24.474999999999998 22.8 24.9 12 23.925 21.925 26.35 27.800000000000004 13 24.9 27.275 25.775 22.05 14 25.650000000000002 25.5 25.5 23.35 15 23.9 25.650000000000002 25.55 24.9 16 28.375 24.8 22.2 24.625 17 23.974999999999998 24.95 26.125 24.95 18 24.05 25.424999999999997 24.224999999999998 26.3 19 26.450000000000003 25.45 23.25 24.85 20 23.425 26.150000000000002 25.75 24.675 21 24.675 25.575 24.775 24.975 22 25.6 24.975 23.35 26.075 23 22.725 26.450000000000003 25.650000000000002 25.174999999999997 24 24.675 24.85 25.275 25.2 25 28.625 23.974999999999998 22.925 24.474999999999998 26 23.849999999999998 25.074999999999996 25.825 25.25 27 29.925 23.25 23.45 23.375 28 24.125 24.675 24.45 26.75 29 25.0 25.074999999999996 25.55 24.375 30 24.0 23.400000000000002 25.5 27.1 31 27.775 23.45 24.025 24.75 32 26.775 25.3 23.75 24.175 33 27.700000000000003 23.599999999999998 24.575 24.125 34 25.724999999999998 25.074999999999996 24.325 24.875 35 22.650000000000002 25.025 26.0 26.325 36 26.174999999999997 24.275 26.6 22.95 37 28.9 23.65 23.225 24.224999999999998 38 27.125 23.95 26.724999999999998 22.2 39 27.875 24.55 23.549999999999997 24.025 40 25.3 24.75 24.425 25.525 41 23.05 26.075 26.35 24.525 42 25.424999999999997 24.65 24.224999999999998 25.7 43 27.775 24.425 26.1 21.7 44 28.199999999999996 24.525 25.05 22.225 45 27.450000000000003 24.175 27.3 21.075 46 27.625 24.8 22.625 24.95 47 28.1 24.8 24.775 22.325 48 23.849999999999998 26.25 24.5 25.4 49 23.125 24.3 26.05 26.525 50 22.975 24.875 26.075 26.075 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.5 2 2.0 3 2.0 4 2.0 5 2.0 6 2.0 7 1.5 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 2.0 22 3.0 23 5.5 24 8.0 25 9.0 26 10.0 27 13.5 28 17.0 29 25.5 30 34.0 31 37.5 32 41.0 33 52.0 34 63.0 35 82.0 36 101.0 37 121.5 38 142.0 39 166.5 40 191.0 41 210.0 42 229.0 43 261.5 44 294.0 45 308.0 46 322.0 47 327.0 48 332.0 49 340.5 50 349.0 51 345.0 52 341.0 53 310.5 54 280.0 55 249.0 56 218.0 57 208.0 58 198.0 59 198.0 60 198.0 61 182.0 62 166.0 63 139.5 64 113.0 65 115.5 66 118.0 67 97.5 68 77.0 69 64.5 70 52.0 71 45.5 72 39.0 73 32.5 74 26.0 75 21.0 76 16.0 77 11.5 78 7.0 79 4.0 80 1.0 81 1.5 82 2.0 83 1.0 84 0.0 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.78542510121457 97.6 2 1.214574898785425 2.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1385504 READS because READLEN < 1 Read 1385504 spots for SRR6322343.sra Written 1385504 spots for SRR6322343.sra Rejected 1385504 READS because READLEN < 1 Read 1385504 spots for SRR6322343.sra Written 1385504 spots for SRR6322343.sra Rejected 1385504 READS because READLEN < 1 Read 1385504 spots for SRR6322343.sra Written 1385504 spots for SRR6322343.sra Rejected 1385504 READS because READLEN < 1 Read 1385504 spots for SRR6322343.sra Written 1385504 spots for SRR6322343.sra Rejected 1385504 READS because READLEN < 1 Read 1385504 spots for SRR6322343.sra Written 1385504 spots for SRR6322343.sra Rejected 1385504 READS because READLEN < 1 Read 1385504 spots for SRR6322343.sra Written 1385504 spots for SRR6322343.sra Rejected 1385504 READS because READLEN < 1 Read 1385504 spots for SRR6322343.sra Written 1385504 spots for SRR6322343.sra Rejected 1385504 READS because READLEN < 1 Read 1385504 spots for SRR6322343.sra Written 1385504 spots for SRR6322343.sra Rejected 1385504 READS because READLEN < 1 Read 1385504 spots for SRR6322343.sra Written 1385504 spots for SRR6322343.sra Rejected 1385504 READS because READLEN < 1 Read 1385504 spots for SRR6322343.sra Written 1385504 spots for SRR6322343.sra Rejected 1385504 READS because READLEN < 1 Read 1385504 spots for SRR6322343.sra Written 1385504 spots for SRR6322343.sra Rejected 1385504 READS because READLEN < 1 Read 1385504 spots for SRR6322343.sra Written 1385504 spots for SRR6322343.sra Rejected 1385504 READS because READLEN < 1 Read 1385504 spots for SRR6322343.sra Written 1385504 spots for SRR6322343.sra Rejected 1385504 READS because READLEN < 1 Read 1385504 spots for SRR6322343.sra Written 1385504 spots for SRR6322343.sra Rejected 1385509 READS because READLEN < 1 Read 1385509 spots for SRR6322343.sra Written 1385509 spots for SRR6322343.sra Rejected 1385504 READS because READLEN < 1 Read 1385504 spots for SRR6322343.sra Written 1385504 spots for SRR6322343.sra Rejected 1385504 READS because READLEN < 1 Read 1385504 spots for SRR6322343.sra Written 1385504 spots for SRR6322343.sra Rejected 1385504 READS because READLEN < 1 Read 1385504 spots for SRR6322343.sra Written 1385504 spots for SRR6322343.sra Rejected 1385504 READS because READLEN < 1 Read 1385504 spots for SRR6322343.sra Written 1385504 spots for SRR6322343.sra Rejected 1385504 READS because READLEN < 1 Read 1385504 spots for SRR6322343.sra Written 1385504 spots for SRR6322343.sra SRR ids: ['SRR6322343.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wrzouvyi SRR6322343.sra spots: 27710085 blocks: [[1, 1385504], [1385505, 2771008], [2771009, 4156512], [4156513, 5542016], [5542017, 6927520], [6927521, 8313024], [8313025, 9698528], [9698529, 11084032], [11084033, 12469536], [12469537, 13855040], [13855041, 15240544], [15240545, 16626048], [16626049, 18011552], [18011553, 19397056], [19397057, 20782560], [20782561, 22168064], [22168065, 23553568], [23553569, 24939072], [24939073, 26324576], [26324577, 27710085]] SRR6322343 file size 3875030 SRR6322343 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322343 SRR6322343_1.fastq Input file: SRR6322343_1.fastq trimmed: SRR6322343-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:36:48 2024 >> started Sat Dec 7 11:37:06 2024 >> done (17.710s) 27710085 reads processed; of these: 267 ( 0.00%) short reads filtered out after trimming by size control 40398 ( 0.15%) empty reads filtered out after trimming by size control 27669420 (99.85%) reads available; of these: 1801 ( 0.01%) trimmed reads available after processing 27667619 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 1795 0.01% 50 27667619 99.99% 27669420 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=20 prefix-density=0.11 prefix-fanout=2.2 sequence=AACCATGTTGGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=20 fanout-score=32.72 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=6.0 sequence=ATCTCCTTGCCAATGGTATAGTGACCGCGGGCAAAGTTGTTGGCTGCATCCTCCTTGCCACTGATGAGCTGCTCAGGGTGGAAGAGCTGGCGGTAAGTGCCAGTCCGCACCTCATCAATCACAGTGGGTTCCAGATCCACAAAGACAGCACGGG Started job on | Dec 07 11:37:52 Started mapping on | Dec 07 11:37:52 Finished on | Dec 07 11:38:19 Mapping speed, Million of reads per hour | 3689.26 Number of input reads | 27669420 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 26180831 Uniquely mapped reads % | 94.62% Average mapped length | 49.85 Number of splices: Total | 3641413 Number of splices: Annotated (sjdb) | 3534157 Number of splices: GT/AG | 3595221 Number of splices: GC/AG | 40130 Number of splices: AT/AC | 1956 Number of splices: Non-canonical | 4106 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.00% Deletion average length | 1.74 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 621413 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 649004 % of reads mapped to too many loci | 2.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.73% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 867176 867176 867176 N_multimapping 621413 621413 621413 N_noFeature 1095624 25604035 1272733 N_ambiguous 421533 1599 23211 UnstrandedReadsAssigned:24663674 PositiveStrandReadsAssigned:575197 NegativeStrandReadsAssigned:24884887 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322343 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322343-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,669,420 reads, 24,550,690 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,274 rounds 52973 SRR6322343.ke.tsv 35125 SRR6322343.se.tsv 88098 total ==> SRR6322343.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 123.713 11.6015 PNS24247 1044 945 26.319 2.18607 PNS24249 1928 1829 14.3878 0.617456 PNS24246 1044 945 26.319 2.18607 PNS24248 1044 945 26.319 2.18607 PNS24244 1471 1372 79.9422 4.57349 PNS24243 293 194 0 0 KQK14069 1603 1504 3.99646 0.208571 KQK14071 474 375 1.01124 0.211666 ==> SRR6322343.se.tsv <== BRADI_1g14170v3 7 BRADI_1g53295v3 45 BRADI_1g59795v3 355 BRADI_1g07683v3 0 BRADI_1g00485v3 257 BRADI_1g20270v3 881 BRADI_1g74790v3 137 BRADI_1g09890v3 40 BRADI_1g77505v3 144 BRADI_1g48960v3 0 SRR6322343 completed mapping pipeline successfully