Starting /dee2/code/volunteer_pipeline.sh SRR6322344 current disk space = 1544155877376 free memory = 1595420472 SRR6322344 SRAfilesize 233b25b38ab6daa47e1e279e5e5e2dd9 SRR6322344.sra SRR6322344.sra file validated SRR6322344 is single end SRR6322344 is conventional basespace SRR6322344 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322344_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6775 32.0 32.0 32.0 32.0 32.0 2 25.54875 32.0 12.0 32.0 12.0 32.0 3 33.49125 32.0 32.0 37.0 32.0 37.0 4 35.48 37.0 37.0 37.0 32.0 37.0 5 36.59375 37.0 37.0 37.0 37.0 37.0 6 40.021 41.0 41.0 41.0 37.0 41.0 7 32.47475 37.0 27.0 41.0 12.0 41.0 8 38.676 41.0 37.0 41.0 32.0 41.0 9 38.87125 41.0 37.0 41.0 32.0 41.0 10 40.11275 41.0 41.0 41.0 37.0 41.0 11 40.301 41.0 41.0 41.0 41.0 41.0 12 40.06675 41.0 41.0 41.0 37.0 41.0 13 38.97025 41.0 41.0 41.0 32.0 41.0 14 38.16875 41.0 37.0 41.0 32.0 41.0 15 39.4965 41.0 41.0 41.0 37.0 41.0 16 36.48125 41.0 37.0 41.0 27.0 41.0 17 39.5595 41.0 41.0 41.0 37.0 41.0 18 40.42125 41.0 41.0 41.0 41.0 41.0 19 40.16525 41.0 41.0 41.0 37.0 41.0 20 36.5575 41.0 37.0 41.0 27.0 41.0 21 39.89075 41.0 41.0 41.0 37.0 41.0 22 40.0735 41.0 41.0 41.0 37.0 41.0 23 38.604 41.0 41.0 41.0 32.0 41.0 24 40.06375 41.0 41.0 41.0 37.0 41.0 25 34.5235 41.0 32.0 41.0 12.0 41.0 26 37.66975 41.0 37.0 41.0 27.0 41.0 27 35.0375 41.0 32.0 41.0 12.0 41.0 28 30.37575 37.0 22.0 41.0 12.0 41.0 29 38.28175 41.0 37.0 41.0 32.0 41.0 30 34.201 41.0 32.0 41.0 12.0 41.0 31 39.25575 41.0 41.0 41.0 37.0 41.0 32 28.56925 32.0 12.0 41.0 12.0 41.0 33 33.7565 37.0 27.0 41.0 12.0 41.0 34 31.695 37.0 27.0 41.0 12.0 41.0 35 36.172 41.0 37.0 41.0 22.0 41.0 36 24.837 27.0 12.0 37.0 12.0 41.0 37 37.9215 41.0 37.0 41.0 32.0 41.0 38 39.17825 41.0 41.0 41.0 37.0 41.0 39 33.72525 41.0 27.0 41.0 12.0 41.0 40 38.60575 41.0 37.0 41.0 32.0 41.0 41 27.5605 32.0 12.0 41.0 12.0 41.0 42 37.87025 41.0 37.0 41.0 32.0 41.0 43 39.813 41.0 41.0 41.0 37.0 41.0 44 38.913 41.0 41.0 41.0 37.0 41.0 45 34.60025 41.0 32.0 41.0 12.0 41.0 46 38.90725 41.0 41.0 41.0 37.0 41.0 47 39.61275 41.0 41.0 41.0 37.0 41.0 48 39.40725 41.0 41.0 41.0 37.0 41.0 49 39.8085 41.0 41.0 41.0 37.0 41.0 50 38.80025 41.0 41.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 4.0 25 3.0 26 13.0 27 23.0 28 36.0 29 43.0 30 67.0 31 100.0 32 143.0 33 192.0 34 282.0 35 363.0 36 530.0 37 685.0 38 801.0 39 639.0 40 75.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.55 10.85 6.425 35.175 2 29.219462747085657 9.4272681196148 35.78307146477446 25.57019766852509 3 25.6 17.175 24.725 32.5 4 28.225 23.525 21.675 26.575 5 29.299999999999997 28.725 22.725 19.25 6 24.349999999999998 31.0 22.175 22.475 7 23.474999999999998 20.474999999999998 38.675 17.375 8 21.95 21.925 30.55 25.575 9 21.25 20.275000000000002 33.650000000000006 24.825 10 23.400000000000002 33.324999999999996 23.65 19.625 11 28.075 23.674999999999997 21.7 26.55 12 23.799999999999997 22.475 27.375 26.35 13 24.075 26.924999999999997 25.6 23.400000000000002 14 25.3 25.124999999999996 24.175 25.4 15 23.799999999999997 25.025 25.074999999999996 26.1 16 25.900000000000002 24.8 24.15 25.15 17 25.6 23.0 25.3 26.1 18 24.275 24.325 24.4 27.0 19 24.075 26.775 24.224999999999998 24.925 20 27.075 25.900000000000002 21.95 25.074999999999996 21 24.2 25.75 25.624999999999996 24.425 22 24.175 25.85 25.224999999999998 24.75 23 25.224999999999998 25.724999999999998 24.15 24.9 24 23.974999999999998 25.6 24.65 25.775 25 29.625 24.0 21.8 24.575 26 24.85 24.425 23.724999999999998 27.0 27 23.150000000000002 24.6 25.924999999999997 26.325 28 29.95 22.400000000000002 23.849999999999998 23.799999999999997 29 26.200000000000003 25.025 24.025 24.75 30 25.95 25.074999999999996 23.799999999999997 25.174999999999997 31 24.075 25.624999999999996 25.424999999999997 24.875 32 29.9 23.599999999999998 24.2 22.3 33 23.925 24.099999999999998 24.6 27.375 34 26.625 25.1 23.95 24.325 35 25.25 26.650000000000002 24.4 23.7 36 30.875000000000004 24.575 24.45 20.1 37 24.675 23.35 25.124999999999996 26.85 38 23.875 25.124999999999996 25.650000000000002 25.35 39 25.874999999999996 23.95 24.725 25.45 40 24.85 24.4 23.674999999999997 27.075 41 30.55 23.35 25.474999999999998 20.625 42 25.35 24.325 24.5 25.825 43 24.925 25.25 23.849999999999998 25.974999999999998 44 25.3 25.2 25.624999999999996 23.875 45 25.374999999999996 24.099999999999998 24.4 26.125 46 23.925 25.35 24.625 26.1 47 24.025 26.3 24.3 25.374999999999996 48 23.175 25.424999999999997 25.95 25.45 49 23.575 25.374999999999996 25.05 26.0 50 24.474999999999998 25.724999999999998 25.0 24.8 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 2.0 23 2.5 24 3.0 25 5.0 26 7.0 27 12.5 28 18.0 29 24.0 30 30.0 31 37.0 32 44.0 33 53.0 34 62.0 35 84.5 36 107.0 37 125.5 38 144.0 39 169.0 40 194.0 41 227.5 42 261.0 43 268.5 44 276.0 45 290.5 46 305.0 47 339.0 48 373.0 49 342.5 50 312.0 51 298.5 52 285.0 53 276.5 54 268.0 55 254.0 56 240.0 57 234.5 58 229.0 59 192.0 60 155.0 61 161.0 62 167.0 63 154.5 64 142.0 65 124.0 66 106.0 67 92.0 68 78.0 69 72.5 70 67.0 71 56.5 72 46.0 73 41.5 74 37.0 75 28.5 76 20.0 77 17.0 78 14.0 79 8.5 80 3.0 81 1.5 82 0.0 83 0.5 84 1.0 85 1.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.35 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.15 #Duplication Level Percentage of deduplicated Percentage of total 1 98.26795720835456 96.45 2 1.6046867040244521 3.15 3 0.10188487009679062 0.3 4 0.025471217524197655 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 2162484 READS because READLEN < 1 Read 2162484 spots for SRR6322344.sra Written 2162484 spots for SRR6322344.sra Rejected 2162484 READS because READLEN < 1 Read 2162484 spots for SRR6322344.sra Written 2162484 spots for SRR6322344.sra Rejected 2162484 READS because READLEN < 1 Read 2162484 spots for SRR6322344.sra Written 2162484 spots for SRR6322344.sra Rejected 2162484 READS because READLEN < 1 Read 2162484 spots for SRR6322344.sra Written 2162484 spots for SRR6322344.sra Rejected 2162484 READS because READLEN < 1 Read 2162484 spots for SRR6322344.sra Written 2162484 spots for SRR6322344.sra Rejected 2162484 READS because READLEN < 1 Read 2162484 spots for SRR6322344.sra Written 2162484 spots for SRR6322344.sra Rejected 2162484 READS because READLEN < 1 Read 2162484 spots for SRR6322344.sra Written 2162484 spots for SRR6322344.sra Rejected 2162484 READS because READLEN < 1 Read 2162484 spots for SRR6322344.sra Written 2162484 spots for SRR6322344.sra Rejected 2162484 READS because READLEN < 1 Read 2162484 spots for SRR6322344.sra Written 2162484 spots for SRR6322344.sra Rejected 2162495 READS because READLEN < 1 Read 2162495 spots for SRR6322344.sra Written 2162495 spots for SRR6322344.sra Rejected 2162484 READS because READLEN < 1 Read 2162484 spots for SRR6322344.sra Written 2162484 spots for SRR6322344.sra Rejected 2162484 READS because READLEN < 1 Read 2162484 spots for SRR6322344.sra Written 2162484 spots for SRR6322344.sra Rejected 2162484 READS because READLEN < 1 Read 2162484 spots for SRR6322344.sra Written 2162484 spots for SRR6322344.sra Rejected 2162484 READS because READLEN < 1 Read 2162484 spots for SRR6322344.sra Written 2162484 spots for SRR6322344.sra Rejected 2162484 READS because READLEN < 1 Read 2162484 spots for SRR6322344.sra Written 2162484 spots for SRR6322344.sra Rejected 2162484 READS because READLEN < 1 Read 2162484 spots for SRR6322344.sra Written 2162484 spots for SRR6322344.sra Rejected 2162484 READS because READLEN < 1 Read 2162484 spots for SRR6322344.sra Written 2162484 spots for SRR6322344.sra Rejected 2162484 READS because READLEN < 1 Read 2162484 spots for SRR6322344.sra Written 2162484 spots for SRR6322344.sra Rejected 2162484 READS because READLEN < 1 Read 2162484 spots for SRR6322344.sra Written 2162484 spots for SRR6322344.sra Rejected 2162484 READS because READLEN < 1 Read 2162484 spots for SRR6322344.sra Written 2162484 spots for SRR6322344.sra SRR ids: ['SRR6322344.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i4fiu0ma SRR6322344.sra spots: 43249691 blocks: [[1, 2162484], [2162485, 4324968], [4324969, 6487452], [6487453, 8649936], [8649937, 10812420], [10812421, 12974904], [12974905, 15137388], [15137389, 17299872], [17299873, 19462356], [19462357, 21624840], [21624841, 23787324], [23787325, 25949808], [25949809, 28112292], [28112293, 30274776], [30274777, 32437260], [32437261, 34599744], [34599745, 36762228], [36762229, 38924712], [38924713, 41087196], [41087197, 43249691]] SRR6322344 file size 6060287 SRR6322344 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322344 SRR6322344_1.fastq Input file: SRR6322344_1.fastq trimmed: SRR6322344-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:31:39 2024 >> started Sat Dec 7 09:32:10 2024 >> done (31.476s) 43249691 reads processed; of these: 497 ( 0.00%) short reads filtered out after trimming by size control 87107 ( 0.20%) empty reads filtered out after trimming by size control 43162087 (99.80%) reads available; of these: 104 ( 0.00%) trimmed reads available after processing 43161983 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 87 0.00% 50 43161983 100.00% 43162087 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=24 prefix-density=0.12 prefix-fanout=2.2 sequence=AACCATGTTGGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=35.05 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=6.3 sequence=ATCTCCTTGCCAATGGTATAGTGACCGCGGGCAAAGTTGTTGGCTGCATCCTCCTTGCCACTGATGAGCTGCTCAGGGTGGAAGAGCTGGCGGTAAGTGCCAGTCCGCACCTCATCAATCACAGTGGGTTCCAGATCCACAAAGACAGCACGGG Started job on | Dec 07 09:32:21 Started mapping on | Dec 07 09:32:21 Finished on | Dec 07 09:32:58 Mapping speed, Million of reads per hour | 4199.55 Number of input reads | 43162087 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 41863129 Uniquely mapped reads % | 96.99% Average mapped length | 49.84 Number of splices: Total | 5464692 Number of splices: Annotated (sjdb) | 5299070 Number of splices: GT/AG | 5395355 Number of splices: GC/AG | 59879 Number of splices: AT/AC | 2939 Number of splices: Non-canonical | 6519 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.00% Deletion average length | 1.71 Insertion rate per base | 0.00% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 798631 % of reads mapped to multiple loci | 1.85% Number of reads mapped to too many loci | 162886 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.77% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 500327 500327 500327 N_multimapping 798631 798631 798631 N_noFeature 1667523 40928894 1949566 N_ambiguous 685704 2616 34961 UnstrandedReadsAssigned:39509902 PositiveStrandReadsAssigned:931619 NegativeStrandReadsAssigned:39878602 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322344 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322344-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 43,162,087 reads, 38,854,132 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,276 rounds 52973 SRR6322344.ke.tsv 35125 SRR6322344.se.tsv 88098 total ==> SRR6322344.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 224.64 13.007 PNS24247 1044 945 40.7958 2.09218 PNS24249 1928 1829 41.4903 1.09938 PNS24246 1044 945 40.7958 2.09218 PNS24248 1044 945 40.7958 2.09218 PNS24244 1471 1372 147.483 5.20958 PNS24243 293 194 0 0 KQK14069 1603 1504 10.6572 0.343409 KQK14071 474 375 4.38742 0.567015 ==> SRR6322344.se.tsv <== BRADI_1g14170v3 14 BRADI_1g53295v3 66 BRADI_1g59795v3 422 BRADI_1g07683v3 0 BRADI_1g00485v3 711 BRADI_1g20270v3 1626 BRADI_1g74790v3 128 BRADI_1g09890v3 63 BRADI_1g77505v3 245 BRADI_1g48960v3 0 SRR6322344 completed mapping pipeline successfully