Starting /dee2/code/volunteer_pipeline.sh SRR6322345 current disk space = 1544132689920 free memory = 1605200288 SRR6322345 SRAfilesize 1d808011b12ed938135015955a9a794b SRR6322345.sra SRR6322345.sra file validated SRR6322345 is single end SRR6322345 is conventional basespace SRR6322345 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322345_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 52 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8775 32.0 32.0 32.0 32.0 32.0 2 31.465 32.0 32.0 32.0 32.0 32.0 3 35.735 37.0 37.0 37.0 32.0 37.0 4 36.35625 37.0 37.0 37.0 37.0 37.0 5 36.755 37.0 37.0 37.0 37.0 37.0 6 40.41725 41.0 41.0 41.0 41.0 41.0 7 40.22925 41.0 41.0 41.0 37.0 41.0 8 33.261 37.0 32.0 41.0 12.0 41.0 9 37.115 41.0 37.0 41.0 32.0 41.0 10 34.3975 37.0 32.0 41.0 12.0 41.0 11 39.81325 41.0 41.0 41.0 37.0 41.0 12 38.58475 41.0 37.0 41.0 32.0 41.0 13 35.743 41.0 32.0 41.0 22.0 41.0 14 35.64075 41.0 32.0 41.0 22.0 41.0 15 39.3515 41.0 41.0 41.0 37.0 41.0 16 35.1785 41.0 32.0 41.0 22.0 41.0 17 39.94125 41.0 41.0 41.0 37.0 41.0 18 40.3115 41.0 41.0 41.0 37.0 41.0 19 36.49575 41.0 37.0 41.0 27.0 41.0 20 39.2045 41.0 41.0 41.0 37.0 41.0 21 38.9895 41.0 41.0 41.0 37.0 41.0 22 36.5685 41.0 37.0 41.0 27.0 41.0 23 39.36725 41.0 41.0 41.0 37.0 41.0 24 40.46975 41.0 41.0 41.0 41.0 41.0 25 34.81125 41.0 32.0 41.0 22.0 41.0 26 39.13425 41.0 41.0 41.0 37.0 41.0 27 30.3845 37.0 22.0 41.0 12.0 41.0 28 36.23025 41.0 37.0 41.0 22.0 41.0 29 38.91525 41.0 41.0 41.0 37.0 41.0 30 39.79825 41.0 41.0 41.0 37.0 41.0 31 33.58375 41.0 27.0 41.0 12.0 41.0 32 31.66425 37.0 22.0 41.0 12.0 41.0 33 30.1705 37.0 22.0 41.0 12.0 41.0 34 32.96675 37.0 27.0 41.0 12.0 41.0 35 37.50275 41.0 37.0 41.0 27.0 41.0 36 26.1755 27.0 12.0 37.0 12.0 41.0 37 29.43825 32.0 22.0 41.0 12.0 41.0 38 23.4205 22.0 12.0 37.0 12.0 41.0 39 23.2375 22.0 12.0 32.0 12.0 37.0 40 32.10575 37.0 27.0 41.0 22.0 41.0 41 38.10025 41.0 37.0 41.0 32.0 41.0 42 33.52075 37.0 27.0 41.0 12.0 41.0 43 25.12575 27.0 12.0 37.0 12.0 41.0 44 24.311 22.0 12.0 37.0 12.0 41.0 45 21.5845 22.0 12.0 32.0 12.0 37.0 46 28.08 27.0 22.0 37.0 12.0 41.0 47 24.33325 22.0 12.0 37.0 12.0 41.0 48 35.886 37.0 32.0 41.0 27.0 41.0 49 38.3115 41.0 37.0 41.0 32.0 41.0 50 39.79075 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 2.0 24 5.0 25 13.0 26 35.0 27 50.0 28 76.0 29 121.0 30 156.0 31 236.0 32 344.0 33 488.0 34 590.0 35 623.0 36 564.0 37 412.0 38 210.0 39 65.0 40 8.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.975 8.1 7.5 42.425000000000004 2 26.479438314944836 10.957873620862587 33.90170511534604 28.66098294884654 3 25.55 14.249999999999998 21.5 38.7 4 29.775000000000002 20.175 19.575 30.475 5 30.049999999999997 25.95 22.55 21.45 6 25.6 29.225 23.025000000000002 22.15 7 19.175 22.825 39.45 18.55 8 27.900000000000002 21.625 27.1 23.375 9 22.35 21.5 32.225 23.925 10 24.825 32.475 23.65 19.05 11 28.499999999999996 24.349999999999998 21.325 25.825 12 24.85 21.825 25.775 27.55 13 27.35 26.0 22.8 23.849999999999998 14 26.474999999999998 23.825 25.974999999999998 23.724999999999998 15 23.200000000000003 25.074999999999996 26.35 25.374999999999996 16 28.375 23.375 21.925 26.325 17 25.074999999999996 25.85 24.05 25.025 18 23.525 23.3 26.650000000000002 26.525 19 27.425 24.425 22.575 25.575 20 26.025 23.775 26.35 23.849999999999998 21 24.45 24.05 25.45 26.05 22 26.650000000000002 25.25 21.575 26.525 23 24.099999999999998 25.45 24.825 25.624999999999996 24 23.775 24.175 24.9 27.150000000000002 25 29.125 23.75 22.575 24.55 26 24.425 25.224999999999998 25.324999999999996 25.025 27 28.15 22.75 23.325000000000003 25.775 28 23.799999999999997 24.925 25.124999999999996 26.150000000000002 29 26.150000000000002 24.925 24.95 23.974999999999998 30 24.775 23.375 24.7 27.150000000000002 31 27.775 23.3 21.099999999999998 27.825 32 28.775000000000002 25.4 22.5 23.325000000000003 33 27.0 23.45 23.425 26.125 34 26.450000000000003 24.2 24.099999999999998 25.25 35 26.125 24.275 24.325 25.275 36 27.55 22.35 25.474999999999998 24.625 37 28.225 22.525000000000002 24.0 25.25 38 28.375 23.599999999999998 26.75 21.275 39 28.249999999999996 24.0 25.1 22.650000000000002 40 24.224999999999998 25.45 23.65 26.674999999999997 41 23.599999999999998 24.825 25.15 26.424999999999997 42 26.700000000000003 23.35 23.775 26.174999999999997 43 27.200000000000003 23.275000000000002 26.275 23.25 44 29.599999999999998 22.35 24.125 23.925 45 27.3 23.3 27.725 21.675 46 28.599999999999998 23.5 22.7 25.2 47 29.5 24.375 24.125 22.0 48 22.825 24.85 25.124999999999996 27.200000000000003 49 25.525 24.55 24.05 25.874999999999996 50 25.025 24.95 24.8 25.224999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 3.5 24 6.0 25 6.5 26 7.0 27 9.0 28 11.0 29 14.0 30 17.0 31 24.5 32 32.0 33 41.0 34 50.0 35 67.5 36 85.0 37 101.5 38 118.0 39 148.5 40 179.0 41 187.5 42 196.0 43 239.5 44 283.0 45 279.5 46 276.0 47 307.5 48 339.0 49 343.5 50 348.0 51 326.5 52 305.0 53 301.0 54 297.0 55 288.0 56 279.0 57 251.0 58 223.0 59 206.0 60 189.0 61 176.0 62 163.0 63 151.0 64 139.0 65 135.5 66 132.0 67 118.0 68 104.0 69 89.5 70 75.0 71 65.0 72 55.0 73 46.0 74 37.0 75 30.0 76 23.0 77 19.0 78 15.0 79 12.5 80 10.0 81 6.0 82 2.0 83 2.0 84 2.0 85 1.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36900555275113 98.425 2 0.4543160020191822 0.8999999999999999 3 0.12619888944977284 0.375 4 0.025239777889954566 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025239777889954566 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGC 8 0.2 TruSeq Adapter, Index 11 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1700069 READS because READLEN < 1 Read 1700069 spots for SRR6322345.sra Written 1700069 spots for SRR6322345.sra Rejected 1700069 READS because READLEN < 1 Read 1700069 spots for SRR6322345.sra Written 1700069 spots for SRR6322345.sra Rejected 1700069 READS because READLEN < 1 Read 1700069 spots for SRR6322345.sra Written 1700069 spots for SRR6322345.sra Rejected 1700069 READS because READLEN < 1 Read 1700069 spots for SRR6322345.sra Written 1700069 spots for SRR6322345.sra Rejected 1700069 READS because READLEN < 1 Read 1700069 spots for SRR6322345.sra Written 1700069 spots for SRR6322345.sra Rejected 1700069 READS because READLEN < 1 Read 1700069 spots for SRR6322345.sra Written 1700069 spots for SRR6322345.sra Rejected 1700069 READS because READLEN < 1 Read 1700069 spots for SRR6322345.sra Written 1700069 spots for SRR6322345.sra Rejected 1700069 READS because READLEN < 1 Read 1700069 spots for SRR6322345.sra Written 1700069 spots for SRR6322345.sra Rejected 1700069 READS because READLEN < 1 Read 1700069 spots for SRR6322345.sra Written 1700069 spots for SRR6322345.sra Rejected 1700069 READS because READLEN < 1 Read 1700069 spots for SRR6322345.sra Written 1700069 spots for SRR6322345.sra Rejected 1700069 READS because READLEN < 1 Read 1700069 spots for SRR6322345.sra Written 1700069 spots for SRR6322345.sra Rejected 1700069 READS because READLEN < 1 Read 1700069 spots for SRR6322345.sra Written 1700069 spots for SRR6322345.sra Rejected 1700069 READS because READLEN < 1 Read 1700069 spots for SRR6322345.sra Written 1700069 spots for SRR6322345.sra Rejected 1700069 READS because READLEN < 1 Read 1700069 spots for SRR6322345.sra Written 1700069 spots for SRR6322345.sra Rejected 1700069 READS because READLEN < 1 Read 1700069 spots for SRR6322345.sra Written 1700069 spots for SRR6322345.sra Rejected 1700069 READS because READLEN < 1 Read 1700069 spots for SRR6322345.sra Written 1700069 spots for SRR6322345.sra Rejected 1700069 READS because READLEN < 1 Read 1700069 spots for SRR6322345.sra Written 1700069 spots for SRR6322345.sra Rejected 1700069 READS because READLEN < 1 Read 1700069 spots for SRR6322345.sra Written 1700069 spots for SRR6322345.sra Rejected 1700071 READS because READLEN < 1 Read 1700071 spots for SRR6322345.sra Written 1700071 spots for SRR6322345.sra Rejected 1700069 READS because READLEN < 1 Read 1700069 spots for SRR6322345.sra Written 1700069 spots for SRR6322345.sra SRR ids: ['SRR6322345.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wcgufypo SRR6322345.sra spots: 34001382 blocks: [[1, 1700069], [1700070, 3400138], [3400139, 5100207], [5100208, 6800276], [6800277, 8500345], [8500346, 10200414], [10200415, 11900483], [11900484, 13600552], [13600553, 15300621], [15300622, 17000690], [17000691, 18700759], [18700760, 20400828], [20400829, 22100897], [22100898, 23800966], [23800967, 25501035], [25501036, 27201104], [27201105, 28901173], [28901174, 30601242], [30601243, 32301311], [32301312, 34001382]] SRR6322345 file size 4759743 SRR6322345 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322345 SRR6322345_1.fastq Input file: SRR6322345_1.fastq trimmed: SRR6322345-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:35:04 2024 >> started Sat Dec 7 09:35:26 2024 >> done (21.951s) 34001382 reads processed; of these: 532 ( 0.00%) short reads filtered out after trimming by size control 165071 ( 0.49%) empty reads filtered out after trimming by size control 33835779 (99.51%) reads available; of these: 2283 ( 0.01%) trimmed reads available after processing 33833496 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 2268 0.01% 50 33833496 99.99% 33835779 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=22 prefix-density=0.11 prefix-fanout=2.3 sequence=TTAGGCATGGGCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=44.12 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=6.7 sequence=ATCTCCTTGCCAATGGTATAGTGACCGCGGGCAAAGTTGTTGGCTGCATCCTCCTTGCCACTGATGAGCTGCTCAGGGTGGAAGAGCTGGCGGTAAGTGCCAGTCCGCACCTCATCAATCACAGTGGGTTCCAGATCCACAAAGACAGCACGGG Started job on | Dec 07 09:35:37 Started mapping on | Dec 07 09:35:37 Finished on | Dec 07 09:36:03 Mapping speed, Million of reads per hour | 4684.95 Number of input reads | 33835779 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 32835054 Uniquely mapped reads % | 97.04% Average mapped length | 49.85 Number of splices: Total | 4506406 Number of splices: Annotated (sjdb) | 4369070 Number of splices: GT/AG | 4449397 Number of splices: GC/AG | 49699 Number of splices: AT/AC | 2668 Number of splices: Non-canonical | 4642 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.00% Deletion average length | 1.71 Insertion rate per base | 0.00% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 603794 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 97541 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.88% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 396931 396931 396931 N_multimapping 603794 603794 603794 N_noFeature 1272369 32128634 1486406 N_ambiguous 518689 1986 27664 UnstrandedReadsAssigned:31043996 PositiveStrandReadsAssigned:704434 NegativeStrandReadsAssigned:31320984 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322345 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322345-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,835,779 reads, 30,883,925 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52973 SRR6322345.ke.tsv 35125 SRR6322345.se.tsv 88098 total ==> SRR6322345.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 159.654 11.7 PNS24247 1044 945 34.6257 2.2475 PNS24249 1928 1829 26.458 0.88731 PNS24246 1044 945 34.6257 2.2475 PNS24248 1044 945 34.6257 2.2475 PNS24244 1471 1372 102.011 4.56062 PNS24243 293 194 0 0 KQK14069 1603 1504 0 0 KQK14071 474 375 3.00484 0.491498 ==> SRR6322345.se.tsv <== BRADI_1g14170v3 3 BRADI_1g53295v3 53 BRADI_1g59795v3 330 BRADI_1g07683v3 0 BRADI_1g00485v3 551 BRADI_1g20270v3 1632 BRADI_1g74790v3 66 BRADI_1g09890v3 64 BRADI_1g77505v3 194 BRADI_1g48960v3 0 SRR6322345 completed mapping pipeline successfully