Starting /dee2/code/volunteer_pipeline.sh SRR6322347 current disk space = 1544105943040 free memory = 1602715360 SRR6322347 SRAfilesize b6d7a667c707f91c0ae693e43688aa47 SRR6322347.sra SRR6322347.sra file validated SRR6322347 is single end SRR6322347 is conventional basespace SRR6322347 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6322347_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 50 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.69125 32.0 32.0 32.0 32.0 32.0 2 25.8075 32.0 12.0 32.0 12.0 32.0 3 33.6925 32.0 32.0 37.0 32.0 37.0 4 35.59125 37.0 37.0 37.0 32.0 37.0 5 36.625 37.0 37.0 37.0 37.0 37.0 6 40.06775 41.0 41.0 41.0 37.0 41.0 7 32.4575 37.0 27.0 41.0 12.0 41.0 8 38.7875 41.0 37.0 41.0 32.0 41.0 9 39.0305 41.0 41.0 41.0 37.0 41.0 10 40.19575 41.0 41.0 41.0 37.0 41.0 11 40.3645 41.0 41.0 41.0 41.0 41.0 12 40.1335 41.0 41.0 41.0 37.0 41.0 13 39.08125 41.0 41.0 41.0 37.0 41.0 14 38.047 41.0 37.0 41.0 32.0 41.0 15 39.397 41.0 41.0 41.0 37.0 41.0 16 36.584 41.0 37.0 41.0 27.0 41.0 17 39.74425 41.0 41.0 41.0 37.0 41.0 18 40.40025 41.0 41.0 41.0 41.0 41.0 19 40.1685 41.0 41.0 41.0 37.0 41.0 20 36.71325 41.0 37.0 41.0 27.0 41.0 21 39.929 41.0 41.0 41.0 37.0 41.0 22 40.08625 41.0 41.0 41.0 37.0 41.0 23 38.49325 41.0 37.0 41.0 32.0 41.0 24 40.14175 41.0 41.0 41.0 37.0 41.0 25 34.42325 41.0 32.0 41.0 12.0 41.0 26 37.756 41.0 37.0 41.0 27.0 41.0 27 35.08075 41.0 32.0 41.0 12.0 41.0 28 30.6345 37.0 22.0 41.0 12.0 41.0 29 38.30425 41.0 37.0 41.0 32.0 41.0 30 34.071 37.0 32.0 41.0 12.0 41.0 31 39.18175 41.0 41.0 41.0 37.0 41.0 32 28.8105 32.0 12.0 41.0 12.0 41.0 33 33.7525 37.0 27.0 41.0 12.0 41.0 34 31.76375 37.0 27.0 41.0 12.0 41.0 35 36.40125 41.0 37.0 41.0 22.0 41.0 36 24.667 22.0 12.0 37.0 12.0 41.0 37 37.82625 41.0 37.0 41.0 32.0 41.0 38 39.1155 41.0 41.0 41.0 37.0 41.0 39 33.7585 41.0 27.0 41.0 12.0 41.0 40 38.69875 41.0 37.0 41.0 32.0 41.0 41 27.7 32.0 12.0 41.0 12.0 41.0 42 37.9285 41.0 37.0 41.0 32.0 41.0 43 39.9 41.0 41.0 41.0 37.0 41.0 44 38.9875 41.0 41.0 41.0 37.0 41.0 45 34.364 41.0 32.0 41.0 12.0 41.0 46 38.97875 41.0 41.0 41.0 37.0 41.0 47 39.652 41.0 41.0 41.0 37.0 41.0 48 39.53975 41.0 41.0 41.0 37.0 41.0 49 39.7595 41.0 41.0 41.0 37.0 41.0 50 38.7425 41.0 41.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 5.0 26 11.0 27 22.0 28 32.0 29 44.0 30 65.0 31 101.0 32 144.0 33 204.0 34 273.0 35 336.0 36 493.0 37 763.0 38 780.0 39 619.0 40 106.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.3 7.675 6.575 43.45 2 27.64124651634153 9.526222447428427 34.58322776792501 28.24930326830504 3 23.400000000000002 14.499999999999998 23.05 39.050000000000004 4 26.525 21.099999999999998 21.4 30.975 5 28.999999999999996 25.124999999999996 25.45 20.424999999999997 6 24.5 28.9 23.925 22.675 7 22.0 22.7 37.625 17.675 8 20.724999999999998 22.8 30.975 25.5 9 19.85 23.025000000000002 33.825 23.3 10 21.875 33.575 26.3 18.25 11 26.05 26.525 23.775 23.65 12 23.1 22.725 26.825 27.35 13 21.349999999999998 27.1 28.349999999999998 23.200000000000003 14 23.5 23.875 27.025 25.6 15 23.150000000000002 24.349999999999998 25.674999999999997 26.825 16 25.25 25.650000000000002 24.075 25.025 17 24.125 26.275 26.075 23.525 18 22.400000000000002 25.775 25.525 26.3 19 23.674999999999997 25.95 24.8 25.575 20 26.325 25.2 24.6 23.875 21 24.3 23.925 26.35 25.424999999999997 22 21.825 26.05 25.650000000000002 26.474999999999998 23 22.725 25.374999999999996 26.474999999999998 25.424999999999997 24 22.425 23.974999999999998 27.0 26.6 25 27.950000000000003 25.15 23.599999999999998 23.3 26 22.25 26.450000000000003 25.25 26.05 27 23.925 24.125 25.724999999999998 26.224999999999998 28 28.575 23.35 23.25 24.825 29 23.825 25.124999999999996 25.8 25.25 30 24.725 23.599999999999998 26.625 25.05 31 22.775000000000002 24.875 24.4 27.950000000000003 32 27.800000000000004 25.124999999999996 25.224999999999998 21.85 33 23.974999999999998 24.125 25.45 26.450000000000003 34 24.375 25.224999999999998 25.324999999999996 25.074999999999996 35 23.925 24.025 26.700000000000003 25.35 36 29.525000000000002 26.55 22.95 20.974999999999998 37 24.4 25.025 25.374999999999996 25.2 38 24.2 25.1 26.700000000000003 24.0 39 25.75 23.575 25.7 24.975 40 23.575 25.55 25.45 25.424999999999997 41 29.175 23.150000000000002 25.95 21.725 42 22.525000000000002 24.625 26.224999999999998 26.625 43 24.05 25.1 25.05 25.8 44 23.225 25.1 25.650000000000002 26.025 45 25.8 23.599999999999998 24.875 25.724999999999998 46 23.549999999999997 24.65 26.35 25.45 47 23.025000000000002 27.0 26.875 23.1 48 23.200000000000003 24.175 26.275 26.35 49 23.375 24.45 26.224999999999998 25.95 50 23.575 24.55 26.224999999999998 25.650000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 2.5 24 3.0 25 7.5 26 12.0 27 13.0 28 14.0 29 16.0 30 18.0 31 29.5 32 41.0 33 56.0 34 71.0 35 85.0 36 99.0 37 125.0 38 151.0 39 180.0 40 209.0 41 246.0 42 283.0 43 311.5 44 340.0 45 351.5 46 363.0 47 348.5 48 334.0 49 334.0 50 334.0 51 322.5 52 311.0 53 294.5 54 278.0 55 267.5 56 257.0 57 226.5 58 196.0 59 178.5 60 161.0 61 143.0 62 125.0 63 120.5 64 116.0 65 100.5 66 85.0 67 76.5 68 68.0 69 55.0 70 42.0 71 38.0 72 34.0 73 26.0 74 18.0 75 19.0 76 20.0 77 13.5 78 7.0 79 5.5 80 4.0 81 3.0 82 2.0 83 1.0 84 0.0 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.675 #Duplication Level Percentage of deduplicated Percentage of total 1 97.28471683475563 94.05 2 2.3273855702094646 4.5 3 0.2844582363589346 0.8250000000000001 4 0.0517196793379881 0.2 5 0.0 0.0 6 0.02585983966899405 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02585983966899405 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC 11 0.27499999999999997 TruSeq Adapter, Index 2 (100% over 50bp) CTTGGGAAGAACATACACCTTCTTCTCATACTTGCCAGTGGACCTCTCCT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1630211 READS because READLEN < 1 Read 1630211 spots for SRR6322347.sra Written 1630211 spots for SRR6322347.sra Rejected 1630211 READS because READLEN < 1 Read 1630211 spots for SRR6322347.sra Written 1630211 spots for SRR6322347.sra Rejected 1630211 READS because READLEN < 1 Read 1630211 spots for SRR6322347.sra Written 1630211 spots for SRR6322347.sra Rejected 1630211 READS because READLEN < 1 Read 1630211 spots for SRR6322347.sra Written 1630211 spots for SRR6322347.sra Rejected 1630211 READS because READLEN < 1 Read 1630211 spots for SRR6322347.sra Written 1630211 spots for SRR6322347.sra Rejected 1630211 READS because READLEN < 1 Read 1630211 spots for SRR6322347.sra Written 1630211 spots for SRR6322347.sra Rejected 1630211 READS because READLEN < 1 Read 1630211 spots for SRR6322347.sra Written 1630211 spots for SRR6322347.sra Rejected 1630227 READS because READLEN < 1 Read 1630227 spots for SRR6322347.sra Written 1630227 spots for SRR6322347.sra Rejected 1630211 READS because READLEN < 1 Read 1630211 spots for SRR6322347.sra Written 1630211 spots for SRR6322347.sra Rejected 1630211 READS because READLEN < 1 Read 1630211 spots for SRR6322347.sra Written 1630211 spots for SRR6322347.sra Rejected 1630211 READS because READLEN < 1 Read 1630211 spots for SRR6322347.sra Written 1630211 spots for SRR6322347.sra Rejected 1630211 READS because READLEN < 1 Read 1630211 spots for SRR6322347.sra Written 1630211 spots for SRR6322347.sra Rejected 1630211 READS because READLEN < 1 Read 1630211 spots for SRR6322347.sra Written 1630211 spots for SRR6322347.sra Rejected 1630211 READS because READLEN < 1 Read 1630211 spots for SRR6322347.sra Written 1630211 spots for SRR6322347.sra Rejected 1630211 READS because READLEN < 1 Read 1630211 spots for SRR6322347.sra Written 1630211 spots for SRR6322347.sra Rejected 1630211 READS because READLEN < 1 Read 1630211 spots for SRR6322347.sra Written 1630211 spots for SRR6322347.sra Rejected 1630211 READS because READLEN < 1 Read 1630211 spots for SRR6322347.sra Written 1630211 spots for SRR6322347.sra Rejected 1630211 READS because READLEN < 1 Read 1630211 spots for SRR6322347.sra Written 1630211 spots for SRR6322347.sra Rejected 1630211 READS because READLEN < 1 Read 1630211 spots for SRR6322347.sra Written 1630211 spots for SRR6322347.sra Rejected 1630211 READS because READLEN < 1 Read 1630211 spots for SRR6322347.sra Written 1630211 spots for SRR6322347.sra SRR ids: ['SRR6322347.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rvb7ynxu SRR6322347.sra spots: 32604236 blocks: [[1, 1630211], [1630212, 3260422], [3260423, 4890633], [4890634, 6520844], [6520845, 8151055], [8151056, 9781266], [9781267, 11411477], [11411478, 13041688], [13041689, 14671899], [14671900, 16302110], [16302111, 17932321], [17932322, 19562532], [19562533, 21192743], [21192744, 22822954], [22822955, 24453165], [24453166, 26083376], [26083377, 27713587], [27713588, 29343798], [29343799, 30974009], [30974010, 32604236]] SRR6322347 file size 4563270 SRR6322347 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6322347 SRR6322347_1.fastq Input file: SRR6322347_1.fastq trimmed: SRR6322347-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 09:39:24 2024 >> started Sat Dec 7 09:39:39 2024 >> done (14.447s) 32604236 reads processed; of these: 638 ( 0.00%) short reads filtered out after trimming by size control 161845 ( 0.50%) empty reads filtered out after trimming by size control 32441753 (99.50%) reads available; of these: 98 ( 0.00%) trimmed reads available after processing 32441655 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 26 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 72 0.00% 50 32441655 100.00% 32441753 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=5.20 fanout-score-rank=18 prefix-density=0.10 prefix-fanout=4.4 sequence=CTTGATGACACCAACAGCAACTGTTTGTCTCATGTCACGCACAGCAAAACGACCAAGAGGAGGGTACATGGCGAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACGATACCAGCATCACCGTTCTTCAAGAACTTGGGCTCCTTCTCCAGCTCCTTACCAGATCGCCTGTCAATCTTGGTCACCAGCTCGGCAAACTTCACGGCAATGTGGGAGGTGTGGCAGTCCAGCACTGGGGCGTAGCCGTTGCCAATCTGACCAGGGTGGTTCATGATGATGACCTGGGAGGTGAAGTTGGCAGCCTCCTTGGCAGGGTCATCCTTGGAGTTGGATGCAACAAACCCACGCTTGAGATCCTTCACAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=14 fanout-score=137.32 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=16.9 sequence=CCTTCTTCTCCTC Started job on | Dec 07 09:39:50 Started mapping on | Dec 07 09:39:50 Finished on | Dec 07 09:40:23 Mapping speed, Million of reads per hour | 3539.10 Number of input reads | 32441753 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 30776215 Uniquely mapped reads % | 94.87% Average mapped length | 49.84 Number of splices: Total | 4894981 Number of splices: Annotated (sjdb) | 4737019 Number of splices: GT/AG | 4832882 Number of splices: GC/AG | 53867 Number of splices: AT/AC | 3362 Number of splices: Non-canonical | 4870 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.00% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1195390 % of reads mapped to multiple loci | 3.68% Number of reads mapped to too many loci | 168229 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.91% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 470148 470148 470148 N_multimapping 1195390 1195390 1195390 N_noFeature 1381596 30193169 1572786 N_ambiguous 422365 2506 30696 UnstrandedReadsAssigned:28972254 PositiveStrandReadsAssigned:580540 NegativeStrandReadsAssigned:29172733 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR6322347 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR6322347-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,441,753 reads, 28,999,454 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,223 rounds 52973 SRR6322347.ke.tsv 35125 SRR6322347.se.tsv 88098 total ==> SRR6322347.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 340.758 24.6716 PNS24247 1044 945 90.4823 5.80242 PNS24249 1928 1829 55.2826 1.83169 PNS24246 1044 945 90.4823 5.80242 PNS24248 1044 945 90.4823 5.80242 PNS24244 1471 1372 279.513 12.346 PNS24243 293 194 0 0 KQK14069 1603 1504 18.9739 0.764516 KQK14071 474 375 9.39038 1.5175 ==> SRR6322347.se.tsv <== BRADI_1g14170v3 42 BRADI_1g53295v3 76 BRADI_1g59795v3 787 BRADI_1g07683v3 0 BRADI_1g00485v3 176 BRADI_1g20270v3 2357 BRADI_1g74790v3 15 BRADI_1g09890v3 1 BRADI_1g77505v3 493 BRADI_1g48960v3 1 SRR6322347 completed mapping pipeline successfully