Starting /dee2/code/volunteer_pipeline.sh SRR6322346 current disk space = 1544129761280 free memory = 1605428052 SRR6322346 SRAfilesize f3b2999cc4763016290625da8e178d5b SRR6322346.sra SRR6322346.sra file validated SRR6322346 is single end SRR6322346 is conventional basespace SRR6322346 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322346_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.69 32.0 32.0 32.0 32.0 32.0 2 25.69625 32.0 12.0 32.0 12.0 32.0 3 33.795 32.0 32.0 37.0 32.0 37.0 4 35.5 37.0 37.0 37.0 32.0 37.0 5 36.63875 37.0 37.0 37.0 37.0 37.0 6 40.10275 41.0 41.0 41.0 37.0 41.0 7 32.4105 37.0 27.0 41.0 12.0 41.0 8 38.8555 41.0 37.0 41.0 32.0 41.0 9 38.92325 41.0 41.0 41.0 32.0 41.0 10 40.256 41.0 41.0 41.0 37.0 41.0 11 40.336 41.0 41.0 41.0 41.0 41.0 12 40.1805 41.0 41.0 41.0 37.0 41.0 13 39.034 41.0 41.0 41.0 37.0 41.0 14 38.2315 41.0 37.0 41.0 32.0 41.0 15 39.64475 41.0 41.0 41.0 37.0 41.0 16 36.64775 41.0 37.0 41.0 27.0 41.0 17 39.649 41.0 41.0 41.0 37.0 41.0 18 40.4235 41.0 41.0 41.0 41.0 41.0 19 40.162 41.0 41.0 41.0 37.0 41.0 20 37.02225 41.0 37.0 41.0 27.0 41.0 21 40.02025 41.0 41.0 41.0 37.0 41.0 22 40.18075 41.0 41.0 41.0 37.0 41.0 23 38.395 41.0 41.0 41.0 32.0 41.0 24 40.02175 41.0 41.0 41.0 37.0 41.0 25 34.25125 41.0 27.0 41.0 12.0 41.0 26 37.62 41.0 37.0 41.0 27.0 41.0 27 35.3585 41.0 32.0 41.0 22.0 41.0 28 30.44975 37.0 22.0 41.0 12.0 41.0 29 38.357 41.0 37.0 41.0 32.0 41.0 30 33.96775 41.0 27.0 41.0 12.0 41.0 31 39.21825 41.0 41.0 41.0 37.0 41.0 32 28.067 32.0 12.0 41.0 12.0 41.0 33 33.86375 37.0 32.0 41.0 12.0 41.0 34 31.55575 37.0 27.0 41.0 12.0 41.0 35 36.26625 41.0 37.0 41.0 22.0 41.0 36 24.6285 22.0 12.0 37.0 12.0 41.0 37 37.82425 41.0 37.0 41.0 32.0 41.0 38 39.07675 41.0 41.0 41.0 37.0 41.0 39 33.62075 41.0 27.0 41.0 12.0 41.0 40 38.752 41.0 37.0 41.0 32.0 41.0 41 27.8845 32.0 12.0 41.0 12.0 41.0 42 38.054 41.0 37.0 41.0 32.0 41.0 43 39.85025 41.0 41.0 41.0 37.0 41.0 44 39.05625 41.0 41.0 41.0 37.0 41.0 45 34.4655 41.0 32.0 41.0 12.0 41.0 46 38.90875 41.0 41.0 41.0 37.0 41.0 47 39.64875 41.0 41.0 41.0 37.0 41.0 48 39.51725 41.0 41.0 41.0 37.0 41.0 49 39.76775 41.0 41.0 41.0 37.0 41.0 50 38.8695 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 2.0 24 3.0 25 6.0 26 12.0 27 17.0 28 32.0 29 53.0 30 72.0 31 102.0 32 126.0 33 183.0 34 277.0 35 352.0 36 500.0 37 730.0 38 832.0 39 614.0 40 86.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.725 7.775 6.1 40.400000000000006 2 27.83975659229209 8.341784989858011 34.83772819472616 28.98073022312373 3 23.5 12.5 22.575 41.425 4 30.049999999999997 19.125 20.175 30.65 5 30.9 24.0 22.85 22.25 6 26.1 28.499999999999996 23.549999999999997 21.85 7 23.075000000000003 21.95 38.475 16.5 8 22.125 22.375 30.525000000000002 24.975 9 23.200000000000003 19.575 34.425 22.8 10 22.375 33.025 25.05 19.55 11 27.800000000000004 24.75 21.9 25.55 12 24.25 24.175 25.874999999999996 25.7 13 25.15 25.525 25.0 24.325 14 25.25 24.175 24.474999999999998 26.1 15 24.975 24.525 26.400000000000002 24.099999999999998 16 26.450000000000003 23.9 23.35 26.3 17 25.25 23.799999999999997 24.725 26.224999999999998 18 24.25 24.05 25.75 25.95 19 24.45 25.05 24.175 26.325 20 28.000000000000004 23.325000000000003 24.5 24.175 21 25.374999999999996 25.025 24.125 25.474999999999998 22 24.6 24.4 25.05 25.95 23 24.875 24.325 24.775 26.025 24 22.75 25.0 26.224999999999998 26.025 25 28.15 22.3 23.849999999999998 25.7 26 24.55 22.575 25.525 27.35 27 25.224999999999998 25.074999999999996 25.174999999999997 24.525 28 30.0 23.025000000000002 22.0 24.975 29 22.975 24.675 24.725 27.625 30 26.424999999999997 23.35 23.65 26.575 31 24.75 25.2 23.95 26.1 32 31.35 22.725 24.5 21.425 33 25.174999999999997 23.3 24.4 27.125 34 25.6 24.4 24.25 25.75 35 25.474999999999998 23.25 25.624999999999996 25.650000000000002 36 30.15 24.125 25.1 20.625 37 24.625 24.425 24.45 26.5 38 23.474999999999998 24.65 24.5 27.375 39 25.8 24.375 23.875 25.95 40 24.45 24.65 25.05 25.85 41 30.275000000000002 21.975 25.75 22.0 42 23.799999999999997 24.05 25.8 26.35 43 24.625 24.15 25.7 25.525 44 24.425 25.275 24.0 26.3 45 26.575 24.775 23.150000000000002 25.5 46 24.7 24.425 24.825 26.05 47 23.724999999999998 25.974999999999998 25.7 24.6 48 25.1 24.775 25.324999999999996 24.8 49 25.374999999999996 23.925 24.474999999999998 26.224999999999998 50 25.0 24.525 25.05 25.424999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 3.5 24 5.0 25 7.5 26 10.0 27 9.5 28 9.0 29 12.0 30 15.0 31 23.0 32 31.0 33 36.0 34 41.0 35 64.0 36 87.0 37 110.0 38 133.0 39 164.5 40 196.0 41 217.0 42 238.0 43 259.5 44 281.0 45 293.0 46 305.0 47 314.5 48 324.0 49 326.5 50 329.0 51 321.0 52 313.0 53 307.5 54 302.0 55 270.5 56 239.0 57 232.5 58 226.0 59 201.0 60 176.0 61 168.0 62 160.0 63 147.5 64 135.0 65 129.0 66 123.0 67 107.0 68 91.0 69 83.0 70 75.0 71 63.5 72 52.0 73 48.5 74 45.0 75 38.0 76 31.0 77 22.5 78 14.0 79 9.5 80 5.0 81 4.5 82 4.0 83 2.5 84 1.0 85 1.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.4000000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.425 #Duplication Level Percentage of deduplicated Percentage of total 1 97.6905311778291 95.175 2 2.1041827046445984 4.1000000000000005 3 0.15396458814472672 0.44999999999999996 4 0.025660764690787787 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025660764690787787 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGC 7 0.17500000000000002 TruSeq Adapter, Index 12 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1640841 READS because READLEN < 1 Read 1640841 spots for SRR6322346.sra Written 1640841 spots for SRR6322346.sra Rejected 1640841 READS because READLEN < 1 Read 1640841 spots for SRR6322346.sra Written 1640841 spots for SRR6322346.sra Rejected 1640841 READS because READLEN < 1 Read 1640841 spots for SRR6322346.sra Written 1640841 spots for SRR6322346.sra Rejected 1640841 READS because READLEN < 1 Read 1640841 spots for SRR6322346.sra Written 1640841 spots for SRR6322346.sra Rejected 1640841 READS because READLEN < 1 Read 1640841 spots for SRR6322346.sra Written 1640841 spots for SRR6322346.sra Rejected 1640841 READS because READLEN < 1 Read 1640841 spots for SRR6322346.sra Written 1640841 spots for SRR6322346.sra Rejected 1640841 READS because READLEN < 1 Read 1640841 spots for SRR6322346.sra Written 1640841 spots for SRR6322346.sra Rejected 1640841 READS because READLEN < 1 Read 1640841 spots for SRR6322346.sra Written 1640841 spots for SRR6322346.sra Rejected 1640841 READS because READLEN < 1 Read 1640841 spots for SRR6322346.sra Written 1640841 spots for SRR6322346.sra Rejected 1640841 READS because READLEN < 1 Read 1640841 spots for SRR6322346.sra Written 1640841 spots for SRR6322346.sra Rejected 1640841 READS because READLEN < 1 Read 1640841 spots for SRR6322346.sra Written 1640841 spots for SRR6322346.sra Rejected 1640841 READS because READLEN < 1 Read 1640841 spots for SRR6322346.sra Written 1640841 spots for SRR6322346.sra Rejected 1640841 READS because READLEN < 1 Read 1640841 spots for SRR6322346.sra Written 1640841 spots for SRR6322346.sra Rejected 1640841 READS because READLEN < 1 Read 1640841 spots for SRR6322346.sra Written 1640841 spots for SRR6322346.sra Rejected 1640849 READS because READLEN < 1 Read 1640849 spots for SRR6322346.sra Written 1640849 spots for SRR6322346.sra Rejected 1640841 READS because READLEN < 1 Read 1640841 spots for SRR6322346.sra Written 1640841 spots for SRR6322346.sra Rejected 1640841 READS because READLEN < 1 Read 1640841 spots for SRR6322346.sra Written 1640841 spots for SRR6322346.sra Rejected 1640841 READS because READLEN < 1 Read 1640841 spots for SRR6322346.sra Written 1640841 spots for SRR6322346.sra Rejected 1640841 READS because READLEN < 1 Read 1640841 spots for SRR6322346.sra Written 1640841 spots for SRR6322346.sra Rejected 1640841 READS because READLEN < 1 Read 1640841 spots for SRR6322346.sra Written 1640841 spots for SRR6322346.sra SRR ids: ['SRR6322346.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ip0w37kt SRR6322346.sra spots: 32816828 blocks: [[1, 1640841], [1640842, 3281682], [3281683, 4922523], [4922524, 6563364], [6563365, 8204205], [8204206, 9845046], [9845047, 11485887], [11485888, 13126728], [13126729, 14767569], [14767570, 16408410], [16408411, 18049251], [18049252, 19690092], [19690093, 21330933], [21330934, 22971774], [22971775, 24612615], [24612616, 26253456], [26253457, 27894297], [27894298, 29535138], [29535139, 31175979], [31175980, 32816828]] SRR6322346 file size 4593166 SRR6322346 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322346 SRR6322346_1.fastq Input file: SRR6322346_1.fastq trimmed: SRR6322346-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:37:12 2024 >> started Sat Dec 7 09:37:38 2024 >> done (26.298s) 32816828 reads processed; of these: 517 ( 0.00%) short reads filtered out after trimming by size control 176180 ( 0.54%) empty reads filtered out after trimming by size control 32640131 (99.46%) reads available; of these: 87 ( 0.00%) trimmed reads available after processing 32640044 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 25 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 62 0.00% 50 32640044 100.00% 32640131 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=3.02 fanout-score-rank=23 prefix-density=0.13 prefix-fanout=2.5 sequence=CTCGTACTCGCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=22 fanout-score=38.01 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=6.7 sequence=ATCTCCTTGCCAATGGTATAGTGACCGCGGGCAAAGTTGTTGGCTGCATCCTCCTTGCCACTGATGAGCTGCTCAGGGTGGAAGAGCTGGCGGTAAGTGCCAGTCCGCACCTCATCAATCACAGTGGGTTCCAGATCCACAAAGACAGCACGGG Started job on | Dec 07 09:37:53 Started mapping on | Dec 07 09:37:53 Finished on | Dec 07 09:38:23 Mapping speed, Million of reads per hour | 3916.82 Number of input reads | 32640131 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 31454577 Uniquely mapped reads % | 96.37% Average mapped length | 49.85 Number of splices: Total | 4378029 Number of splices: Annotated (sjdb) | 4240623 Number of splices: GT/AG | 4324882 Number of splices: GC/AG | 46755 Number of splices: AT/AC | 2335 Number of splices: Non-canonical | 4057 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.00% Deletion average length | 1.73 Insertion rate per base | 0.00% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 616618 % of reads mapped to multiple loci | 1.89% Number of reads mapped to too many loci | 319770 % of reads mapped to too many loci | 0.98% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.74% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 568936 568936 568936 N_multimapping 616618 616618 616618 N_noFeature 1127117 30765162 1336054 N_ambiguous 503772 1957 24220 UnstrandedReadsAssigned:29823688 PositiveStrandReadsAssigned:687458 NegativeStrandReadsAssigned:30094303 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322346 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322346-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,640,131 reads, 29,344,292 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,223 rounds 52973 SRR6322346.ke.tsv 35125 SRR6322346.se.tsv 88098 total ==> SRR6322346.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 102.127 7.82911 PNS24247 1044 945 48.7452 3.30977 PNS24249 1928 1829 14.1543 0.49656 PNS24246 1044 945 48.7452 3.30977 PNS24248 1044 945 48.7452 3.30977 PNS24244 1471 1372 137.483 6.42975 PNS24243 293 194 0 0 KQK14069 1603 1504 5.0051 0.213532 KQK14071 474 375 0 0 ==> SRR6322346.se.tsv <== BRADI_1g14170v3 5 BRADI_1g53295v3 35 BRADI_1g59795v3 250 BRADI_1g07683v3 0 BRADI_1g00485v3 859 BRADI_1g20270v3 2280 BRADI_1g74790v3 51 BRADI_1g09890v3 69 BRADI_1g77505v3 148 BRADI_1g48960v3 0 SRR6322346 completed mapping pipeline successfully